ID: 976841366

View in Genome Browser
Species Human (GRCh38)
Location 4:89436467-89436489
Sequence CAGAATAAACAGCACTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976841366_976841375 26 Left 976841366 4:89436467-89436489 CCTCCATAGTGCTGTTTATTCTG No data
Right 976841375 4:89436516-89436538 GAAAAACCCCACACTTCACTGGG No data
976841366_976841369 -4 Left 976841366 4:89436467-89436489 CCTCCATAGTGCTGTTTATTCTG No data
Right 976841369 4:89436486-89436508 TCTGCACCACAGAGTTCCCTGGG No data
976841366_976841376 27 Left 976841366 4:89436467-89436489 CCTCCATAGTGCTGTTTATTCTG No data
Right 976841376 4:89436517-89436539 AAAAACCCCACACTTCACTGGGG No data
976841366_976841368 -5 Left 976841366 4:89436467-89436489 CCTCCATAGTGCTGTTTATTCTG No data
Right 976841368 4:89436485-89436507 TTCTGCACCACAGAGTTCCCTGG No data
976841366_976841374 25 Left 976841366 4:89436467-89436489 CCTCCATAGTGCTGTTTATTCTG No data
Right 976841374 4:89436515-89436537 AGAAAAACCCCACACTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976841366 Original CRISPR CAGAATAAACAGCACTATGG AGG (reversed) Intergenic
No off target data available for this crispr