ID: 976843692

View in Genome Browser
Species Human (GRCh38)
Location 4:89462109-89462131
Sequence GACAAATAGAAATGGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976843692_976843695 21 Left 976843692 4:89462109-89462131 CCATGGATCCATTTCTATTTGTC No data
Right 976843695 4:89462153-89462175 ATTTTCAATGAAGTACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976843692 Original CRISPR GACAAATAGAAATGGATCCA TGG (reversed) Intergenic
No off target data available for this crispr