ID: 976843695

View in Genome Browser
Species Human (GRCh38)
Location 4:89462153-89462175
Sequence ATTTTCAATGAAGTACTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976843692_976843695 21 Left 976843692 4:89462109-89462131 CCATGGATCCATTTCTATTTGTC No data
Right 976843695 4:89462153-89462175 ATTTTCAATGAAGTACTTTGAGG No data
976843693_976843695 13 Left 976843693 4:89462117-89462139 CCATTTCTATTTGTCAGATTGTT No data
Right 976843695 4:89462153-89462175 ATTTTCAATGAAGTACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976843695 Original CRISPR ATTTTCAATGAAGTACTTTG AGG Intergenic
No off target data available for this crispr