ID: 976844189

View in Genome Browser
Species Human (GRCh38)
Location 4:89468667-89468689
Sequence ACTCCCAAATACCATGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976844189_976844199 9 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844199 4:89468699-89468721 GGGAGGTGATGAGGTCATTCGGG No data
976844189_976844201 27 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844201 4:89468717-89468739 TCGGGTGGAGCCCTCAAGAATGG No data
976844189_976844196 0 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844196 4:89468690-89468712 GGGGCCTTTGGGAGGTGATGAGG 0: 45
1: 376
2: 1200
3: 2218
4: 3598
976844189_976844195 -8 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844195 4:89468682-89468704 TTGGGAGTGGGGCCTTTGGGAGG No data
976844189_976844202 28 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844202 4:89468718-89468740 CGGGTGGAGCCCTCAAGAATGGG No data
976844189_976844198 8 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844198 4:89468698-89468720 TGGGAGGTGATGAGGTCATTCGG No data
976844189_976844200 12 Left 976844189 4:89468667-89468689 CCAAGGTCATGGTATTTGGGAGT No data
Right 976844200 4:89468702-89468724 AGGTGATGAGGTCATTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976844189 Original CRISPR ACTCCCAAATACCATGACCT TGG (reversed) Intergenic
No off target data available for this crispr