ID: 976851513

View in Genome Browser
Species Human (GRCh38)
Location 4:89552192-89552214
Sequence TTAGAATACCAGTTGAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976851511_976851513 8 Left 976851511 4:89552161-89552183 CCTAAGGGGATCCAGAAGCTGAG No data
Right 976851513 4:89552192-89552214 TTAGAATACCAGTTGAGTCAAGG No data
976851512_976851513 -3 Left 976851512 4:89552172-89552194 CCAGAAGCTGAGATGACTATTTA No data
Right 976851513 4:89552192-89552214 TTAGAATACCAGTTGAGTCAAGG No data
976851510_976851513 19 Left 976851510 4:89552150-89552172 CCTCAGCTGATCCTAAGGGGATC No data
Right 976851513 4:89552192-89552214 TTAGAATACCAGTTGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976851513 Original CRISPR TTAGAATACCAGTTGAGTCA AGG Intergenic
No off target data available for this crispr