ID: 976866794

View in Genome Browser
Species Human (GRCh38)
Location 4:89738159-89738181
Sequence TTGAATATACTAATGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976866793_976866794 -1 Left 976866793 4:89738137-89738159 CCTGTTACTTGGATAGACTCGGT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG 0: 1
1: 0
2: 3
3: 39
4: 281
976866790_976866794 13 Left 976866790 4:89738123-89738145 CCAGCTTTTTTTGTCCTGTTACT 0: 1
1: 0
2: 3
3: 46
4: 502
Right 976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG 0: 1
1: 0
2: 3
3: 39
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976866794 Original CRISPR TTGAATATACTAATGCACAA AGG Intronic
902133302 1:14282436-14282458 TTGAATACACTTGGGCACAAAGG - Intergenic
902651275 1:17839212-17839234 ATGAATATATTAATGCACTCTGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903092207 1:20931325-20931347 TTCAAAATACTACTGCACATTGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904990276 1:34586988-34587010 GGGAATATACTAATGAGCAAAGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905622917 1:39464368-39464390 TTGGATATACTAATGAAACATGG - Intronic
909153803 1:72043818-72043840 TTGCATGTACTAATACAAAATGG - Intronic
909753013 1:79187951-79187973 TGCCATGTACTAATGCACAACGG + Intergenic
909840711 1:80319470-80319492 TTGAATATATAAATGCTCTAAGG - Intergenic
910069828 1:83198736-83198758 TTAAATATAAGAATGCAGAATGG - Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
912602385 1:110949749-110949771 TCATTTATACTAATGCACAAGGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914780946 1:150784355-150784377 TTGAATATTCTAATTCATACAGG - Intergenic
916846055 1:168651358-168651380 ATTAATACTCTAATGCACAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
920069876 1:203295174-203295196 TTGAAACTACAAAGGCACAATGG + Intergenic
920090128 1:203446811-203446833 TTGACTAAACTGCTGCACAAAGG + Intergenic
920249487 1:204613950-204613972 TTGAATTTGCTAGTGCACTAGGG + Intergenic
920542848 1:206792424-206792446 GTGAATGTACTAAACCACAAAGG - Intergenic
920923300 1:210316704-210316726 TTAAATATACTAATTAAAAATGG + Intergenic
921369853 1:214410613-214410635 TTGAATTTACTTTTGTACAAAGG + Intronic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923185850 1:231572547-231572569 TTGAATACATAAATTCACAAAGG - Intronic
923355741 1:233153579-233153601 GTGAAAATGCTAATGCATAAGGG + Intronic
923824619 1:237486126-237486148 TTGAATATATGGATGCACGATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924816826 1:247449883-247449905 TTTAATGTCCTAATGCCCAAAGG - Intergenic
1063474113 10:6313602-6313624 AAGGATAAACTAATGCACAAAGG - Intergenic
1065978225 10:30863101-30863123 TTGTAAGTACAAATGCACAAGGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068888638 10:62125247-62125269 TTAAATATCATAGTGCACAAGGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072202428 10:93172654-93172676 CTGAACAGACTAATGCACTAGGG + Intergenic
1074840183 10:117343706-117343728 TTGGATTTACTAATGCTCAGGGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1078976107 11:16479226-16479248 TTCAATATAACAATGCACAAGGG + Intronic
1080509652 11:32956171-32956193 TTGATGATACCAATGTACAAAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081411312 11:42761588-42761610 TTGACTATCCTAATGTACACAGG - Intergenic
1082646371 11:55731810-55731832 TTCATTATAATCATGCACAAAGG - Intergenic
1082691578 11:56311222-56311244 TGGAATAAAATAATGCACAAAGG - Intergenic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1084647770 11:70469431-70469453 ATAAATATACTATTGCACTAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1090069782 11:123533802-123533824 GTGAATAAACTAAAGCACAGAGG + Intronic
1090178801 11:124675050-124675072 TGTATTATACTAATTCACAATGG + Exonic
1090478578 11:127047345-127047367 TTGAATATACTTATGAAAAGGGG - Intergenic
1090542076 11:127717747-127717769 TAAAATACACTAATGAACAATGG + Intergenic
1090567605 11:128012382-128012404 TTGAATGTACATATACACAATGG + Intergenic
1090599236 11:128353256-128353278 ATGAATACATTAATGCACCAGGG + Intergenic
1090655060 11:128836800-128836822 TTGAATATAATAATGCATCATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098484380 12:71003893-71003915 TTGAATGTACAAAGGCAAAATGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105975118 13:25466721-25466743 TTGGTAATACTAATGCACAGGGG + Intronic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109365097 13:61344177-61344199 TTGAATATATGAATGCACTTGGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109727502 13:66362814-66362836 TTGCTCATACTAATTCACAAGGG - Intronic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114761454 14:25321235-25321257 TTAAATGAACTAATGCACGAGGG - Intergenic
1114830532 14:26135984-26136006 TGGCATATAACAATGCACAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115403822 14:32993607-32993629 TTGAATATAAAAATACAAAATGG - Intronic
1116717681 14:48448392-48448414 TTGACATTACTAATGCACATGGG - Intergenic
1116826009 14:49674240-49674262 TTGACTATCATAATACACAAAGG + Intronic
1117357667 14:54941149-54941171 TAGAAGGTATTAATGCACAAAGG + Exonic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1120124380 14:80723608-80723630 CTGAATATTTTAATGCAAAAAGG - Intronic
1120418351 14:84249246-84249268 ATAAATATACTAATCCATAATGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121359504 14:93243757-93243779 TTGACTATAATAATGAAAAATGG - Intronic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1124712263 15:32024149-32024171 TTCAAAATACTAATGAAAAAAGG + Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125039701 15:35170969-35170991 TAGAATATTCTAAAACACAATGG + Intergenic
1125973203 15:43929033-43929055 TTGAAAATACTAGTGCATATAGG + Intronic
1127578930 15:60319287-60319309 ATGACAATAATAATGCACAAGGG - Intergenic
1128918476 15:71589220-71589242 TTGAATATATTAAAGGACATAGG + Intronic
1128973348 15:72129195-72129217 TTAAAAATACTAATTTACAATGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1132774462 16:1584616-1584638 TTCAAGATACTGATGCTCAAGGG + Intronic
1134607716 16:15584139-15584161 TTTAATATCCTAATGGACACTGG - Intronic
1134886650 16:17799117-17799139 TTGGATATGCCAATGCTCAAGGG + Intergenic
1135087827 16:19488922-19488944 TTGAATGAATTAATGAACAAGGG + Intronic
1137354351 16:47745321-47745343 TTGAATAAACTAATGGCCATAGG + Intergenic
1138399126 16:56731065-56731087 TTGCAAACACAAATGCACAAAGG - Intronic
1139019630 16:62731466-62731488 TTGTATAAACTAATGATCAATGG + Intergenic
1139236831 16:65348637-65348659 TTTTATATCCTAATGCCCAATGG - Intergenic
1140215797 16:73007021-73007043 TGGAATCTACAAATGCAGAACGG + Intronic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1145340832 17:21953037-21953059 TTGAATGGAATAACGCACAATGG + Intergenic
1148378518 17:47173529-47173551 TTGATTATACCAATAAACAATGG + Intronic
1151129937 17:71886226-71886248 TTGAATATATTGATGCAAAGGGG - Intergenic
1154383713 18:13874790-13874812 CTCTATATACTAATGCAGAAAGG + Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155751116 18:29423104-29423126 TTAAATAACATAATGCACAAGGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157530633 18:48417802-48417824 TAGAACAGACAAATGCACAAAGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159310778 18:66706088-66706110 TTAAATATTCTAATTCAGAAGGG - Intergenic
1159400720 18:67930317-67930339 TTGAATATACTCAAGAACAGTGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159851430 18:73530839-73530861 TTGAATAAACTAATGATCATGGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161864751 19:6825669-6825691 TTGACTATACGGATGCACACAGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931230395 2:60369654-60369676 TTGAATATTTTAATACACCAGGG - Intergenic
931702582 2:64920801-64920823 ATGAAGATAGTAATGCAGAATGG + Intergenic
931842741 2:66171470-66171492 ATGAATTTAATAATGCATAATGG + Intergenic
932819010 2:74883628-74883650 TTAATTATACTAGTGCACATGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933223790 2:79721804-79721826 TTGAAAACCATAATGCACAATGG - Intronic
934883380 2:98003551-98003573 TTGAATAAACTAAAGTACCATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935900418 2:107786326-107786348 TAGAATATAATGATGCTCAAAGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937530367 2:122820320-122820342 TTAAATATAATTATGCATAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939369777 2:141284104-141284126 TTGAAAATAAAAATGCACAGTGG + Intronic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940461631 2:153970833-153970855 TTGCATATAATAATGCAAACAGG - Intronic
942575339 2:177357185-177357207 TTGAAAATACTCTTGGACAAAGG + Intronic
942644912 2:178099633-178099655 TTGTGTATTCTAATTCACAATGG + Intronic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
944141674 2:196463521-196463543 TTGAGAATACTAATGCAGAGTGG + Intronic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944238057 2:197458271-197458293 ATGTATATACTAATACACATAGG - Intronic
944357716 2:198811771-198811793 TTGAATGAATTAATGAACAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946135487 2:217643443-217643465 TTTAATATACTAATGTGCATAGG - Intronic
1170501539 20:16979592-16979614 TTCAATATATTTTTGCACAAAGG + Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1175320717 20:58086111-58086133 ATGGATATAATAATGCACAGTGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177808950 21:25904041-25904063 TTGAAGATATTAATACACAGAGG - Intronic
1177871734 21:26580941-26580963 GAGAATAGACTAATGCACCAGGG + Intergenic
1178142009 21:29694923-29694945 TTGAATATTCTCATGCACTTTGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179321381 21:40294759-40294781 TTCCATGTAATAATGCACAATGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
950500691 3:13361741-13361763 TGGAATAGTTTAATGCACAAGGG - Intronic
952019930 3:29006282-29006304 TTAAAATTACTAATACACAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
959430336 3:106246559-106246581 TTGATAAAACTAATGCTCAAAGG + Intergenic
961758612 3:129147757-129147779 TTGACTATAGTGATGCATAAGGG - Intronic
963354013 3:144187621-144187643 TTGAATTTAGTAAAGGACAAAGG - Intergenic
964426490 3:156559744-156559766 ATGAATATCCTTAGGCACAAAGG - Intergenic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971698523 4:29937196-29937218 TTGAAAATACTATTGCAGTAAGG + Intergenic
971848765 4:31956313-31956335 TTGAATATACTAATATTAAAAGG - Intergenic
972509230 4:39752095-39752117 TTGAAAATACTAAACCACATGGG + Intronic
972939957 4:44183522-44183544 TTTAATATAATAAAGCCCAAGGG - Intronic
973259495 4:48147681-48147703 TTGAGTATAATAATGCTAAATGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973973338 4:56237294-56237316 ATGAATATATTAATGCATATTGG - Intronic
974998569 4:69193506-69193528 TGGAATCTCCTAATGCTCAAGGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
978839650 4:113196229-113196251 TTCAAGATTCTAATGCAAAAAGG + Intronic
978883402 4:113736401-113736423 TAAAATATACTAATGTAGAAAGG + Intronic
979958560 4:126988099-126988121 TAGATTATACTAATTCAAAAAGG + Intergenic
980681704 4:136170951-136170973 TTAAAGATACTAATGCACAATGG - Intergenic
980684524 4:136209337-136209359 TTGAATAAACTAATGAATAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
982607408 4:157532459-157532481 TAAAATATACTAATTCTCAATGG - Intergenic
983815228 4:172118033-172118055 TCACATATTCTAATGCACAAAGG - Intronic
984304208 4:177966193-177966215 TGGCATACACCAATGCACAATGG - Intronic
984397106 4:179216096-179216118 TGGAATAAACTACAGCACAATGG + Intergenic
985344708 4:188991503-188991525 TTGAATATATTACTGAAAAATGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986822437 5:11482403-11482425 ATGAATATACTAATGCATTCAGG - Intronic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
988259701 5:28869621-28869643 TTGATTGTACTGATGCTCAAGGG + Intergenic
989111589 5:37912028-37912050 GAAAATATACTTATGCACAATGG + Intergenic
989823407 5:45823745-45823767 TTCAATATACCATTGCACAGAGG - Intergenic
990012587 5:51018452-51018474 TTAAATAGAATAAGGCACAATGG - Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992979676 5:82155931-82155953 TTGAATATAATAATTGATAAAGG + Intronic
993417005 5:87647702-87647724 TGGAATATGCCAAGGCACAAGGG + Intergenic
993780900 5:92064117-92064139 ATGAATCTACTACTCCACAATGG + Intergenic
994402181 5:99295143-99295165 TTAAATATATTAATGAAAAATGG + Intergenic
995369060 5:111398172-111398194 TTTAATATGCTAATGCAAGATGG - Intronic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999562413 5:152819034-152819056 TTGATTCTATTAATGCACCAAGG + Intergenic
1000036220 5:157450271-157450293 TTTAATATGCTAATGTACAATGG + Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005369989 6:25122451-25122473 TTGAAGAAATTAAAGCACAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006765598 6:36502408-36502430 TAAAAAATACTAATGGACAAAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009433476 6:63592006-63592028 TTGAATATACTTTTGCAGCAGGG - Intergenic
1010409667 6:75546558-75546580 TTGAATATATTAGTGCACTTGGG - Intergenic
1011001889 6:82599488-82599510 TTGAATAAACATAAGCACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011623349 6:89263413-89263435 TTGGATTTTCTACTGCACAAGGG + Intronic
1012663691 6:101938596-101938618 TTTAATTGCCTAATGCACAAAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017484105 6:154887177-154887199 ATGAATTTACTAAAGCACATGGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020809768 7:12837248-12837270 TTGATGATAGAAATGCACAATGG + Intergenic
1020918348 7:14227654-14227676 TTTAATATACTCCAGCACAAAGG - Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021964235 7:25901881-25901903 TTGAAAATAATAAAGCACTAAGG + Intergenic
1023037153 7:36142026-36142048 TTTAATTTACTAATGTGCAAGGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1027287601 7:76663896-76663918 TTAAATATAAGAATGCAGAATGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028817530 7:95164312-95164334 TTGTAAATATTAATGGACAATGG - Intronic
1030791011 7:113729159-113729181 TTGAAGTTAGTATTGCACAAAGG + Intergenic
1031652656 7:124309799-124309821 TTGAAGACACTAAGGCCCAAAGG - Intergenic
1032880952 7:136089910-136089932 TTAAATATACTCATTTACAATGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035793266 8:2327239-2327261 TTCAATATACTCATGTGCAACGG + Intergenic
1035799538 8:2394466-2394488 TTCAATATACTCATGTGCAACGG - Intergenic
1038854616 8:31317780-31317802 TTGAAATTACTAATCAACAAAGG - Intergenic
1039730559 8:40271740-40271762 TTGAATATCCATATCCACAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040625709 8:49147560-49147582 TTAAATATACTAACACACAGTGG - Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041301180 8:56413410-56413432 TTGAATATAGAAATGCAAATTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1046838771 8:118833102-118833124 TTGAATTTTCTATTGCACAGGGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047707666 8:127516738-127516760 TTCACTATCCTAATTCACAATGG - Intergenic
1048200052 8:132365195-132365217 TTGAACAAATTAATGAACAAAGG + Intronic
1048696521 8:137034630-137034652 TTGAAAATAGAAATGCACACAGG + Intergenic
1050570115 9:6928958-6928980 TTGGTTTTACTAAAGCACAAGGG - Intronic
1050829751 9:9996341-9996363 TTTAATATCCTAATTCACTATGG - Intronic
1050837052 9:10095858-10095880 TTGAATATATTAAAGCACAAGGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051071737 9:13177275-13177297 ATGAACATACTATTGCATAAAGG + Intronic
1051639789 9:19213938-19213960 TTGAATATGTTAATTCTCAATGG - Intergenic
1055481774 9:76715491-76715513 TTGCACATACGAATCCACAAAGG + Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1058414605 9:104774567-104774589 TTAAATATAGTAAGGCTCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1187424714 X:19166749-19166771 TTGAATTAACTGATGCACATGGG + Intergenic
1187538597 X:20167589-20167611 TTGAATATCTTCACGCACAAGGG - Exonic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188804897 X:34575944-34575966 TTTAATGTACTAATTCATAAAGG - Intergenic
1189427105 X:40911419-40911441 TTAAATACATTACTGCACAATGG + Intergenic
1189859486 X:45258350-45258372 TTGAATATAAGAACGCACAATGG + Intergenic
1190374357 X:49774733-49774755 TTGAATATACTGGTTCACACTGG + Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1192730265 X:73795971-73795993 TGGAATAGACTAATGTATAATGG + Intergenic
1192975741 X:76282585-76282607 CTTAATAGACTAATGCAAAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193168580 X:78309939-78309961 TTAAATATACTGTTGTACAAAGG + Intronic
1194043160 X:88969053-88969075 CTGTATATACTTATGCACAGAGG - Intergenic
1194051626 X:89076498-89076520 TTGAATAAACTACTGAAAAAAGG - Intergenic
1194681074 X:96853563-96853585 TTGAATACATTAATGGAAAATGG - Intronic
1195054102 X:101126065-101126087 TTGAATCGAATACTGCACAAAGG - Intronic
1198055987 X:132995332-132995354 TAGATTATATTAATGAACAATGG + Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202186691 Y:22192796-22192818 TTTCATAAAATAATGCACAAAGG - Intergenic
1202204668 Y:22393600-22393622 TTTCATAAAATAATGCACAAAGG + Intronic