ID: 976870405

View in Genome Browser
Species Human (GRCh38)
Location 4:89786260-89786282
Sequence ACCATAGGCAATAAACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976870405 Original CRISPR ACCATAGGCAATAAACAATG GGG (reversed) Intronic
903656541 1:24952229-24952251 ACCATGGGCTATAAGCACTGTGG - Intronic
906506959 1:46387493-46387515 ACCATTACCCATAAACAATGAGG + Intergenic
907024178 1:51099032-51099054 ACCAAAGGCCAGAAAGAATGTGG + Intergenic
909195257 1:72612486-72612508 ATGAAAGGCACTAAACAATGGGG + Intergenic
911773105 1:101772633-101772655 ACCAAAGTCAATAAGCAAAGAGG - Intergenic
911843416 1:102715525-102715547 ACCCTAGGCTAGAAACAATTTGG + Intergenic
912213617 1:107582384-107582406 ACAATAAGCAGTAAACAATAGGG - Intronic
916726700 1:167529888-167529910 CCCATAGGCAGTTCACAATGTGG + Intronic
919104442 1:193131451-193131473 ACTATAGGAAATAAAGAGTGGGG - Intronic
923965858 1:239138431-239138453 ACCATAGGCAATAATCATTCAGG - Intergenic
1064110337 10:12533260-12533282 ACCACTGCCAATAAACAAAGTGG - Intronic
1064501118 10:15974429-15974451 TCCACAGGGAATAAACGATGTGG - Intergenic
1069266947 10:66471102-66471124 ACCATGGACAATAAACAATGGGG - Intronic
1071717866 10:88115033-88115055 AACACAGGCAATAAACAAGAGGG - Intergenic
1072155736 10:92722129-92722151 AGCATAGGCAAGAAACTTTGTGG + Intergenic
1073168765 10:101483019-101483041 ACCATATTCAATAAATAATAAGG - Intronic
1075661023 10:124196575-124196597 ACATTATGCCATAAACAATGGGG + Intergenic
1078039706 11:7848601-7848623 ACCATACGAAAAAAAAAATGTGG - Intergenic
1078632617 11:13017143-13017165 AACATAGGCAATTAACAAAAGGG - Intergenic
1079863148 11:25699702-25699724 ATCATAGTCAAAACACAATGTGG - Intergenic
1081199635 11:40200646-40200668 ACCAAAGGTAATAAACTACGGGG - Intronic
1081468302 11:43345689-43345711 ACTCTAGGCAAGAAATAATGGGG - Intergenic
1082234170 11:49802692-49802714 TCCATCTGTAATAAACAATGAGG + Intergenic
1086595511 11:88566412-88566434 ACTATAGGCAACAAAGAATTGGG + Intronic
1088404308 11:109456079-109456101 TACATGGGCAATAAACAATAGGG - Intergenic
1090588058 11:128235732-128235754 ACCAAAGGCAATATAAAATCTGG + Intergenic
1090881546 11:130836642-130836664 ACCATAGAAAATAAAAAGTGGGG + Intergenic
1091462319 12:653685-653707 ACCAAAGGCAAAAAAAAAAGTGG + Intronic
1092959104 12:13578960-13578982 ACCAGGGGCTATAAATAATGTGG + Intronic
1093555150 12:20463932-20463954 ACCATATGGTATAAAGAATGTGG + Intronic
1097922791 12:65094727-65094749 ACCAAATGCAATAAATAAAGAGG + Intronic
1099260855 12:80381049-80381071 TACATAGGAAGTAAACAATGAGG + Intergenic
1099316484 12:81089090-81089112 ACTATAAGCAATGAATAATGTGG - Intronic
1101151420 12:101886077-101886099 ACCAAAGTCAATGAACAATGAGG - Intronic
1105673206 13:22642950-22642972 ACCAAAGGAAATAAAGAAGGGGG + Intergenic
1106441651 13:29779147-29779169 GCTATAGGAAATAAACAAGGTGG - Intronic
1108312438 13:49208524-49208546 ACCACATGCAATCAACAATTTGG - Exonic
1109078918 13:57872851-57872873 CCCACAGGCAATAAATAATCAGG - Intergenic
1109753533 13:66727402-66727424 AAGATAGGCAATGAACAATGGGG - Intronic
1116609940 14:47055769-47055791 GCCATAGGCAATAAATAAATGGG - Intronic
1117276822 14:54202533-54202555 ACCATAGACTATAAACACTGTGG + Intergenic
1122677269 14:103425908-103425930 CTCATAGGGAATAAATAATGTGG + Intronic
1202947509 14_KI270726v1_random:42095-42117 ACCACAGACAATAAAGAAAGAGG - Intergenic
1125101428 15:35917455-35917477 AGCATAGGCAAAAGATAATGAGG - Intergenic
1131502358 15:92980905-92980927 ACCTCAGGTAATTAACAATGAGG + Exonic
1134011508 16:10856977-10856999 ACCATAGACAGTAAACACAGAGG + Intergenic
1135845342 16:25913502-25913524 ACCAAAGGCCATAAACTGTGTGG - Intronic
1136511925 16:30743468-30743490 ACTATTGGCAAGAAACAGTGAGG - Intronic
1144542251 17:16155768-16155790 ACCATAGGCAAGGAGGAATGGGG - Intronic
1146813232 17:35920843-35920865 AACATAAGAAATAAAAAATGTGG + Intronic
1148036182 17:44662032-44662054 ACCATAGACAATAAACAAATGGG - Intronic
1150406019 17:64901250-64901272 AACATAAGAAATAAAAAATGTGG + Intronic
1150609524 17:66722795-66722817 ATCATAGCCAATAAACTGTGAGG + Intronic
1152966601 18:121259-121281 ACCATGGGCAATCAACAGTAAGG - Intergenic
1155378850 18:25194432-25194454 AACATAGGCAGTAATCCATGAGG + Intronic
1156322680 18:36042075-36042097 ACCAAAGGCCTTAAACAAAGAGG + Intronic
1156544869 18:37954582-37954604 AGAAGAGGCAAAAAACAATGAGG - Intergenic
1157025039 18:43832437-43832459 ACCAGAAACAATAAACACTGAGG - Intergenic
1161700219 19:5790368-5790390 AACATAGTCAATAAACACTGGGG + Intronic
1163152069 19:15421501-15421523 ACCACATGCAATAAACAAGAAGG + Exonic
925778988 2:7362561-7362583 ACCATAGGCCATAACCAGAGAGG - Intergenic
926638580 2:15210458-15210480 AAGACAGGCAATAAACAATGCGG + Intronic
928675986 2:33652068-33652090 ACCAGAGGCAATACACATAGAGG - Intergenic
928897347 2:36280801-36280823 ATCAAAGGCAAGATACAATGGGG + Intergenic
929037571 2:37709244-37709266 AACATAGGCAGTAAATTATGAGG + Intronic
930267594 2:49218052-49218074 ACCCTAGGCAATGAAGAGTGAGG + Intergenic
931123180 2:59243827-59243849 ACTACAGTGAATAAACAATGAGG - Intergenic
931801665 2:65765018-65765040 ACCACAGGGAAGAAACAGTGGGG + Intergenic
932050256 2:68391039-68391061 ATCATAGGCAATGAACACTTGGG + Intronic
939285733 2:140126682-140126704 AGCAAAGGCACTAAACAAAGAGG - Intergenic
940655985 2:156488510-156488532 ACCACAGGCAATTAACAACCAGG - Intronic
941157232 2:161994462-161994484 ACCACAGGCGATAAACAATTAGG - Intronic
946750073 2:222885466-222885488 TTAATAGGTAATAAACAATGTGG + Intronic
948587995 2:239032937-239032959 AACATAGGAAATAAACAAAGAGG - Intergenic
1170688642 20:18591828-18591850 GACATAGGCAGTAAACAATTGGG - Intronic
1173208292 20:41011926-41011948 ATCATAGGCAATACACCATAGGG + Intergenic
1176689538 21:9887494-9887516 ACCAAACTCAATAAAAAATGTGG - Intergenic
1177086428 21:16710901-16710923 ACCATAAGCAAGAAAGAATCAGG - Intergenic
1177096491 21:16841829-16841851 ACCACATGAAATAAACAGTGAGG + Intergenic
1181141956 22:20812290-20812312 AACATAGGTAATAATTAATGAGG - Intronic
1185044940 22:48524066-48524088 GTCAGAGGCAATAAAAAATGGGG - Intronic
953008230 3:38997788-38997810 AGCATAGGCCTTAGACAATGGGG + Intergenic
953675237 3:44996019-44996041 ACCATAGGGAGCAAACAGTGAGG - Intronic
954588506 3:51758911-51758933 TCCATAGGCTTTAAAAAATGTGG + Intergenic
955149483 3:56352873-56352895 TCCATAGGCAGCTAACAATGTGG + Intronic
955506277 3:59636275-59636297 AACAGAGGCCATAAGCAATGGGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
962064027 3:131960505-131960527 ACAATAGGCAAACAACTATGGGG - Intronic
964753537 3:160074463-160074485 ATAATAGGCAATAAAGAATAAGG + Intergenic
965893819 3:173548202-173548224 TGCAAAGGCAATAAACTATGAGG - Intronic
966910754 3:184558577-184558599 GCCTTGGGCAATAAGCAATGAGG - Intronic
974647354 4:64712635-64712657 ACCATAGGCAATACATAAATCGG - Intergenic
974937723 4:68428323-68428345 CCTATAGGCAATGAACAAAGTGG - Intergenic
976870405 4:89786260-89786282 ACCATAGGCAATAAACAATGGGG - Intronic
978098760 4:104811613-104811635 ACCATCAGCAATATACAATAGGG + Intergenic
980085913 4:128389820-128389842 ACAGTAGCCAATAAACCATGAGG - Intergenic
980443621 4:132879919-132879941 AAAATAGGCAATAACAAATGTGG + Intergenic
982510921 4:156282275-156282297 ACCATAGTCAATAATCAATTTGG - Intergenic
984009524 4:174354336-174354358 ACCATATTCAACAAACAATTTGG - Intergenic
987682107 5:21149626-21149648 AACATAGGGAAAAAAAAATGTGG - Intergenic
988446597 5:31292980-31293002 ACAATAGGAAATCAACACTGTGG + Intronic
990215476 5:53527111-53527133 ACCATATACAAAAATCAATGCGG - Intergenic
992666458 5:79014128-79014150 ACCATAGTCACTAAAAAAGGGGG + Intronic
992681542 5:79158430-79158452 AACACAGCCAGTAAACAATGTGG + Intronic
993664139 5:90674016-90674038 TCCAGAGGCACTAAGCAATGAGG - Intronic
994890770 5:105632128-105632150 AACATAGGTAATATAAAATGAGG + Intergenic
1001976281 5:176002408-176002430 TCCATATGCAAAAAAAAATGAGG + Intronic
1002241141 5:177841359-177841381 TCCATATGCAAAAAAAAATGAGG - Intergenic
1002828543 6:796420-796442 AACATAGGCAACACACAATGAGG - Intergenic
1003257327 6:4485961-4485983 TCCATAGGCACTCCACAATGTGG + Intergenic
1005047542 6:21656362-21656384 AGCATAAGGAATAAACAAGGTGG - Intergenic
1007257312 6:40538175-40538197 ACCCTAGGCATTCAACACTGTGG + Intronic
1008031970 6:46706952-46706974 AGTATAGGCAATAAACACTATGG - Intronic
1011539570 6:88415902-88415924 ACCATTACCCATAAACAATGAGG + Intergenic
1011986317 6:93451118-93451140 CACAGAGACAATAAACAATGGGG + Intergenic
1012187145 6:96233146-96233168 ACCATAGGTAAAATAAAATGAGG + Intergenic
1014917689 6:127172283-127172305 ACCATATGTATTAAACAATTTGG - Intronic
1019836834 7:3394794-3394816 TCTATAAGCAATAAACAATCTGG - Intronic
1022976559 7:35563127-35563149 ATCATATGCAATAAACAAGTAGG + Intergenic
1023190464 7:37575412-37575434 ACCACAGGCACTAGAAAATGTGG + Intergenic
1023953425 7:44866520-44866542 ACAATAGGCAATGAACAATGAGG - Intergenic
1024427865 7:49248379-49248401 ACCATAGGCAATAATCTGTGTGG + Intergenic
1027936011 7:84603524-84603546 AGCATAGGCAAGAAACTCTGGGG - Intergenic
1028385372 7:90247153-90247175 ACCACAGGCAAAAAACAAGAAGG - Intronic
1028480941 7:91303890-91303912 GCCATAGGCAATCTCCAATGAGG - Intergenic
1029028518 7:97443801-97443823 TCCATAGGCAATTAACAAGTGGG + Intergenic
1030783748 7:113634247-113634269 GGCATTGGAAATAAACAATGAGG - Intergenic
1033840029 7:145361438-145361460 ACAATAGGCAAACAACTATGAGG + Intergenic
1043775914 8:84268033-84268055 AGAATAGGTAATAAACAATATGG + Intronic
1045832666 8:106482564-106482586 ACCATGGGCCAAAAACTATGCGG - Intronic
1047800032 8:128299339-128299361 ACAATAGTCAATAAAGAAGGCGG + Intergenic
1047977948 8:130150207-130150229 ATCTTAGCCACTAAACAATGTGG + Intronic
1050817237 9:9831063-9831085 ACCATAGGCTATAATAAATAAGG - Intronic
1051382679 9:16474344-16474366 AAAATAGGCAAGAGACAATGAGG + Intronic
1058332086 9:103775586-103775608 ACAATAAACAATAAACAATAAGG - Intergenic
1059049993 9:110914019-110914041 ACCAAAGGAAAAAAGCAATGAGG - Intronic
1061105798 9:128529431-128529453 AGGAAAGGCAATAAACGATGAGG - Intronic
1062210811 9:135362755-135362777 CCCACAGGCAGTAAACAGTGGGG + Intergenic
1186802081 X:13103515-13103537 ACCTTATGCAATAAAGAATTTGG + Intergenic
1188798204 X:34492856-34492878 ACCATAGAAAATAAACACTCTGG - Intergenic
1190972356 X:55362847-55362869 ACCATATACAATAAGGAATGTGG + Intergenic
1197500590 X:127236926-127236948 GCCCTATGCAATAAATAATGGGG - Intergenic
1197824487 X:130574364-130574386 ACTATTAACAATAAACAATGAGG - Intergenic
1201779728 Y:17706901-17706923 AGCATAAGCAATATACAATATGG - Intergenic
1201821827 Y:18199091-18199113 AGCATAAGCAATATACAATATGG + Intergenic