ID: 976871491

View in Genome Browser
Species Human (GRCh38)
Location 4:89799365-89799387
Sequence CATTGTCACCAGAGCATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976871491_976871494 25 Left 976871491 4:89799365-89799387 CCTGCTATGCTCTGGTGACAATG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 976871494 4:89799413-89799435 ATGATAGATACTGAATTTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976871491 Original CRISPR CATTGTCACCAGAGCATAGC AGG (reversed) Intronic
901196062 1:7440344-7440366 CAATGTCCCCAGGGCAGAGCTGG + Intronic
901674466 1:10874903-10874925 CACTGTCATCAGAGCAGAACCGG - Intergenic
903575484 1:24337218-24337240 CACTGTCCCCAGAGCATAGCAGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904229113 1:29052325-29052347 AATTGTCCCCAGAGAATATCTGG - Intronic
912578152 1:110694387-110694409 CATTTTCAGCAGAGCCCAGCTGG + Intergenic
914440184 1:147698724-147698746 TATTGTCAACAGAGTACAGCAGG + Intergenic
914958077 1:152182585-152182607 AACTGTCCCCAAAGCATAGCTGG - Intergenic
921271820 1:213476595-213476617 CATTGTAAGCAGAGCATGTCAGG - Intergenic
924279728 1:242424218-242424240 CATTATCAGTAGAGCATAGTGGG - Intronic
1063752698 10:8969076-8969098 CATTATCACGAGAACAGAGCAGG + Intergenic
1064386041 10:14892617-14892639 CATTATCACCAGAATATAGAGGG - Intronic
1067234277 10:44435276-44435298 CAGTGTCCCCAAAGCATAGATGG + Intergenic
1073558840 10:104480203-104480225 CATTGTCACCAATGCAGAGCTGG - Intergenic
1075987277 10:126798845-126798867 CATTCTCTCCAGAACAAAGCAGG - Intergenic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080942114 11:36930539-36930561 CATTGACAACAAAGCAAAGCAGG - Intergenic
1081704231 11:45171470-45171492 CATTCTCTCCAAAGCATTGCTGG - Intronic
1082286118 11:50320092-50320114 CATCGTCACCAGAGTACAGCAGG + Intergenic
1087208856 11:95425704-95425726 ACTTGTCACCACAGCATAGCCGG - Intergenic
1088707151 11:112474308-112474330 CATTTCCACCAGAGCATCCCAGG - Intergenic
1088793120 11:113243996-113244018 TTTTGTCAGCAGAGCAGAGCCGG + Intronic
1088825529 11:113490652-113490674 CCTTCTCACCACAGCATTGCAGG - Intergenic
1089491483 11:118886859-118886881 CAGTGTGACCAGAGCATCACAGG + Intronic
1090395326 11:126414782-126414804 CATTATCACCCTGGCATAGCAGG + Intronic
1090919094 11:131192542-131192564 CATTTTCAACAGAGTAAAGCAGG - Intergenic
1091318950 11:134636217-134636239 CAATGTCAGCCGAGCACAGCGGG - Intergenic
1092959129 12:13579190-13579212 TATTGTTGCCAGAGCCTAGCAGG + Intronic
1094818824 12:34209521-34209543 CATCGCCACCAGAGAACAGCTGG - Intergenic
1096239366 12:49951365-49951387 CAATGATACCAGAGCAAAGCAGG + Intronic
1108745397 13:53388215-53388237 CATTCTCCCCAGAGCTCAGCGGG + Intergenic
1109737358 13:66504327-66504349 TATTGTCATCAGACCATAGAAGG - Intronic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110008406 13:70300699-70300721 CATTGTTACAATAGCAAAGCTGG + Intergenic
1110137747 13:72089270-72089292 CTTCCTCACCACAGCATAGCAGG - Intergenic
1110729415 13:78862769-78862791 CCTTCTCATCAGAGCATTGCAGG - Intergenic
1116827934 14:49690179-49690201 CATTGTCACCAGAGGCTCACAGG - Intergenic
1120410918 14:84154249-84154271 CACTGTCACCAGAACATCACAGG - Intergenic
1122347627 14:101070373-101070395 CATAGACACCAGTGCAAAGCAGG + Intergenic
1202853536 14_GL000225v1_random:36495-36517 CATCGCCACCAGAGAATGGCTGG + Intergenic
1202854631 14_GL000225v1_random:42937-42959 CATCGCCACCAGAGAATGGCTGG + Intergenic
1202862305 14_GL000225v1_random:90362-90384 CATCGCCACCAGAGAATGGCTGG - Intergenic
1202865549 14_GL000225v1_random:114843-114865 CATCGCCACCAGAGAACAGCTGG - Intergenic
1123630374 15:22256859-22256881 CATTGGCACCGGAGGATTGCAGG - Intergenic
1124159261 15:27254140-27254162 CATTGTCGCCAGTGCATTCCAGG - Intronic
1125515025 15:40313915-40313937 CAGTGTTACCAGAGCTTTGCAGG - Intergenic
1126920967 15:53523699-53523721 CATTGCCACCAGTACAGAGCTGG - Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1130754260 15:86745907-86745929 CATGGGCACCAGAGCACATCTGG + Intronic
1132636438 16:952128-952150 CAGTGTCACCAGGGCAGGGCAGG - Intronic
1135516625 16:23141050-23141072 CATTTTCACAAGATCATACCAGG + Intronic
1135838575 16:25851892-25851914 CATTGTTATCATAGCATGGCAGG - Intronic
1138368358 16:56502391-56502413 CATGGACACCAGTGCAGAGCAGG - Exonic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1142527091 17:550908-550930 CATTGGCACCAGAGCTCAGAAGG + Intronic
1146552650 17:33795060-33795082 CATGGTAATCAGAGCAAAGCTGG + Intronic
1151049809 17:70964720-70964742 CATAGGCTCCAGAGCATAGAGGG - Intergenic
1151049905 17:70965727-70965749 CATAGGCTCCAGAGCATAGAGGG - Intergenic
1153107813 18:1548562-1548584 CATTCTCACAAAAGCATAGGTGG + Intergenic
1157004692 18:43568118-43568140 CACTGTCACAAGAGCAGTGCAGG + Intergenic
1157172824 18:45423784-45423806 TATTGTCAACAAAGCAAAGCAGG + Intronic
1166888525 19:45975481-45975503 CATTGTCCCCAGAGCCAAGGGGG + Intergenic
925615322 2:5739843-5739865 CATTGTCAACAGATCATTTCGGG + Intergenic
929124508 2:38511029-38511051 CACTGTCCCCAGAGCAGAGCAGG + Intergenic
933358671 2:81248947-81248969 CATTTTCACCATAGCAAATCTGG - Intergenic
934072754 2:88400089-88400111 CATGGTCACCAGAGAAAATCTGG + Intergenic
939974776 2:148704848-148704870 TAATGTCACCAGGACATAGCTGG - Intronic
947135810 2:226975839-226975861 CATTGTCACCAATAGATAGCAGG + Intronic
1168949016 20:1783811-1783833 CATAGTGAACAGAGCATTGCTGG + Intergenic
1169667832 20:8058144-8058166 GGTTGAGACCAGAGCATAGCAGG + Intergenic
1171239206 20:23551484-23551506 CACTTTCTCCTGAGCATAGCTGG + Intergenic
1172838293 20:37886849-37886871 CTTTGTCCCCAGAGTCTAGCAGG - Intergenic
1174103322 20:48143990-48144012 CCATGTCTCCAGAGCAGAGCAGG + Intergenic
1176270641 20:64234249-64234271 CATTATCACCACAGCCTAGAGGG + Intronic
1176312006 21:5156033-5156055 CATTGTCAGCACAGCCTAGGAGG - Intergenic
1180721266 22:17910532-17910554 CATTGTCACCAGTGCCCTGCAGG - Intronic
1183076789 22:35432479-35432501 CCTTGTCAGTAGAGCAGAGCAGG + Intergenic
1184233411 22:43170372-43170394 TATAGTCACCAGTGCATGGCAGG + Intronic
1184979040 22:48082994-48083016 CATAATCACCAGATCATTGCTGG - Intergenic
1185159385 22:49213828-49213850 CATTGTCAGTAAAGCACAGCTGG - Intergenic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
950853817 3:16087133-16087155 CATTGCCACCAAAACATGGCAGG + Intergenic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
954334707 3:49909537-49909559 CATTGTCTCCCCACCATAGCAGG + Intronic
961313116 3:126016389-126016411 CATTGCCACTAGAGCTTTGCTGG - Intronic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
964391401 3:156201620-156201642 CATTGTCATCAGAGCATTGGTGG - Intronic
967820276 3:193833536-193833558 CTTTGTCAGCATAGTATAGCTGG - Intergenic
968610570 4:1555048-1555070 CATTGTCACCTGCACACAGCAGG - Intergenic
968886866 4:3339597-3339619 CATGGTCTACAGTGCATAGCTGG + Intronic
969055624 4:4400713-4400735 CTTTGTCACCAATGCATACCAGG + Intronic
972083373 4:35182352-35182374 CATTGTCATCAGAGTATTACTGG + Intergenic
972428028 4:38953464-38953486 GAATGTCACCAGTGCATAGTGGG - Intergenic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
974205879 4:58702816-58702838 CATTGTCACAAGAGCAGAATGGG + Intergenic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
983315284 4:166124538-166124560 CATTGTCCCAAGAGAACAGCTGG + Intergenic
984701023 4:182818965-182818987 CTTTGTCAACAGAGCAGGGCTGG + Intergenic
991504141 5:67306554-67306576 CATTTTCACTAGGCCATAGCTGG - Intergenic
992143046 5:73818654-73818676 CATTGTCAGCAGAGTAGAGGAGG + Intronic
998371236 5:141662991-141663013 TATTGTAACCAGAGGCTAGCAGG + Intronic
1000369928 5:160525388-160525410 TAGTGTCACCAGAGAATAGAGGG + Intergenic
1000663357 5:163963729-163963751 CAATGTCTCCAGAGTTTAGCAGG + Intergenic
1001768445 5:174273680-174273702 CATTGTCCAAAGAGCCTAGCTGG - Intergenic
1002317971 5:178356680-178356702 CATTGCCGCCGGAGCAGAGCCGG + Intronic
1004953252 6:20698662-20698684 CATTCTCATCACAGCATATCAGG + Intronic
1009334051 6:62462959-62462981 TGTTGTTACCAGACCATAGCAGG + Intergenic
1013658956 6:112275073-112275095 CATTCTCAGAAGAGCAGAGCTGG - Intergenic
1014786511 6:125625729-125625751 CACTGTCACATGACCATAGCAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1016886473 6:148964282-148964304 CATTGGCACCTTAGCATAGGAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018263759 6:161997642-161997664 CACAGTCACCACAGAATAGCAGG - Intronic
1019768541 7:2869203-2869225 CATAGTCACAGGAGCATTGCAGG + Intergenic
1023558451 7:41447589-41447611 CATTCCAGCCAGAGCATAGCAGG + Intergenic
1024203685 7:47133175-47133197 CATTGACACCTGAGCCAAGCAGG + Intergenic
1025067963 7:55874170-55874192 CATTGTTACCAGAGCGTAATTGG + Intergenic
1027004705 7:74683448-74683470 GTTTGTCACCAGAGGACAGCAGG + Intronic
1028913840 7:96237277-96237299 CATTGTCACCAAACCAAAGTCGG - Intronic
1034124870 7:148662463-148662485 CATTGTGACCGGCTCATAGCAGG - Intergenic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1040939199 8:52815473-52815495 CATTTTCTCCAGAGAATAGTTGG - Intergenic
1043355062 8:79402203-79402225 CAGTAACACCAGAGCAGAGCAGG + Intergenic
1045008757 8:97938790-97938812 TATTGTCACCAGAGGATTGCAGG - Intronic
1049053046 8:140214204-140214226 CATCGTAACCAGAACATGGCAGG - Intronic
1050436037 9:5611870-5611892 CATTGTCATCAGTGCAGAGTGGG - Intergenic
1050623767 9:7481783-7481805 CATTGTCAACAGCACAGAGCTGG - Intergenic
1051901914 9:22052277-22052299 CATGGTCCCTAGAGCATAGCAGG + Intergenic
1055545042 9:77361755-77361777 CATTCTTACCAGAGCATATGAGG + Intronic
1056110191 9:83387788-83387810 CATGGTCCCCAGACCAAAGCTGG + Intronic
1056238419 9:84619083-84619105 CCTTGTCCCCAGAGCAGAGAAGG - Intergenic
1060597667 9:124857889-124857911 CATTGTCAATAAAGCACAGCTGG - Exonic
1060892862 9:127199486-127199508 CCCTGTCACCAGTGCCTAGCAGG - Intronic
1192109680 X:68351531-68351553 CATGGTCACCAAAGCACAGCTGG + Intronic
1193573447 X:83173179-83173201 CGTTGTCACGTGATCATAGCTGG + Intergenic
1197711807 X:129676971-129676993 CAGTGTGAACAGAACATAGCAGG - Intergenic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic