ID: 976886505

View in Genome Browser
Species Human (GRCh38)
Location 4:89991268-89991290
Sequence GAGAAAAGCCCCAAATAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976886505_976886508 24 Left 976886505 4:89991268-89991290 CCATGCTATTTGGGGCTTTTCTC No data
Right 976886508 4:89991315-89991337 AATCCTTCAACCATCATACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976886505 Original CRISPR GAGAAAAGCCCCAAATAGCA TGG (reversed) Intergenic
No off target data available for this crispr