ID: 976888044

View in Genome Browser
Species Human (GRCh38)
Location 4:90009612-90009634
Sequence TCTTGAAGACAGCAGATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3384
Summary {0: 128, 1: 271, 2: 470, 3: 835, 4: 1680}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976888044_976888047 15 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888047 4:90009650-90009672 TAAGGACCCACATAAACTTAAGG 0: 5
1: 291
2: 394
3: 314
4: 294
976888044_976888051 22 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG No data
976888044_976888052 23 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888052 4:90009658-90009680 CACATAAACTTAAGGTAAAGGGG 0: 267
1: 420
2: 328
3: 241
4: 351
976888044_976888049 21 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888049 4:90009656-90009678 CCCACATAAACTTAAGGTAAAGG 0: 6
1: 326
2: 463
3: 334
4: 489
976888044_976888053 26 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888053 4:90009661-90009683 ATAAACTTAAGGTAAAGGGGTGG 0: 188
1: 446
2: 399
3: 274
4: 531
976888044_976888045 -3 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888045 4:90009632-90009654 AGAGACTCACCTGACACATAAGG 0: 38
1: 239
2: 481
3: 443
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976888044 Original CRISPR TCTTGAAGACAGCAGATACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr