ID: 976888046

View in Genome Browser
Species Human (GRCh38)
Location 4:90009641-90009663
Sequence TATGTGGGTCCTTATGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976888046_976888049 -8 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888049 4:90009656-90009678 CCCACATAAACTTAAGGTAAAGG 0: 6
1: 326
2: 463
3: 334
4: 489
976888046_976888053 -3 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888053 4:90009661-90009683 ATAAACTTAAGGTAAAGGGGTGG 0: 188
1: 446
2: 399
3: 274
4: 531
976888046_976888052 -6 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888052 4:90009658-90009680 CACATAAACTTAAGGTAAAGGGG 0: 267
1: 420
2: 328
3: 241
4: 351
976888046_976888051 -7 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG No data
976888046_976888054 20 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888054 4:90009684-90009706 AAAAAGATATTGCATGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976888046 Original CRISPR TATGTGGGTCCTTATGTGTC AGG (reversed) Intergenic
No off target data available for this crispr