ID: 976888051

View in Genome Browser
Species Human (GRCh38)
Location 4:90009657-90009679
Sequence CCACATAAACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976888044_976888051 22 Left 976888044 4:90009612-90009634 CCAAGTATCTGCTGTCTTCAAGA 0: 128
1: 271
2: 470
3: 835
4: 1680
Right 976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG No data
976888043_976888051 26 Left 976888043 4:90009608-90009630 CCAACCAAGTATCTGCTGTCTTC 0: 111
1: 283
2: 408
3: 366
4: 380
Right 976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG No data
976888046_976888051 -7 Left 976888046 4:90009641-90009663 CCTGACACATAAGGACCCACATA No data
Right 976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976888051 Original CRISPR CCACATAAACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr