ID: 976893946

View in Genome Browser
Species Human (GRCh38)
Location 4:90084699-90084721
Sequence TGTACCCTGTTCAGTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976893946_976893949 19 Left 976893946 4:90084699-90084721 CCATTAGCACTGAACAGGGTACA No data
Right 976893949 4:90084741-90084763 TAAGCTAGACCGTGGCCAAGTGG No data
976893946_976893950 20 Left 976893946 4:90084699-90084721 CCATTAGCACTGAACAGGGTACA No data
Right 976893950 4:90084742-90084764 AAGCTAGACCGTGGCCAAGTGGG No data
976893946_976893947 11 Left 976893946 4:90084699-90084721 CCATTAGCACTGAACAGGGTACA No data
Right 976893947 4:90084733-90084755 GACCACTGTAAGCTAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976893946 Original CRISPR TGTACCCTGTTCAGTGCTAA TGG (reversed) Intergenic
No off target data available for this crispr