ID: 976895160

View in Genome Browser
Species Human (GRCh38)
Location 4:90100398-90100420
Sequence CTGTGAAATTAGAAGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976895157_976895160 3 Left 976895157 4:90100372-90100394 CCCGGGAATGAGCAAGGACAGTT No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data
976895151_976895160 25 Left 976895151 4:90100350-90100372 CCCATAGTTAGTTTGGCCTGTGC No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data
976895152_976895160 24 Left 976895152 4:90100351-90100373 CCATAGTTAGTTTGGCCTGTGCC No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data
976895150_976895160 28 Left 976895150 4:90100347-90100369 CCTCCCATAGTTAGTTTGGCCTG No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data
976895155_976895160 9 Left 976895155 4:90100366-90100388 CCTGTGCCCGGGAATGAGCAAGG No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data
976895158_976895160 2 Left 976895158 4:90100373-90100395 CCGGGAATGAGCAAGGACAGTTA No data
Right 976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976895160 Original CRISPR CTGTGAAATTAGAAGCAAGA TGG Intergenic
No off target data available for this crispr