ID: 976897000

View in Genome Browser
Species Human (GRCh38)
Location 4:90125396-90125418
Sequence CATTGTAAAAAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976896994_976897000 17 Left 976896994 4:90125356-90125378 CCAGCCCTAAAAAACATTAACAT No data
Right 976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG No data
976896996_976897000 12 Left 976896996 4:90125361-90125383 CCTAAAAAACATTAACATTTCAT No data
Right 976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG No data
976896995_976897000 13 Left 976896995 4:90125360-90125382 CCCTAAAAAACATTAACATTTCA No data
Right 976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976897000 Original CRISPR CATTGTAAAAAGAAGGAGGG AGG Intergenic
No off target data available for this crispr