ID: 976897466

View in Genome Browser
Species Human (GRCh38)
Location 4:90128515-90128537
Sequence GTGCGCGCGCGCGCGCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 5, 2: 32, 3: 79, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976897464_976897466 11 Left 976897464 4:90128481-90128503 CCCAGGTTGTGTGCGTGTGTGTG 0: 2
1: 9
2: 145
3: 929
4: 4860
Right 976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG 0: 1
1: 5
2: 32
3: 79
4: 319
976897463_976897466 12 Left 976897463 4:90128480-90128502 CCCCAGGTTGTGTGCGTGTGTGT 0: 1
1: 5
2: 41
3: 331
4: 2417
Right 976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG 0: 1
1: 5
2: 32
3: 79
4: 319
976897465_976897466 10 Left 976897465 4:90128482-90128504 CCAGGTTGTGTGCGTGTGTGTGT 0: 2
1: 27
2: 370
3: 3278
4: 5981
Right 976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG 0: 1
1: 5
2: 32
3: 79
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976897466 Original CRISPR GTGCGCGCGCGCGCGCGCTC TGG Intronic
900345365 1:2207958-2207980 GTGCGCGCGCGCATGCGTGCAGG + Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901934453 1:12618045-12618067 TCGCGCGCGCTCGCTCGCTCCGG + Intergenic
902451434 1:16499166-16499188 GTGCGCGCGTGCGCGGGGGCTGG - Intergenic
904769031 1:32870808-32870830 GGCCGCTCGCGCTCGCGCTCCGG + Exonic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
904940613 1:34163317-34163339 GTGCGCGCGCCTGGGAGCTCTGG - Intronic
905231833 1:36519249-36519271 GTGCGCGCGCGCTCACGTGCAGG + Intergenic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
913323519 1:117606609-117606631 GTGCGCGCCCGCGGGAGCGCCGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915818781 1:158999084-158999106 GTGTGCGCGCGCACGCACGCAGG - Intergenic
915954949 1:160213624-160213646 GTGTGCGTGTGCGCACGCTCTGG + Exonic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920367699 1:205456798-205456820 GTGCGGGCGTGAGCGCGCGCGGG - Intergenic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
921138655 1:212285378-212285400 GTGCGCGTGTGCGCGCGCCAGGG - Intergenic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
922577049 1:226667852-226667874 GTGCGCGCGCGCGTGCGAAGTGG + Intronic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
924527466 1:244864620-244864642 GGCCGAGCGCGGGCGCGCTCCGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1069662495 10:70132743-70132765 GCGCCCGCGCGCTCTCGCTCCGG + Exonic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1070329652 10:75408277-75408299 GTGCGCGCGCTGGCCCGCGCGGG + Intergenic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071529283 10:86376921-86376943 ATGCGGGCGCGCGCGGCCTCTGG - Intergenic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1073062045 10:100738994-100739016 GTCCGCGTGCGCGCGCGCGACGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076707287 10:132308638-132308660 GAGCGCGGGCGCACGTGCTCAGG - Intronic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1083448574 11:62727273-62727295 GTGCGTGCGCTCGCTCGCGCGGG - Exonic
1083933232 11:65857372-65857394 CGGCGCGTGCGCGCACGCTCAGG - Intronic
1084128982 11:67119128-67119150 GTGCGCGTTCACGCGCGCCCGGG + Intergenic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091718273 12:2795085-2795107 GTGCCGGCGCGAGCGCACTCTGG - Exonic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096255049 12:50057715-50057737 GTCCGCCCGCCCGCGCGCGCTGG - Exonic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096994616 12:55830810-55830832 GCGCGCGCGTGCGCGCGGTGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1097989833 12:65823839-65823861 GTGCGCGCTCGCCCGCCCGCAGG + Intergenic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100613342 12:96210548-96210570 GTGTGCGTGCGCCCGCGCGCAGG - Intronic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1101641257 12:106586979-106587001 GTGCGCGCGCGCGGGCGAACGGG + Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1102651966 12:114448538-114448560 GTGCGCGCGCGCCAGGGCTTAGG - Intergenic
1102677249 12:114667322-114667344 GTGTGCGCGCTCGCGCGATTAGG - Intergenic
1103188553 12:118981528-118981550 GTGCGTGCGCGTGTGAGCTCCGG - Exonic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105243564 13:18628485-18628507 GGGGACGCGCGCGCACGCTCGGG - Intergenic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1108541951 13:51453249-51453271 GTGCGCGCGAGCGGGCGGGCGGG + Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655609 13:112066666-112066688 GCCGCCGCGCGCGCGCGCTCAGG + Intergenic
1113737709 13:112690157-112690179 GGGGCCGCGCGCGCGCGCTCTGG - Intergenic
1113806045 13:113110440-113110462 GTGCCCCCGAGCGCGCCCTCGGG + Intronic
1115851761 14:37595073-37595095 TTGGGCCCGCGCGGGCGCTCGGG - Intronic
1116186787 14:41608215-41608237 GTGCAAGTGCGCGCGCGCCCGGG + Exonic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121253097 14:92513946-92513968 GTCCCCGCGCGCGGGCGCCCCGG - Exonic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122884213 14:104703409-104703431 GTGCGCGCGCGCAGGTCCTCGGG - Exonic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1202900257 14_GL000194v1_random:32382-32404 GTGGGAGCGCGAGCGGGCTCGGG - Intergenic
1124696929 15:31870935-31870957 GCGCGCCCGCGAGCCCGCTCCGG + Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129483074 15:75843280-75843302 GCGGCCGGGCGCGCGCGCTCTGG + Exonic
1129644848 15:77420259-77420281 GTGAGCACGCGCGCGCTCACGGG + Intergenic
1130348117 15:83067287-83067309 GTGCGGGGGCGCGCGCGGTCAGG - Exonic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131263627 15:90902988-90903010 GTGCGCGCGCGGGAGGGCTCCGG + Exonic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1133020201 16:2963807-2963829 GTGCGAGCGCGTGCGTGCACTGG + Intergenic
1133513442 16:6483296-6483318 GCTCTCGCGCCCGCGCGCTCGGG + Intronic
1136245796 16:28975119-28975141 GGCCGCGCCCGCCCGCGCTCCGG - Exonic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1141054684 16:80804229-80804251 GTGCGTGTGCGCGCGGGGTCCGG + Exonic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141839760 16:86567157-86567179 GTGCGCGGGCGGCGGCGCTCGGG - Intergenic
1141990213 16:87604991-87605013 GTGCGCGCGCGTGCAGGCACAGG + Intronic
1142211794 16:88811926-88811948 GTCCCCGCGCAGGCGCGCTCGGG - Exonic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1144991568 17:19237351-19237373 GGACGCGTGCGCGCGCCCTCAGG - Exonic
1145963865 17:28903095-28903117 GTGCGCGTGCGGGTGCGCGCCGG + Intergenic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146058612 17:29593265-29593287 GTGCGCCCCCGCGCCCGCTGCGG + Intronic
1146403689 17:32519566-32519588 GTGCGCTGGCGCTCGGGCTCGGG - Intronic
1146601968 17:34225231-34225253 GTGCGCGCGTGCGCGCGTGTTGG - Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1147967247 17:44199827-44199849 CGGCACACGCGCGCGCGCTCCGG - Intronic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148388681 17:47254380-47254402 GTGAGAGCGTGCGCGCGCGCGGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160863931 19:1249109-1249131 GGCTGCGCCCGCGCGCGCTCGGG - Intronic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161752555 19:6109034-6109056 GTGTGCGCCCGCGAGCGCGCTGG + Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163681164 19:18683495-18683517 GCGCGCCCAGGCGCGCGCTCGGG - Intergenic
1164658572 19:29942447-29942469 GCGCCCGCGCGCCCGCCCTCAGG - Exonic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165349489 19:35268421-35268443 GGGCGGGCGCGCGCGAGCCCGGG - Intergenic
1165561992 19:36687823-36687845 GTGCTCCCGGGCCCGCGCTCTGG - Intronic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1167156812 19:47743607-47743629 GTGTGCGCGCGCTCACGCACCGG + Intergenic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168336526 19:55600356-55600378 GTGCGCGCGCGCGGGGGCAACGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
926820053 2:16842052-16842074 GTGCGCGCGCGGACGCACACAGG - Intergenic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929313571 2:40452155-40452177 GGGGGAGCGCGCGCGCGCCCGGG - Intronic
930158849 2:48132581-48132603 GTGCACGCGCGCGCACGCATAGG - Intergenic
930872694 2:56184420-56184442 GGGAGCGCGGGCGCGCGCGCGGG + Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
944494908 2:200296897-200296919 GTGTGCGTGCGCGCGCATTCAGG - Intergenic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
947518830 2:230828748-230828770 GTGGGCGGGCGCCTGCGCTCAGG - Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947792548 2:232876464-232876486 GCGCGCGCAGGCGAGCGCTCAGG + Intronic
949018177 2:241725294-241725316 GGGCGGGCGCGCGTGAGCTCGGG + Exonic
1169132377 20:3173010-3173032 GTGCGCGCGTGTGTGTGCTCGGG - Intronic
1169171725 20:3470942-3470964 GTACTCGCGCACGCGCGCGCCGG + Intergenic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173649049 20:44651552-44651574 GTGAGCGCGCGCGGGGGCTCCGG - Intronic
1173807477 20:45935135-45935157 TTTGGCGCGCGCGCGCGCGCCGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1175808069 20:61841765-61841787 GTGCGCGCGTGCGCGCACCGTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176619629 21:9047160-9047182 GTGGGAGCGCGAGCGGGCTCGGG - Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179133641 21:38660891-38660913 GTGTCCGTGCGCGCGCCCTCGGG + Intronic
1179150536 21:38805512-38805534 GTGCGCGCGAGTGTGCGCCCTGG - Exonic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1180215959 21:46324034-46324056 GGTCTCGCGCACGCGCGCTCTGG - Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182380397 22:29883121-29883143 GAGGACGCGCGCGCACGCTCGGG - Intergenic
1182709619 22:32312346-32312368 GTGCGCGCGCGCGTGTGATTTGG - Intergenic
1183504736 22:38202713-38202735 GTGTCCGCGCGCGCGCTCCCTGG + Intronic
1183504738 22:38202715-38202737 GTCCGCGCGCGCGCTCCCTGGGG + Intronic
1183664998 22:39242096-39242118 GTGTGCGCGCACGTGTGCTCAGG + Intronic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
951110000 3:18792006-18792028 GTGTGCGCGCGCACGCACACAGG - Intergenic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
955387620 3:58492100-58492122 GTCCCCGCGCTCGCGCTCTCCGG + Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
958641784 3:96814560-96814582 TTGCGCGCGCGCGCTCTCTCCGG + Intronic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967904164 3:194486977-194486999 GGGGGAGCGCGCGCGGGCTCAGG + Intronic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
968879833 4:3293165-3293187 GAGGGCGCGGGCGCGCGCCCCGG - Intronic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
970617442 4:17781352-17781374 GTGCACGTGCGTGCGCGCGCGGG + Exonic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
982000301 4:151015746-151015768 GTGCGCGAGCGCGAGTGCGCGGG + Intergenic
984024116 4:174522520-174522542 CTGCACGCGCGCGCGCGCAGGGG - Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984260192 4:177435779-177435801 GTGCGTGTGCGTGCACGCTCAGG - Intronic
986957645 5:13173969-13173991 GTGCACGCGCGCGCACGTGCAGG - Intergenic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
988609694 5:32712659-32712681 GTGCGCGCGGGCACTCGTTCAGG + Intronic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
989178910 5:38556772-38556794 GGCCGCGCGCCCGCGCGCGCGGG + Intronic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
992550072 5:77851553-77851575 ATACACGCGCGCGCGCGCACGGG - Intronic
993550711 5:89270424-89270446 GTGTGCGCGCGCGCGCATGCTGG - Intergenic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1001906576 5:175478515-175478537 GCGCGCGCGAGGACGCGCTCCGG + Exonic
1002488760 5:179559098-179559120 GTAAACGCGCGCGCGCGCCCGGG + Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521759 5:179796267-179796289 ACGCGAGCGCGCGCGCCCTCTGG + Exonic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1010235577 6:73572515-73572537 GTGCGGGCGCACGCACGCACTGG - Intergenic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1011281135 6:85678931-85678953 GTGCGCCTGCGGGCGCGCGCCGG - Intergenic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1012515945 6:100059382-100059404 GTGCGTGCGCGCACGCACTGAGG + Intergenic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1012986351 6:105880414-105880436 GTGCGGGGGCGCGTGTGCTCCGG - Intergenic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019025745 6:168961479-168961501 GTGCTCGCGCACGCGCGATGGGG + Intergenic
1019474537 7:1237578-1237600 GTGCGCGCGGGGGCGCGCGGCGG - Intergenic
1020253002 7:6484189-6484211 CTGCCGGCGCGCGCGCGCGCGGG + Exonic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1027592553 7:80134746-80134768 ACGTGCGCGGGCGCGCGCTCTGG + Intronic
1030394492 7:108968546-108968568 GTGCGCGCGCGCGCACTATTTGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031886596 7:127251690-127251712 GGGCGTGGGCGCGGGCGCTCGGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034349160 7:150405322-150405344 GTGCGCGCGGGGCCGCGCTGGGG + Intronic
1035747553 8:1973495-1973517 GTGGGCGCGGGCTCGGGCTCGGG + Intergenic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038644269 8:29349980-29350002 GTACGCGCCCGCTTGCGCTCCGG - Exonic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039903263 8:41767659-41767681 GTGCGCGCGGGGGCGCGGGCGGG + Intronic
1039918353 8:41875941-41875963 GTGTGCGCCCGGGCGCGCGCCGG - Intronic
1041689933 8:60678832-60678854 GTGCGGACGCGCTCGTGCTCGGG + Exonic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045918297 8:107499829-107499851 GTGCGCGCGCACGCGTGTGCTGG - Intergenic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1053435129 9:38069178-38069200 GGGCACGGGCGCGCGGGCTCCGG - Exonic
1054351487 9:64020889-64020911 GTGGGAGCGCGAGCGGGCTCGGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055308361 9:74952896-74952918 GTGCGCGCGCGCACTCTGTCTGG + Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1057708023 9:97411999-97412021 CTGCGCACGCGCGGGCGCTCCGG - Exonic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059191842 9:112333855-112333877 CTGGGGGCGCGCGCGCGCGCCGG - Intergenic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060283379 9:122228496-122228518 GTGGGAGCGCGCGCGCGAGCGGG - Intronic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1185747350 X:2583817-2583839 GTGCGCTCGTGCGGGCGCTTTGG - Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1188594242 X:31877693-31877715 GTGCACGCACGCGCGCACACAGG + Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1189322889 X:40097150-40097172 GTGGGCGGGCGGGCGCGCTGAGG - Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200068880 X:153518120-153518142 ATGCGCGTGCGCGCGCGATGCGG - Intronic
1200136842 X:153879433-153879455 GTGCACGTGCGCGTGCGCGCAGG + Intronic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic