ID: 976899094

View in Genome Browser
Species Human (GRCh38)
Location 4:90151976-90151998
Sequence ATTCCTTTACTTAATAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976899094_976899096 7 Left 976899094 4:90151976-90151998 CCAGCTCTATTAAGTAAAGGAAT 0: 1
1: 0
2: 2
3: 14
4: 193
Right 976899096 4:90152006-90152028 GAATAAGTTATATTAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976899094 Original CRISPR ATTCCTTTACTTAATAGAGC TGG (reversed) Intronic
905021926 1:34823504-34823526 ATTCCTCCACTTTATAGATCAGG - Intronic
906992891 1:50757631-50757653 ATTTCTATACTTTATAAAGCAGG + Intronic
909267929 1:73586049-73586071 ATGAGTTTACTTAATAGTGCTGG + Intergenic
910236178 1:85038632-85038654 ATTTCTTTACTTAATAGTTGAGG - Intronic
910620703 1:89250179-89250201 ATTCATTTACTTCAAAGAGGAGG + Intergenic
915166462 1:153950706-153950728 ATTCCTTCACTTAATAGATGAGG - Intronic
916124228 1:161555030-161555052 TTTCCTCTACTTAAAAGATCTGG + Intergenic
916134111 1:161636389-161636411 TTTCCTCTACTTAAAAGATCTGG + Intronic
916617445 1:166457399-166457421 ATTCTTGTAATGAATAGAGCAGG - Intergenic
918668935 1:187188613-187188635 AATCCTTTACTGTATAGAGTAGG + Intergenic
918822496 1:189272878-189272900 AATCCTTTACTTCATAGAGTAGG + Intergenic
919446872 1:197717036-197717058 ATTCATTTAATGAAAAGAGCTGG - Intronic
921339599 1:214121553-214121575 ATACATTTACTTAATATAGATGG + Intergenic
924113059 1:240719082-240719104 TTTCTTTCACTTAATACAGCAGG - Intergenic
1063402446 10:5759464-5759486 ATTCCTTGGCTGAAGAGAGCTGG + Intronic
1063963639 10:11327831-11327853 ATTCCTTTACAAACTAGAGGAGG - Intronic
1067253082 10:44606280-44606302 ATTCCTCTACAAAATAGAGGAGG - Intergenic
1068087326 10:52390847-52390869 ATTCCTTTGCTTAATAAATAAGG + Intergenic
1071386285 10:85124520-85124542 ATTCCTTTCCTAGACAGAGCTGG + Intergenic
1074584179 10:114750904-114750926 ATTCCTTTTCTTAATTGAGTAGG + Intergenic
1076476327 10:130755725-130755747 ATTCCTTTATTTGATAGAATGGG - Intergenic
1078296888 11:10080291-10080313 ACTCCTTTACTTATTCTAGCAGG - Intronic
1078598503 11:12710562-12710584 ATTCATTTATTTAATAAAGAGGG + Intronic
1079083879 11:17431722-17431744 ATTCCTAAATTTAAAAGAGCAGG + Intronic
1080914222 11:36638932-36638954 ATACCATTGCTTAATAGAGTTGG - Intronic
1081659187 11:44877501-44877523 ACTCCTTTATTTAGTTGAGCGGG - Intronic
1086325732 11:85697208-85697230 ATTTATTTATTTAATAGAGAAGG + Intronic
1087179879 11:95131359-95131381 ATTCCTTTTCTTTATCCAGCAGG - Exonic
1090144039 11:124299920-124299942 ATTTCTTTAGATAAGAGAGCTGG - Intergenic
1092518648 12:9242386-9242408 TTTCCTTTATTTAAGAGGGCTGG + Intergenic
1092655609 12:10681297-10681319 AATCCTATACATAATAGAGTGGG - Intergenic
1093409458 12:18846631-18846653 ATGCCTTTTCTAAATAGAGTTGG - Intergenic
1094459334 12:30677376-30677398 ATTGCTATACTTTATACAGCTGG - Intronic
1095193234 12:39283228-39283250 ATTCCTTTACAACAAAGAGCTGG - Intergenic
1097260227 12:57715693-57715715 TTTGCTTTAGTTATTAGAGCAGG - Intronic
1098701288 12:73630977-73630999 ATTCATTTACTTTATATAGATGG + Intergenic
1099013427 12:77319028-77319050 ATTTCTCTACTTAATAGAGGAGG - Intergenic
1101279823 12:103241324-103241346 AGTCATTTACCTAATGGAGCTGG + Intronic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1107241323 13:38238066-38238088 ATTCCTATAATTAAAAGAGAAGG + Intergenic
1111652776 13:91113457-91113479 ATTTATTTATTTAATAGAGATGG - Intergenic
1111944668 13:94651976-94651998 ACACCATTACTTGATAGAGCTGG - Intergenic
1112514319 13:100038914-100038936 ATTTATTTATTTAATAGAGAAGG + Intergenic
1112677043 13:101714056-101714078 ATTCATTTCCTTTAAAGAGCAGG + Exonic
1113531519 13:111030815-111030837 ATTACTTTACTTAAATGAGCTGG - Intergenic
1115407161 14:33030235-33030257 ATTACATAACTTAATAAAGCAGG - Intronic
1115782976 14:36791363-36791385 ATTTCTTTACTTTAAAAAGCAGG - Intronic
1117975866 14:61296155-61296177 ATTCCTTTTTCAAATAGAGCAGG + Intronic
1121067021 14:90977438-90977460 ATTCCTTTCTCAAATAGAGCTGG - Intronic
1121849775 14:97210446-97210468 ATTCCTTTCCTTTATATAACAGG + Intergenic
1122038046 14:98962566-98962588 ATTCATTTACTCAACAAAGCTGG + Intergenic
1123136883 14:106036002-106036024 ATTCCATTCCTTAATATGGCTGG + Intergenic
1126130293 15:45334400-45334422 ATTGCTTTAACCAATAGAGCAGG - Intergenic
1127929264 15:63580975-63580997 ATTTTTGTACTTAATAGAGATGG + Intronic
1129960087 15:79676218-79676240 ATTCCTGTACTCAATAGGGGAGG - Intergenic
1130424650 15:83783873-83783895 ATTCCTTTACTTCAAATATCAGG + Intronic
1131699016 15:94912647-94912669 ACTCTTTTACTGAATAGAGAAGG - Intergenic
1135242651 16:20822286-20822308 ATTTCTTTAACAAATAGAGCAGG + Intronic
1136749341 16:32618993-32619015 ATTCCATCACTTAATAGAAGTGG - Intergenic
1139110727 16:63887365-63887387 ATTCCTGTACTTAATAGTGCAGG - Intergenic
1139899925 16:70320276-70320298 GTTTCTTTATTTAATAGAGATGG + Intronic
1140433436 16:74924789-74924811 ATTTCTTTTTTTAATAGAGATGG + Intronic
1203051473 16_KI270728v1_random:878207-878229 ATTCCATCACTTAATAGAAGTGG - Intergenic
1146986285 17:37221989-37222011 ATTGCTTTAATTAATAAAGCTGG + Intronic
1147206629 17:38841956-38841978 ATTCATTTATTTAGTAGAGATGG - Intergenic
1150246642 17:63680846-63680868 TTTGCTTTACTTAACAGAGGAGG - Intronic
1150571810 17:66393436-66393458 ATTCCTCTACTAAATTGAGATGG - Intronic
1154198652 18:12284308-12284330 ATTCCTTTACCTAATTCACCAGG + Intergenic
1154282310 18:13015587-13015609 ATTCCATCACTTAATAGAAGTGG - Intronic
1154516792 18:15177300-15177322 ATTACTTTACTGAATACTGCAGG + Intergenic
1154997580 18:21655529-21655551 ATTTCTTGACTTAAGAAAGCAGG + Intronic
1155636720 18:27964780-27964802 AATCCTTTTCTTAATAGATCTGG - Intronic
1155721824 18:29023647-29023669 ATTCCTGTACTGAATAGTGTAGG + Intergenic
1156602114 18:38619807-38619829 ATTCCTTTATTTAAGGTAGCTGG - Intergenic
1156832790 18:41514973-41514995 ATTCCTTTAGCTAATAAAGATGG - Intergenic
1159299936 18:66550294-66550316 ATTGCTTAAATTATTAGAGCAGG + Intronic
1159390227 18:67783337-67783359 ATTCTTATACAAAATAGAGCAGG - Intergenic
1162616070 19:11801165-11801187 ATTTATTTATTTAATAGAGACGG - Intronic
1166710956 19:44936938-44936960 ATTACTTTACTTAATTGCGGTGG - Intergenic
1167053326 19:47093554-47093576 GCTCCTTTACTTCAGAGAGCTGG + Intronic
925590949 2:5508424-5508446 ATTCCTTTATACAAAAGAGCTGG - Intergenic
928509190 2:31985956-31985978 ATTTATATACTTAATAGAGTTGG - Intronic
930107653 2:47652752-47652774 ATTGCATTTATTAATAGAGCAGG + Intergenic
931507333 2:62944438-62944460 ATTCCTATACTGAATAGTGTAGG - Intronic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
933151826 2:78924104-78924126 AATCCTTTATTTACTTGAGCAGG - Intergenic
934065305 2:88335165-88335187 ATTCATTTATTTATTAGAGATGG - Intergenic
936541780 2:113358114-113358136 ACACCTTTATTTTATAGAGCAGG + Intergenic
936822997 2:116545840-116545862 ATTGAATTACCTAATAGAGCAGG + Intergenic
937402736 2:121599203-121599225 ATTCCTTTTCTTAACAGGGAAGG - Intronic
938042583 2:128087912-128087934 ATTTATTTATTTAATAGATCAGG - Intergenic
940960341 2:159778520-159778542 ATTTCTTTACTTGCTACAGCAGG - Intronic
941209586 2:162620836-162620858 ATTCCTTTGCTCAATAATGCAGG + Intronic
942431455 2:175915701-175915723 ATTCCTTTAATTAAGAGAAATGG - Intergenic
942849263 2:180464015-180464037 ATCCATATACTTAATAGAGAAGG - Intergenic
943033103 2:182709080-182709102 ATTCCTTCAATTCATAGAGGAGG - Intergenic
943086343 2:183316442-183316464 ATTCCTTTCCTTATTAGATTAGG - Intergenic
943474527 2:188338080-188338102 ATTCCTTTAATTTAAAGAGCAGG + Intronic
946218280 2:218203287-218203309 ATTTTTTTAATTAATAGAGATGG - Intergenic
1170169002 20:13390778-13390800 ATGACTATACTCAATAGAGCTGG - Intronic
1173139276 20:40468043-40468065 ATTAATTTTCTTAATAGAGAGGG - Intergenic
1173378155 20:42508794-42508816 ATATTTTTACTTAATAGACCTGG + Intronic
1173421100 20:42901735-42901757 CTTCCTTTCCTTAATGGGGCAGG - Intronic
1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG + Intergenic
1179116522 21:38498354-38498376 TTTCCTTACCTTAATAGTGCTGG + Intronic
1185408315 22:50670032-50670054 ATTCTTTTTCTAAATTGAGCTGG - Intergenic
949254401 3:2028490-2028512 ATTCCTTAACTTTATAGAGAAGG + Intergenic
949775703 3:7630271-7630293 ATTCCTTAGCTTAATAGAATGGG - Intronic
954165869 3:48757471-48757493 ATTCCTTAACTTAATATAAATGG + Intronic
956324610 3:68037547-68037569 ATTCTTTTACTCAATAAAGTAGG + Intronic
958901991 3:99897951-99897973 ATATCTTTTCTTAATAGAGTTGG - Intronic
959087406 3:101866133-101866155 ATTCCTTAGCTTAATTGATCTGG + Intergenic
960228961 3:115202014-115202036 ACTCCTTTGCTTAATAGATGAGG + Intergenic
961152009 3:124647074-124647096 ATTTTTTTATTTAATAGAGATGG + Intronic
963268908 3:143266501-143266523 ATTCATTTGCATAATAGAGAGGG + Exonic
963287093 3:143443929-143443951 ATTCCTTGGCTTACTAAAGCAGG + Intronic
966704006 3:182890573-182890595 ATCCCTTTACCTTATAGAGTAGG + Intronic
967305675 3:188056779-188056801 ATTCTTTTATTTAATAGATAAGG - Intergenic
968458158 4:708882-708904 ATTCCTTCCCTTACTAGAGAGGG - Intronic
970329591 4:14965860-14965882 ATTCTTCTACTCAATAAAGCAGG - Intergenic
970521265 4:16886393-16886415 ATAATTTTACTTAAAAGAGCTGG + Intronic
970755034 4:19415435-19415457 ATTCCTTTCCTGAAGATAGCTGG - Intergenic
970801757 4:19980139-19980161 AATCCTCTACTCAATAGAGAGGG - Intergenic
972311755 4:37889796-37889818 ATTTTTTTACTTAATGTAGCTGG - Intergenic
972862055 4:43181234-43181256 ATTCCTTATCTTACTAGCGCAGG + Intergenic
974034676 4:56807569-56807591 ATTTATTTATTTAATAGAGACGG + Intergenic
974608712 4:64186846-64186868 TTTGCTTTACTTAATAGAGATGG - Intergenic
975678457 4:76851242-76851264 TGTACTTTACTTAATAGAGATGG + Intergenic
976899094 4:90151976-90151998 ATTCCTTTACTTAATAGAGCTGG - Intronic
977437616 4:97019414-97019436 TTTCCTTTCCTGGATAGAGCTGG + Intergenic
977494859 4:97762275-97762297 TTTTCCTTTCTTAATAGAGCAGG + Intronic
977559751 4:98520245-98520267 ACCCCTTTGCTTAGTAGAGCTGG - Intronic
978871330 4:113581834-113581856 CTACTTTTACTTAATATAGCTGG - Intronic
979102513 4:116638379-116638401 ATTCCTTTAATAAATAGATTTGG - Intergenic
982536784 4:156616939-156616961 ATTCCTTTACTTATTAAATCTGG + Intergenic
983072969 4:163291747-163291769 ATTCCTTTCTTTAACAGACCAGG - Intergenic
983424894 4:167571056-167571078 ATTTGTTTACTTAATAAATCTGG - Intergenic
984026749 4:174551914-174551936 AGTCCGTTATTTAATAGGGCTGG + Intergenic
984428989 4:179624677-179624699 ATTTTTTTACTTCTTAGAGCAGG - Intergenic
987972563 5:24967178-24967200 ATTCTTTTATTTACTAGAGTTGG + Intergenic
987996693 5:25291564-25291586 ATTATTTTACTGAATAGAACGGG - Intergenic
988172299 5:27674138-27674160 ATCCCTTTACTTAACCCAGCAGG + Intergenic
988574417 5:32406385-32406407 ATTCTTTAACTTAATATAGCAGG - Intronic
991000629 5:61779305-61779327 ATTCCTTCATGTAACAGAGCAGG - Intergenic
991055182 5:62312656-62312678 ATTGCTTTATCTAAAAGAGCTGG - Intronic
991777995 5:70104155-70104177 AGTACTTTACTTCATAGAGTGGG + Intergenic
991870442 5:71104482-71104504 AGTACTTTACTTCATAGAGTGGG + Intergenic
991982436 5:72246745-72246767 ATTCCTTTACTTTATAGAGGAGG + Intronic
992332394 5:75730698-75730720 ATTCCTTGAGGTATTAGAGCTGG - Intergenic
992474113 5:77086119-77086141 ATTACTTTGCTTAATAGATATGG + Intronic
994993763 5:107032942-107032964 ATTCCTTTACTTAATGGCTTTGG + Intergenic
999496801 5:152107192-152107214 ATTTCTCTTCTTAAAAGAGCAGG - Intergenic
1001451282 5:171826595-171826617 ATAACTCTACTTAATACAGCTGG + Intergenic
1001991267 5:176117493-176117515 ATTCCATCACTTAATAGAAGTGG - Intronic
1002225608 5:177720643-177720665 ATTCCATCACTTAATAGAAGTGG + Intronic
1002268241 5:178050562-178050584 ATTCCATCACTTAATAGAAGTGG - Intronic
1003630827 6:7785282-7785304 ATTGCTGTAATTAATATAGCTGG + Intronic
1003999118 6:11578198-11578220 TTTTCTTCACTTAATAGAGCTGG + Exonic
1004108296 6:12687311-12687333 ATTCATTCACTCAATAGAGGAGG + Intergenic
1004184237 6:13408232-13408254 TTTCCTTTCCTTCTTAGAGCAGG + Intronic
1004470758 6:15927024-15927046 ATTTTTTTATTTAATAGAGATGG - Intergenic
1006471264 6:34230231-34230253 ATTCCGTAACCTAATGGAGCTGG + Intergenic
1008038327 6:46770915-46770937 ATCCCTTTACTCAATCAAGCTGG + Intergenic
1009317499 6:62239566-62239588 ATTCATTTATTTAATTGAGATGG - Intronic
1009358537 6:62785030-62785052 ATTCCTTTTCTTAGTAGAAAGGG - Intergenic
1011586053 6:88926398-88926420 ATTCAGTGACTTAATAGAGGTGG + Intronic
1012163406 6:95917143-95917165 ATTTATTTACTTATTAGAGATGG + Intergenic
1012835444 6:104259267-104259289 ATTTCTCTTCTCAATAGAGCAGG + Intergenic
1013565563 6:111357089-111357111 ACTCCATTACTTATTAGATCTGG - Exonic
1013937376 6:115614327-115614349 ATTCCTTTTCTTAATACACAAGG - Intergenic
1014169481 6:118262914-118262936 ATTCATTTTCTAAATAGAGATGG - Intronic
1014741129 6:125148537-125148559 ATTCCTTTAGGTGATACAGCTGG + Intronic
1016221047 6:141669830-141669852 ATTTCTTTATTTAGTAGAGATGG - Intergenic
1016269738 6:142274689-142274711 ATTCTTTTGCTTTAAAGAGCCGG + Intergenic
1017309145 6:152956449-152956471 ATTTCTTTTTTTAATAGAGACGG - Intergenic
1018609621 6:165635080-165635102 ATTCCTTTAGTAAATTGAGTGGG + Intronic
1019222808 6:170487745-170487767 TTTTCTTTACTTAATAATGCTGG - Intergenic
1019946018 7:4330027-4330049 ATTTATTTATTTAATAGAGATGG + Intergenic
1022330639 7:29375532-29375554 ATTCCCTTAATTAGTAGAGTTGG + Intronic
1024391487 7:48818129-48818151 GTTTCTTTAGTTAAGAGAGCTGG - Intergenic
1025564308 7:62413577-62413599 ATTACTGTACTGAATACAGCAGG - Intergenic
1027920442 7:84386692-84386714 ATTCCAATACTTAAGAGTGCAGG + Intronic
1029241033 7:99162732-99162754 ATTTTTTTAATTAAAAGAGCTGG - Intergenic
1030584428 7:111399855-111399877 ATTCTCTTACTTTATAGTGCTGG - Intronic
1030671973 7:112347907-112347929 ATTCCTTCACTTATTTCAGCTGG - Intergenic
1031298177 7:120031508-120031530 ATTACTTAATTCAATAGAGCTGG - Intergenic
1031330335 7:120456314-120456336 ATGCCATTACTTCATAGAGATGG - Intronic
1031371557 7:120973721-120973743 TTTCCTTTACTTTTTAGATCAGG - Intronic
1031917961 7:127580941-127580963 TTGCCTTTTCTTAAAAGAGCAGG + Exonic
1032842402 7:135724687-135724709 AATCCTGTCCTTAATACAGCTGG - Intronic
1034533032 7:151708495-151708517 ATTCCTTTGCTAAACAGAGAAGG - Intronic
1036496330 8:9273024-9273046 ATTCATTCATTTAATAGAGATGG - Intergenic
1036927736 8:12923517-12923539 AATCATTTACTTATTAGGGCAGG + Intergenic
1037205324 8:16310932-16310954 AGTACTTTACTTAATAGATTTGG + Intronic
1044091042 8:88001763-88001785 CTTCTTTTACTTAAAAGAGTTGG + Intergenic
1046183425 8:110682573-110682595 ATTTATTTACTTAATAGACAAGG + Intergenic
1046622773 8:116545658-116545680 TTTACTTTACTTAATAGAGATGG - Intergenic
1048419078 8:134259229-134259251 ATTCCCTTACATCATAGTGCTGG - Intergenic
1050384341 9:5070586-5070608 ATTTATTTATTTATTAGAGCAGG + Intronic
1053319804 9:37086651-37086673 ATTCCTTTCATAAATAGATCTGG + Intergenic
1054690280 9:68317200-68317222 ATTACTCTCCATAATAGAGCAGG + Intergenic
1055193062 9:73551368-73551390 TCTGCGTTACTTAATAGAGCAGG - Intergenic
1059705733 9:116821608-116821630 ATTCATTTACTTATTTAAGCTGG - Intronic
1060114190 9:120928018-120928040 TTCCCTTTTCTTATTAGAGCAGG - Exonic
1185980139 X:4770211-4770233 CTTTCTTTAATTAATAGACCTGG - Intergenic
1186330851 X:8531994-8532016 ATTCCTTTGATTGATAGAGAAGG - Exonic
1189339867 X:40196736-40196758 ATTGATTTACTTATTAGAGATGG - Intergenic
1193104370 X:77652414-77652436 ATTCCATTAATTAACACAGCAGG + Intronic
1193402465 X:81062263-81062285 ATTTCATTATTTAATACAGCAGG + Intergenic
1199412593 X:147541899-147541921 AGTCCTTTGCTTAATAAAGGGGG + Intergenic