ID: 976899120

View in Genome Browser
Species Human (GRCh38)
Location 4:90152317-90152339
Sequence TAACCTACACACACCAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976899120_976899121 -1 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899121 4:90152339-90152361 AAAAATTTGCCCTTAACCTGAGG 0: 1
1: 0
2: 3
3: 19
4: 204
976899120_976899125 11 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899125 4:90152351-90152373 TTAACCTGAGGCCAGGATGAAGG No data
976899120_976899127 16 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899127 4:90152356-90152378 CTGAGGCCAGGATGAAGGAATGG 0: 1
1: 1
2: 2
3: 52
4: 568
976899120_976899130 25 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899130 4:90152365-90152387 GGATGAAGGAATGGGCATACTGG 0: 1
1: 0
2: 0
3: 19
4: 188
976899120_976899128 17 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899128 4:90152357-90152379 TGAGGCCAGGATGAAGGAATGGG No data
976899120_976899122 4 Left 976899120 4:90152317-90152339 CCTTGATTGGTGTGTGTAGGTTA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 976899122 4:90152344-90152366 TTTGCCCTTAACCTGAGGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976899120 Original CRISPR TAACCTACACACACCAATCA AGG (reversed) Intronic
904349134 1:29893666-29893688 TACCCCACGCACACCAATCCAGG + Intergenic
905925757 1:41748465-41748487 TCACCTGCACAAAGCAATCAGGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907711218 1:56883604-56883626 ACACCTACACCCACCAATAAAGG - Exonic
921173771 1:212573754-212573776 AAACCTACATATGCCAATCACGG - Intronic
921480888 1:215663509-215663531 CACGCTACACACACCAACCACGG - Intronic
1068227376 10:54123472-54123494 ATACCTACTCACACCAGTCAGGG + Intronic
1069152149 10:64976561-64976583 AAACATACATACACCAAACACGG - Intergenic
1069393565 10:67963726-67963748 AAACCCTCACACACCAACCAGGG - Intronic
1070663544 10:78327830-78327852 AATACTACACACACCAACCAGGG - Intergenic
1070720729 10:78755180-78755202 TCACCTACCCACCCCAAGCAGGG - Intergenic
1074352642 10:112753001-112753023 TAAGATACACATACAAATCAGGG - Intronic
1074561010 10:114535205-114535227 TAAGCTACACTCTACAATCAAGG + Intronic
1080827338 11:35859404-35859426 TGACCCACACAGACCAATTAGGG + Intergenic
1087146334 11:94815887-94815909 TGACTTACACAGACCATTCATGG - Intronic
1087736848 11:101843655-101843677 TAACCTCCACAAACAAGTCACGG - Intronic
1087912981 11:103774846-103774868 TAAAGTACAAACACCAAACATGG + Intergenic
1089777981 11:120852323-120852345 TCACCTGCAAACACCCATCAGGG - Intronic
1089787493 11:120918477-120918499 TAACCTGCACAAACCATACATGG - Intronic
1090647013 11:128774516-128774538 TAACCTCCACACACCCACCCTGG - Intronic
1091804667 12:3347152-3347174 TTACCTGCACACAACAAACACGG - Intergenic
1095840156 12:46683946-46683968 TAAACCACATACATCAATCAGGG - Intergenic
1096916769 12:55041389-55041411 CAGCCTTCACACCCCAATCAAGG - Intergenic
1107824264 13:44313192-44313214 TAACCTGCAATCACCAGTCATGG - Intergenic
1109359379 13:61275999-61276021 GAACGTACACACATCCATCATGG - Intergenic
1110230282 13:73160913-73160935 TAACCTACACAAACTAATATAGG + Intergenic
1110413264 13:75226093-75226115 TAACCTGCAAACACAAATCACGG + Intergenic
1112079625 13:95955136-95955158 GAATCTACAAATACCAATCATGG - Intronic
1119158753 14:72435430-72435452 TAACCTGACCACACCCATCAGGG - Intronic
1119884722 14:78130595-78130617 TCACACACACACACAAATCAAGG - Intergenic
1124711857 15:32019899-32019921 TAATCAAAACACACCAAACAGGG + Intergenic
1127732554 15:61814079-61814101 TAAAATACACACAGCCATCATGG - Intergenic
1128019141 15:64374955-64374977 AAAACTACACACACCAAACTTGG - Intronic
1140632962 16:76876091-76876113 TAACTTAGACAAACCAATCTGGG - Intergenic
1141152129 16:81571692-81571714 TGTCCTACACACACCAAGGAAGG - Intronic
1142780148 17:2175287-2175309 TGACCTGCACGCACCAACCAGGG - Intronic
1144136931 17:12304269-12304291 TGAACGACACACACAAATCATGG - Intergenic
1147495627 17:40912437-40912459 TAACTTACACACATCACACAAGG - Intergenic
1152544865 17:80995347-80995369 TGACCTACCCACACCACCCAGGG - Intronic
1159864403 18:73687313-73687335 TTACCTACACACAGAAATAAAGG - Intergenic
1166211439 19:41309100-41309122 AAACCTCCACAGCCCAATCATGG + Intronic
1166586977 19:43958004-43958026 TAACCAACTGACATCAATCATGG - Intronic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
940250007 2:151664747-151664769 TAACCTACTTACATCACTCATGG + Exonic
942645798 2:178110109-178110131 TTTCCTACCCACAACAATCAAGG - Intergenic
943232338 2:185270974-185270996 TAACCATCACACACCATTCAGGG - Intergenic
1170625908 20:18029997-18030019 AAACCAACCCTCACCAATCAAGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1183017239 22:34999142-34999164 GCACACACACACACCAATCAGGG - Intergenic
1184917622 22:47582234-47582256 TGACTTACACAGACCATTCATGG - Intergenic
950767085 3:15280861-15280883 AGACACACACACACCAATCAGGG + Intronic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
961941939 3:130646996-130647018 TAACCTAAACACAACACTGATGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
965860953 3:173149497-173149519 CAACATACACAAATCAATCAAGG + Intergenic
965974291 3:174602925-174602947 CAACATACACAAATCAATCAGGG - Intronic
966167951 3:177042057-177042079 TAAACTAGACACTCCAATAAAGG - Intronic
967575809 3:191090778-191090800 TCACCAACACACACTAAACAAGG + Intergenic
969800186 4:9557923-9557945 TAACCTATTCTGACCAATCATGG + Intergenic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
983424191 4:167561306-167561328 CAACCTACACAAATCAATAAAGG - Intergenic
986037766 5:3957461-3957483 TAAACAAAACACACCAATTAAGG + Intergenic
991712413 5:69420549-69420571 AAACATACACACACAAATGAGGG - Intronic
992548539 5:77839686-77839708 TAAGCCCCACACACCACTCATGG + Intronic
999853976 5:155573303-155573325 TTAACTCCCCACACCAATCATGG + Intergenic
1004298881 6:14439178-14439200 AAACATACACACACCAAGCTGGG + Intergenic
1004558602 6:16725380-16725402 TGAACTACACACAGCAATAAAGG + Intronic
1005630782 6:27705864-27705886 AAACCTACACACACCAGGCCGGG + Intergenic
1009979640 6:70712232-70712254 TAACATACACAAATCAATCAAGG - Intronic
1012397989 6:98821902-98821924 TGACCTAAGCAGACCAATCAAGG - Intergenic
1015565705 6:134568306-134568328 CACCCTTTACACACCAATCAGGG + Intergenic
1017158284 6:151341778-151341800 AAACCCACACACACCCATCTCGG - Intronic
1018546551 6:164942906-164942928 AACCCTACACACCCCAATTAGGG + Intergenic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG + Intronic
1029800789 7:102945546-102945568 TAACCTGCAAACCCAAATCACGG - Intronic
1030265481 7:107616381-107616403 AAAAGTACACACACCAAACAGGG - Intronic
1030872462 7:114774227-114774249 TAACCTACACAAGCCCATAAAGG - Intergenic
1034959244 7:155354543-155354565 TCACCTGCACACACCACACATGG + Intergenic
1037479798 8:19293796-19293818 ACACATACACACACAAATCAAGG - Intergenic
1041124370 8:54620708-54620730 CAACCTAAACACACGAATAAGGG - Intronic
1044786824 8:95803055-95803077 AAACCTACACAGATAAATCAGGG + Intergenic
1051586707 9:18734272-18734294 TCACCTACATCCTCCAATCAAGG - Intronic
1052206752 9:25851040-25851062 TGACTTACACAGACCATTCATGG - Intergenic
1053701866 9:40701931-40701953 TGACCTAAACACACCACACAAGG - Intergenic
1053803870 9:41780918-41780940 TAATACACACACACAAATCATGG + Intergenic
1054411928 9:64825386-64825408 TGACCTAAACACACCACACAAGG - Intergenic
1056763835 9:89432660-89432682 CAACCGCCTCACACCAATCAGGG + Intronic
1056802516 9:89702391-89702413 TCACCTACACAGGCCACTCATGG - Intergenic
1056927324 9:90846049-90846071 AAACCTGCACTCACCACTCATGG - Intronic
1059398998 9:114057038-114057060 TAACACACACACACCATTTAGGG - Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1194001725 X:88437927-88437949 TCACCTACAGTCTCCAATCAGGG + Intergenic
1194894292 X:99420143-99420165 TTACCTACAGAGAACAATCATGG + Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195439052 X:104880870-104880892 TAGCCTACAAAAATCAATCATGG - Intronic
1196981236 X:121215602-121215624 TAACCTACACAAAAAAATGATGG - Intergenic
1199321557 X:146445451-146445473 TGACTTACACAAACCATTCATGG + Intergenic
1199943390 X:152646876-152646898 CACCCTACACACACCAAGGATGG + Intronic