ID: 976909179

View in Genome Browser
Species Human (GRCh38)
Location 4:90279290-90279312
Sequence GTATGCACATAGTTTTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976909179 Original CRISPR GTATGCACATAGTTTTATCT GGG Intronic
909165583 1:72220022-72220044 TTGTGCACATAGATTCATCTTGG + Intronic
909596048 1:77407390-77407412 GTATGCAACTATTTTTGTCTGGG - Intronic
910270838 1:85392255-85392277 ATATTCACATTGTATTATCTTGG + Intronic
916396318 1:164391764-164391786 GTATTCACATAGTTTCTTGTAGG + Intergenic
917174790 1:172221707-172221729 GCATGCACATAATTTTAAATAGG - Intronic
921483855 1:215693808-215693830 GTATGAACATAGTTTTTCCCTGG + Intronic
923795179 1:237147032-237147054 GTTTGCTCATAGTTTTTTCCAGG - Intronic
923802295 1:237222054-237222076 GTGTGCACATGTTTTTATCCTGG + Intronic
924840178 1:247700883-247700905 GTATGCACATATACCTATCTGGG - Intergenic
1069199560 10:65595852-65595874 GTATACACATAGGTATATATAGG + Intergenic
1071361902 10:84855422-84855444 GTATGCACTGTTTTTTATCTGGG + Intergenic
1071429831 10:85598541-85598563 GTATGGAATTAGTTTTACCTTGG + Intergenic
1072559850 10:96561951-96561973 GTATTCAAATAGTTTAATGTAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1080438875 11:32272063-32272085 GTATGAACATAGACCTATCTAGG - Intergenic
1080499481 11:32855262-32855284 ATATGCACACAAATTTATCTGGG + Exonic
1081178399 11:39957610-39957632 ATATGCACAGTGTTTTATATGGG - Intergenic
1083056290 11:59824096-59824118 TTATGCACTCAGTTTTATGTTGG - Intergenic
1091197188 11:133741502-133741524 GTGAACACATGGTTTTATCTTGG - Intergenic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1094860482 12:34460815-34460837 GAATCCACAAAGTTTTATTTGGG - Intergenic
1096926181 12:55149925-55149947 TTATACACCTAGTTTTATCTTGG - Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1099178017 12:79444505-79444527 GAAAGCTCATAGTTTTCTCTGGG - Intronic
1100069559 12:90695815-90695837 GTAAGCACATATTTTATTCTAGG - Intergenic
1100419606 12:94419294-94419316 GTTTGCACATCTTTTTACCTAGG - Intronic
1101068497 12:101048005-101048027 GTATGGATATAGTTATATTTAGG - Intronic
1103974447 12:124693186-124693208 TTATGCATATAGATTTATATCGG + Intergenic
1106448053 13:29854188-29854210 GTTTTCACATAGTTTTCTCATGG - Intergenic
1106879270 13:34111754-34111776 GAATGAAAAGAGTTTTATCTGGG - Intergenic
1108232727 13:48366533-48366555 GCATGCCAATAGTTTTCTCTTGG + Intronic
1108716421 13:53083296-53083318 TTTTGCACATAGTGTGATCTTGG + Intergenic
1110416319 13:75257258-75257280 GTAGGCACATAGTATGAACTCGG - Intergenic
1111857421 13:93655626-93655648 GTATACACATAGATTTTTCAGGG - Intronic
1112422991 13:99270269-99270291 GTAAGCAGATATTTTTATCAAGG + Intronic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1119863895 14:77957085-77957107 ATATACATATAGTTTTTTCTAGG - Intergenic
1120617388 14:86724279-86724301 GTCTCCAAATAGTTTTATGTGGG + Intergenic
1122804054 14:104247791-104247813 GTTTGCACATAATTTGTTCTGGG + Intergenic
1202830488 14_GL000009v2_random:23671-23693 GTATGAACATAGACTTATATGGG + Intergenic
1125190397 15:36986113-36986135 GTTTTCACATAATTTTATTTGGG + Intronic
1125422574 15:39519397-39519419 GAAGGCACATAGTCTTGTCTTGG - Intergenic
1127545039 15:59985509-59985531 ATATGCCCATAGCATTATCTAGG - Intergenic
1130725522 15:86435195-86435217 ATATGCACATATTTTAATGTGGG - Intronic
1133467196 16:6039079-6039101 CTATGCACACAGTTTGGTCTGGG - Intronic
1137880413 16:52040061-52040083 GTGTGGACATAATTTTCTCTTGG + Intronic
1140541192 16:75757758-75757780 GTGTTCACATAATTTTGTCTGGG + Intronic
1141234557 16:82203491-82203513 GCCTGCACATAGTTTTATTTGGG - Intergenic
1146217642 17:30990968-30990990 GTATGTACATTGTTTCATATGGG + Intronic
1146867550 17:36350860-36350882 GTATGCATATGGCTTTATCTTGG - Intronic
1147070426 17:37951474-37951496 GTATGCGTATGGCTTTATCTTGG - Intergenic
1147081950 17:38030999-38031021 GTATGCGTATGGCTTTATCTTGG - Intronic
1147097899 17:38154964-38154986 GTATGCGTATGGCTTTATCTTGG - Intergenic
1159621439 18:70643487-70643509 ATATGCAAATATTTTTAGCTAGG - Intronic
1159975136 18:74701982-74702004 GTATGCACATAGTGCTCTGTGGG + Intronic
1168681692 19:58320488-58320510 GTATTCACATGGTTTTCCCTGGG - Intergenic
1202642206 1_KI270706v1_random:104108-104130 GTATGAACATAGACTTATATGGG - Intergenic
926709961 2:15871379-15871401 GTATCCACCTGGTTTTCTCTTGG - Intergenic
928639180 2:33279832-33279854 GTATGCAAATATTTTAATCCAGG + Intronic
929326805 2:40623335-40623357 GTATACACATAGATGAATCTTGG + Intergenic
931934257 2:67178394-67178416 GTATGCACTTAGTTGTCACTGGG - Intergenic
932521542 2:72419662-72419684 ATGTGCTCATAGTTTTATCAAGG + Intronic
932992360 2:76803168-76803190 GTTTGCAAATACTTTTATCCTGG - Intronic
933027243 2:77275521-77275543 GTATGCTCGTAATTTTATTTTGG - Intronic
933425394 2:82105164-82105186 TCATGCTCTTAGTTTTATCTTGG - Intergenic
933537903 2:83600227-83600249 GTTTGGACTTAGTTTTTTCTTGG - Intergenic
935486955 2:103668534-103668556 GTATGTACATAGTTGAATATAGG - Intergenic
940105097 2:150090460-150090482 ATATGAACATAAATTTATCTGGG - Intergenic
940357742 2:152763912-152763934 GTAGGCACACAGTCTAATCTTGG - Intergenic
940412706 2:153384677-153384699 GGATGCACATAGTTTTGAGTGGG - Intergenic
943269783 2:185784630-185784652 ATAGCAACATAGTTTTATCTTGG - Intronic
943963638 2:194301686-194301708 GTATGTACACATTTTTATATGGG - Intergenic
946371424 2:219283794-219283816 GTATCCACTTAGTTTTAATTTGG + Intronic
946673581 2:222132876-222132898 GTATGCACATAATTATAACATGG + Intergenic
947159716 2:227200298-227200320 GTATTCACAAAGTTTTTCCTGGG + Intronic
1169049070 20:2560915-2560937 CTGAGCACATAGTATTATCTGGG + Intronic
1169240067 20:3969621-3969643 GTGTGGCCATAGTTTTTTCTGGG - Intronic
1169636166 20:7694249-7694271 ATATTCACATAGGTTTATCATGG + Intergenic
1169698075 20:8414216-8414238 GTCTGCACATATTTTTATTTGGG + Intronic
1169985366 20:11437352-11437374 GTATGCATATAGTGTTCTCAAGG - Intergenic
1170213123 20:13865136-13865158 GTATGTGCTTATTTTTATCTGGG + Intronic
1170388382 20:15845609-15845631 GAATTCACAAAATTTTATCTTGG + Intronic
1176609674 21:8868509-8868531 GTATGAACATAGACTTATATGGG + Intergenic
1177421690 21:20867513-20867535 GTATGCACATACTTCTGTCCAGG + Intergenic
1177678183 21:24329882-24329904 GTAAGCATATAGTTGTGTCTCGG + Intergenic
1178289326 21:31353458-31353480 GTCTTCACATAGTTTTATGAGGG - Intronic
1180305812 22:11123738-11123760 GTATGCAGTTAGTTTTTGCTTGG - Intergenic
1180359729 22:11877746-11877768 GTATGAACATAGACTTATATGGG + Intergenic
1180544331 22:16485921-16485943 GTATGCAGTTAGTTTTTGCTTGG - Intergenic
1184915958 22:47569179-47569201 GTATGCACCTAGTTTCACCGTGG + Intergenic
950239656 3:11357459-11357481 GTATGTAGATATTTTTATCGGGG - Intronic
951192786 3:19789122-19789144 GTATGCACCTAGTTTTCTTTAGG + Intergenic
951877122 3:27439913-27439935 GTTTGCAGAGAGTTTTATCATGG + Intronic
956147794 3:66209477-66209499 GTATACATATACTTTTATATGGG + Intronic
958673710 3:97238079-97238101 GCATGTACATAATTTTAGCTTGG - Intronic
962681760 3:137807835-137807857 GTATGGACCCAGTTTAATCTTGG + Intergenic
965756436 3:172032491-172032513 CTACACACATATTTTTATCTAGG + Intergenic
1202736355 3_GL000221v1_random:3283-3305 GTATGAACATAGACTTATATGGG + Intergenic
971095065 4:23391326-23391348 GCATGATCATAGTTTTATTTTGG + Intergenic
972460832 4:39300613-39300635 GTGTGAACATAGTTTCATTTGGG - Intronic
975038724 4:69717176-69717198 ATATGTACATATTTTTATGTAGG - Intergenic
976603464 4:86960602-86960624 GTATGCACATACTTTAGTTTTGG - Intronic
976909179 4:90279290-90279312 GTATGCACATAGTTTTATCTGGG + Intronic
978536043 4:109764598-109764620 ATATGAACATTGTCTTATCTTGG + Exonic
978635477 4:110799926-110799948 GTATGCAAATAGCTTTATTTTGG + Intergenic
979952473 4:126910239-126910261 GTGTGCACATATTTTTCTCAAGG - Intergenic
982967378 4:161929697-161929719 GTGTGTACATAGTTTAAACTTGG + Intronic
984896532 4:184546510-184546532 GTATGTACATGGTTTCAGCTGGG + Intergenic
1202769578 4_GL000008v2_random:189983-190005 GTATGAACATAGACTTATATGGG - Intergenic
987379526 5:17272122-17272144 GTATGCTCATTGCTTTCTCTTGG + Intronic
992173993 5:74131908-74131930 ATATGCACATATTTTTTTCTTGG + Intergenic
993390097 5:87309512-87309534 GTAACCACATAGTTTTCTATTGG + Intronic
996931963 5:128900744-128900766 TTATGAGCATAGTTTTATGTGGG + Intronic
997053900 5:130417098-130417120 CTATTCTCATAGTTTTATCTTGG + Intergenic
1006298802 6:33182339-33182361 TTATGCACAGAATTTTATTTAGG + Intronic
1006879728 6:37328398-37328420 TTATGCACAAAGCCTTATCTTGG - Intronic
1007538304 6:42616135-42616157 CTATGCCCATAATTATATCTAGG + Intronic
1009681893 6:66904857-66904879 GTATATACATAGTTTTTTCATGG - Intergenic
1010592617 6:77728379-77728401 TCATGCATATAGTTTTTTCTTGG + Intronic
1010645385 6:78381628-78381650 GAATGCATATTGTTTTAGCTTGG - Intergenic
1011111751 6:83845304-83845326 GTATGCTCAAAGCTTAATCTCGG + Intergenic
1011793003 6:90918174-90918196 GTATTCACATAGTATTCTCTAGG + Intergenic
1013205795 6:107944808-107944830 GTATAAACATAGTCTTATTTTGG - Intronic
1015208917 6:130672988-130673010 GTGTGAAGATAGTTTTATCCTGG - Intergenic
1015835855 6:137419222-137419244 GTATGAAAATAGTTTTCCCTGGG + Intergenic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1021676143 7:23082621-23082643 CTATTCACATAATATTATCTGGG - Intergenic
1024403549 7:48951567-48951589 ATATGCACATATTTTTATTATGG + Intergenic
1025595319 7:62916264-62916286 GAATTCACAAAGTTTTATGTGGG + Intergenic
1025640710 7:63365501-63365523 GTAGGCACAAACTTTTATTTTGG - Intergenic
1025641989 7:63382585-63382607 GTAGGCACAAACTTTTATTTTGG + Intergenic
1028760845 7:94494445-94494467 GTATTCACATAGCTTAATGTGGG - Intergenic
1031276194 7:119726698-119726720 GTATGTACATTGTTTAATTTAGG + Intergenic
1044619274 8:94173033-94173055 GTATGGACATGGTTTGATTTGGG - Intronic
1047164326 8:122420346-122420368 ATATACACATATTTTTTTCTAGG + Intergenic
1048633912 8:136274780-136274802 GTATGTATACATTTTTATCTTGG - Intergenic
1050632031 9:7569918-7569940 GTATGCCCACAGCTTTATCTTGG + Intergenic
1051954252 9:22670869-22670891 GTATCCACATACTTTTATTTGGG + Intergenic
1055143867 9:72908940-72908962 GTATGCAGATATTCTTATATCGG - Intronic
1056974518 9:91239248-91239270 GTATCCACATACTTTTAACTTGG - Intronic
1203694472 Un_GL000214v1:83710-83732 GTATGAACATAGACTTATATGGG - Intergenic
1203705084 Un_KI270742v1:33722-33744 GTATGAACATAGACTTATATGGG + Intergenic
1203558926 Un_KI270744v1:32089-32111 GTATGAACATAGACTTATATGGG - Intergenic
1203641801 Un_KI270751v1:20353-20375 GTATGAACATAGACTTATATGGG + Intergenic
1186786097 X:12956950-12956972 GTCTGCAGTTAGTTTGATCTAGG + Intergenic
1192024608 X:67435988-67436010 GTATCTACATTTTTTTATCTTGG + Intergenic
1193912385 X:87321980-87322002 GCATGCACAGTGTTTTGTCTTGG - Intergenic
1195304351 X:103564901-103564923 GTATGTACACAGGTTTAACTAGG - Intergenic