ID: 976912994

View in Genome Browser
Species Human (GRCh38)
Location 4:90331561-90331583
Sequence TTCTAGTAAGGTGTCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976912994_976912997 1 Left 976912994 4:90331561-90331583 CCCACAAGGACACCTTACTAGAA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 976912997 4:90331585-90331607 AAGTAAGAAATTACTAGTTCTGG 0: 1
1: 0
2: 5
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976912994 Original CRISPR TTCTAGTAAGGTGTCCTTGT GGG (reversed) Intronic
903942356 1:26940511-26940533 TTCTGCTAACGTGTCCTTTTTGG + Intronic
905565708 1:38962846-38962868 TTCTGATATGGTGTCCTTGTTGG + Intergenic
907538755 1:55192214-55192236 TTACAGTAATGTATCCTTGTTGG - Intronic
908388471 1:63664196-63664218 ATCCAGTAAGTTGTCATTGTGGG + Intergenic
909785718 1:79610172-79610194 TTCTAGTAAGGTGTTAGTGGTGG - Intergenic
915924207 1:160003911-160003933 TTCTAGGAAGGTGCCCCTGCTGG - Intergenic
916080971 1:161231960-161231982 TAATAATAAGGTGCCCTTGTCGG - Intronic
918859641 1:189806380-189806402 TTATAGGAAGGTGCCCTTGAAGG + Intergenic
922983027 1:229844574-229844596 TTCTAGGAAGATGTCCTGGATGG - Intergenic
923363814 1:233239322-233239344 TCCTACTAAGGTGTCCTGCTAGG + Intronic
924525425 1:244843031-244843053 TTCTTCTAAGGTTTCATTGTAGG + Exonic
1068853473 10:61771563-61771585 TTGTAGTAAGGTATCCTGGATGG + Intergenic
1071598409 10:86944070-86944092 TTGTAGGAAGGTGTCCACGTGGG + Exonic
1073576340 10:104628905-104628927 TTCTAAAAAGTAGTCCTTGTTGG - Intergenic
1075209412 10:120478262-120478284 TTCTTGTGAGGGGTCCTTGGTGG + Intronic
1076478013 10:130766179-130766201 TTCCAGTGAGGTGCCCTGGTCGG + Intergenic
1078439143 11:11349954-11349976 TTCTTGGAAGGTGTCCCTGAAGG + Intronic
1079410293 11:20181162-20181184 TACTGGTTAGGTGTCCTCGTAGG + Intergenic
1080254340 11:30272223-30272245 TTTTAGTAAGGTGTCTTTTGAGG - Intergenic
1082050648 11:47767736-47767758 TTCTAGAAAGGTGTGCTGCTGGG + Intergenic
1082616363 11:55365260-55365282 TTCTAATAAGGTGTATGTGTAGG + Intergenic
1086968834 11:93058468-93058490 TTCTAGGGAGATGTCCTTGCAGG + Intergenic
1099244602 12:80180065-80180087 TTTTAGTAAGGAGGCCTTGGTGG + Intergenic
1099677284 12:85778006-85778028 TTGTAGGAGTGTGTCCTTGTAGG + Intergenic
1101975549 12:109355025-109355047 TTCTAATAAGGTCTAGTTGTGGG + Intronic
1105734604 13:23255008-23255030 TTCTAGTACAGTATCTTTGTGGG - Intronic
1109792674 13:67270124-67270146 TTGTAGGTAGGTGTCCTTGAAGG + Intergenic
1111695983 13:91624422-91624444 TTCTATCAAGTTGTCCTTGGAGG - Intronic
1112120074 13:96400423-96400445 ATCTAGTAAAGTGTCCTGATAGG + Intronic
1114873327 14:26684580-26684602 TTTGAGTAAGCTGTCCTTGTAGG + Intergenic
1116842722 14:49835768-49835790 TTCTAGTAGGGTTTTTTTGTGGG - Intronic
1117894238 14:60463776-60463798 TTCTAGTAATGGGTCATTTTTGG + Intronic
1117951192 14:61083836-61083858 TTCTGGTAAGCTTTCCTTTTGGG + Intergenic
1117983558 14:61365079-61365101 TTCTACAAAGGTTTCCCTGTGGG - Intronic
1120502839 14:85318499-85318521 TTCTAATAAAATGTCCTTCTAGG - Intergenic
1121493107 14:94373974-94373996 TTCTAATGGGGTTTCCTTGTGGG + Intergenic
1123176674 14:106425720-106425742 TTCCAGTAAGCTGTCCCAGTAGG - Intergenic
1123936400 15:25196197-25196219 TTCAGGGAAGGTGTCCTTCTTGG - Intergenic
1135433632 16:22409086-22409108 TTCTAATAATGTGTCAGTGTAGG - Intronic
1135602578 16:23795936-23795958 TTCTAGGAAGGTATCCATGGAGG - Intergenic
1136524324 16:30818676-30818698 TCCCAGCAAGGTTTCCTTGTGGG - Intergenic
1140782601 16:78310275-78310297 TTCTAGAAACGTGTGCTTCTGGG + Intronic
1148489936 17:48016537-48016559 TTGAAGAAAGGTCTCCTTGTAGG - Intergenic
1148932208 17:51136265-51136287 TTTGAGGAAAGTGTCCTTGTTGG + Intergenic
1149783458 17:59416534-59416556 TTGTACTGAGGTCTCCTTGTTGG + Intergenic
1150372079 17:64647759-64647781 GTCTACCAAGGTGTCTTTGTAGG - Intronic
1153438547 18:5091760-5091782 TTCTAGAAAGATGTTCCTGTGGG - Intergenic
1153904819 18:9651838-9651860 TACTTTGAAGGTGTCCTTGTTGG + Intergenic
1157734014 18:50030570-50030592 TTCTAGTTAGTGGTCCTGGTTGG - Intronic
1159849310 18:73508043-73508065 ATGTAATAAGATGTCCTTGTTGG - Intergenic
1159953287 18:74501278-74501300 TTCTGAAAAGGTGTCCTTGAGGG - Intronic
1161231310 19:3176436-3176458 TACCAGTAAGGTGTCCTGGAAGG - Intronic
1163510456 19:17732274-17732296 TTCTAGGAATGTGTCCATTTCGG + Intronic
926643866 2:15267016-15267038 TTTTTGTAAGATGTCATTGTGGG - Intronic
927102939 2:19801747-19801769 TTCTAGTAAGTGTGCCTTGTGGG + Intergenic
928272542 2:29869459-29869481 TTCTATTAAGGTTTGCTTCTGGG - Intronic
928878946 2:36074936-36074958 TTCAAGCAATGTGTCCTTATAGG - Intergenic
929859286 2:45662359-45662381 TTGTAGTAAGCTGTGCTTCTCGG - Intronic
932138088 2:69248353-69248375 TTCTACCAAGCTGTGCTTGTTGG + Exonic
936020910 2:108994144-108994166 TTTTAATAAGGTGTCCATGGGGG - Intergenic
940225075 2:151392700-151392722 CTCTAGTGAGCTGTCCTGGTTGG - Intergenic
942472583 2:176276685-176276707 TTATAGTAAGGGGTCCTTTGAGG + Intronic
944064078 2:195600931-195600953 TTCTAGCAAGGTTTTCTTGGAGG - Intronic
945729937 2:213521164-213521186 TTCCAGGAAGGTGGCCTGGTTGG + Intronic
945957590 2:216100499-216100521 TTCTTGGATGGGGTCCTTGTTGG - Exonic
1168904254 20:1391389-1391411 TTTTAGATAGCTGTCCTTGTAGG - Intronic
1168919315 20:1517796-1517818 TTATAGAAATGTGTCTTTGTAGG - Intergenic
1169419910 20:5451701-5451723 TTGTAGGATTGTGTCCTTGTAGG + Intergenic
1170295932 20:14825381-14825403 TTCTAGAAAGGTCTCCATATTGG + Intronic
1177228776 21:18292044-18292066 TTGTAGGAATGTGTCCTCGTAGG - Intronic
1177702209 21:24653844-24653866 ATCTGGAATGGTGTCCTTGTAGG + Intergenic
1181466109 22:23111567-23111589 TTCTACTAAAGTGACCTTGGGGG - Intronic
1184088487 22:42280155-42280177 TTCTTGGAAGGTTTCCATGTAGG - Intronic
949940895 3:9153490-9153512 TTGTAGTTGAGTGTCCTTGTTGG - Intronic
953858176 3:46517873-46517895 TCCTAGCAAGGCTTCCTTGTGGG - Exonic
956635966 3:71365383-71365405 TTCTAGTAAGCTGTCTATGTGGG - Intronic
956831647 3:73055390-73055412 TTTGAGTAAGGTCTCCTAGTGGG + Intronic
958461402 3:94401708-94401730 TTCTAGAAAGCTGTATTTGTGGG + Intergenic
959294206 3:104514517-104514539 TTCTGAAAAGCTGTCCTTGTGGG - Intergenic
966599816 3:181763943-181763965 TGCAAGTAGGGTATCCTTGTGGG + Intergenic
967422817 3:189292874-189292896 GTTTAGAAAGGTGTCCTTGGAGG + Intronic
967535063 3:190592583-190592605 TTCTACAAAGTTTTCCTTGTGGG - Intronic
971668631 4:29526842-29526864 TTCAAGTAAAATGTCCTTTTTGG - Intergenic
974898055 4:67963281-67963303 TGCTAGTGAGGTGTCTTTGGTGG - Intronic
976912994 4:90331561-90331583 TTCTAGTAAGGTGTCCTTGTGGG - Intronic
977869121 4:102068895-102068917 TTCAAGTAATTTGTCCTTTTTGG - Intronic
978111502 4:104969303-104969325 CTCTAGAAATGTGTCCTTGATGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
984624868 4:181995938-181995960 TGCTAGTGAGGTGTCACTGTGGG - Intergenic
984836458 4:184026661-184026683 TTATAGTATGGTATCCTGGTTGG - Intergenic
987323660 5:16793141-16793163 TTCTAGTGAGGTTTCCGTGGAGG - Intronic
987717978 5:21595968-21595990 TCCTAGTCAAGTGTGCTTGTTGG - Intergenic
990892317 5:60662627-60662649 CTTTTTTAAGGTGTCCTTGTAGG - Intronic
996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG + Intronic
997031118 5:130129735-130129757 TTCTAGTTGTGTGTTCTTGTAGG + Intronic
1004151676 6:13126079-13126101 TTCAAGTAAGATTTCCTTCTCGG + Intronic
1005362624 6:25045324-25045346 TTCTTGTAAGCTGTTCTAGTGGG - Intergenic
1016665190 6:146631343-146631365 ATTTTGTAAGGTGTCCTTATAGG + Intronic
1016987204 6:149904559-149904581 TTGCAGGAAGGTGTCCATGTGGG - Intergenic
1017108135 6:150907290-150907312 TTTTAATAAGGTTTCCTTTTAGG + Intronic
1017281534 6:152631171-152631193 TTCTGGAAAGGTGTCCTTCTTGG + Intronic
1019122918 6:169819014-169819036 TTCTAGTTTGGTGTACTTTTAGG + Intergenic
1021271584 7:18593967-18593989 TCCTGGTAATGTGTACTTGTAGG - Exonic
1023241475 7:38151926-38151948 TTCTTGTGAGGTGTCTTAGTGGG - Intergenic
1026907902 7:74073474-74073496 TTTTAGAAAGGTGTCAGTGTAGG - Intergenic
1028893603 7:96015697-96015719 TACCAGAAATGTGTCCTTGTGGG - Intronic
1030994677 7:116344940-116344962 TGCTAGGAAGTTGTTCTTGTAGG + Intronic
1031914613 7:127551501-127551523 TTGTAGGAATGTGTCCTTGTAGG + Intergenic
1035456868 7:159014415-159014437 TGCTAGTAAGCTGTCCTTTGTGG + Intergenic
1038740867 8:30215511-30215533 TTCTAGTAGAATATCCTTGTAGG + Intergenic
1043333387 8:79144575-79144597 TGCTAATAATGTGTCCGTGTAGG - Intergenic
1046621849 8:116536749-116536771 TTGTATTAAGGTTTCCTTTTTGG + Intergenic
1056386434 9:86100289-86100311 TTCTAGCATGGTTTCCCTGTAGG - Intergenic
1059712320 9:116880316-116880338 TTCCAATAAAGTGTCATTGTTGG - Intronic
1061472504 9:130837600-130837622 TTCTAGGAAGGTGTCACTCTAGG + Intronic
1186132382 X:6481730-6481752 TTGTAGGAGTGTGTCCTTGTAGG + Intergenic
1189530747 X:41879888-41879910 TTCTTATAAGGTGTCATTCTTGG - Intronic
1189909889 X:45799848-45799870 TCTGAGTAAGGTGTCTTTGTTGG + Intergenic
1193821280 X:86168605-86168627 GTCTAGTAAGGTGACTTTCTCGG + Intronic
1194248722 X:91545923-91545945 TTATAGAAAGGTTTCTTTGTTGG - Intergenic
1194347767 X:92786842-92786864 TTGTAGGAGTGTGTCCTTGTAGG + Intergenic
1194756059 X:97741296-97741318 TTCTAATGAGGTGTCTTGGTGGG - Intergenic
1195228998 X:102827152-102827174 TTTTAGTACTGTGCCCTTGTGGG - Intergenic
1197688882 X:129475896-129475918 TTTTGGTAATGTGTCATTGTGGG - Intronic
1200656092 Y:5903478-5903500 TTGTAGGAGTGTGTCCTTGTAGG + Intergenic