ID: 976921322

View in Genome Browser
Species Human (GRCh38)
Location 4:90447435-90447457
Sequence CAAAAATTCTCTGAAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976921318_976921322 3 Left 976921318 4:90447409-90447431 CCTTTCTGGCTGTTGAAATCAAA 0: 1
1: 0
2: 1
3: 22
4: 268
Right 976921322 4:90447435-90447457 CAAAAATTCTCTGAAGGGGCAGG 0: 1
1: 0
2: 1
3: 43
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976921322 Original CRISPR CAAAAATTCTCTGAAGGGGC AGG Intronic
900018220 1:169357-169379 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
900048479 1:527953-527975 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
900070705 1:769805-769827 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
900078551 1:837334-837356 AAAAAATTCTGTAAAGGGCCGGG + Intergenic
902177385 1:14661107-14661129 CAAAAATTCTGTGAGGGAGATGG + Intronic
902353618 1:15879186-15879208 CAAAAATTATCTGGAGGTGGTGG + Intronic
903506546 1:23839703-23839725 AAAAAAATCTTTAAAGGGGCCGG - Intergenic
903681299 1:25099022-25099044 TGAGACTTCTCTGAAGGGGCTGG + Intergenic
903726716 1:25452988-25453010 AAAAAATTCACTGTAGGGCCAGG - Intronic
903878813 1:26494729-26494751 TAAAAATTCAATGAAAGGGCTGG + Intergenic
904347325 1:29881637-29881659 AAAAGAGTCTCTGAGGGGGCGGG - Intergenic
904518470 1:31075580-31075602 CAAGAATGCTATGATGGGGCTGG + Intergenic
904547045 1:31283304-31283326 CAAAAATTCACTAAACAGGCCGG + Intronic
906372944 1:45269939-45269961 CAAACATTTGCTGCAGGGGCGGG + Intronic
906576997 1:46900108-46900130 CAAAAATTCTATGATAGGGGAGG - Intergenic
906835909 1:49083323-49083345 CAAAAGTTTTCTGCAGGGGCAGG - Intronic
907229921 1:52987205-52987227 CAAAAATATTCAGAAGAGGCAGG - Intronic
907508823 1:54943427-54943449 CAAAAATTTTCTGCAGGTGTGGG + Intergenic
907616754 1:55934044-55934066 CAAAAGTTTTCTGCAGGGGTGGG - Intergenic
907925676 1:58953357-58953379 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
908017267 1:59856239-59856261 GAAAAATTCACTATAGGGGCTGG - Intronic
908273908 1:62449281-62449303 CAAGATTTTTTTGAAGGGGCGGG + Intronic
908336565 1:63131349-63131371 CCAAACTATTCTGAAGGGGCAGG - Intergenic
908654117 1:66369850-66369872 TAAAAAATCTGTGAAAGGGCTGG + Intronic
908853379 1:68395984-68396006 CAGAAATTTGCTGCAGGGGCGGG - Intergenic
908863353 1:68516291-68516313 CAAAACTTTTCTGTAGGAGCTGG - Intergenic
909160922 1:72148174-72148196 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
909274423 1:73666305-73666327 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
910083564 1:83371739-83371761 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
911738494 1:101362661-101362683 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
912042671 1:105411620-105411642 CAGAAGTTTGCTGAAGGGGCAGG + Intergenic
914733815 1:150397124-150397146 CAAAAATTAACTGAAGGTGGTGG - Intronic
915710930 1:157897193-157897215 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
916795399 1:168162389-168162411 CAAAATTTCTCTTCAGGAGCAGG - Intergenic
917933161 1:179838044-179838066 CAAAAATTCGCTGAATGTGGTGG - Intergenic
918787077 1:188776251-188776273 CAAAAGTTTGCTGAAGGGGTGGG + Intergenic
918800180 1:188961106-188961128 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
920077436 1:203347673-203347695 CAACAATGCTCTGGAGGGGCTGG - Exonic
920523258 1:206645480-206645502 GAAAAATACTAAGAAGGGGCTGG - Intronic
921575052 1:216825235-216825257 CAAACATTTCCTTAAGGGGCAGG - Intronic
924348248 1:243092788-243092810 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
1065105141 10:22375871-22375893 CAAAAATCCTTTGAGGTGGCCGG - Intronic
1066451872 10:35537272-35537294 CAAAAATTTGCTTCAGGGGCGGG + Intronic
1066728113 10:38412113-38412135 CAAAACACCCCTGAAGGGGCTGG - Intergenic
1068103181 10:52581565-52581587 CAGAAATTTGCTGCAGGGGCAGG - Intergenic
1068243573 10:54336674-54336696 CAAAAGTTTGCTGAAGGGGCAGG + Intronic
1068354813 10:55897374-55897396 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1070577728 10:77692402-77692424 TAAAAATTATATGAATGGGCTGG + Intergenic
1071195947 10:83159830-83159852 TAAAAACTCTCTCAAGGGCCTGG + Intergenic
1071756775 10:88550795-88550817 AAATGATTCTCTGAAGAGGCAGG - Intronic
1073153448 10:101327909-101327931 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1073229861 10:101959879-101959901 TAAGAATTCTCTACAGGGGCTGG + Intronic
1073913111 10:108370127-108370149 CAAAAATTCTTTGCAAAGGCTGG - Intergenic
1074262748 10:111870481-111870503 CAAAAGTTTGCTGCAGGGGCGGG + Intergenic
1074441488 10:113480965-113480987 CAGAAATGCCCTGCAGGGGCAGG + Intergenic
1075550361 10:123388345-123388367 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1075562557 10:123478952-123478974 CAAGAACTCTCAGAAAGGGCAGG - Intergenic
1075961376 10:126570071-126570093 CAAAAATGCTCTGCGGGTGCTGG + Intronic
1076464817 10:130671826-130671848 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1076974822 11:164553-164575 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
1079774196 11:24502680-24502702 CAAAAACACTTTGGAGGGGCTGG - Intronic
1080065130 11:28002328-28002350 CAGAAGTTCTCTGCAGGGGTGGG + Intergenic
1080929764 11:36797583-36797605 CTAAAATACTCTGTAGAGGCTGG - Intergenic
1081238917 11:40679758-40679780 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1081900028 11:46619731-46619753 TAAAAATCCTCTGAAGGGGCCGG + Intronic
1081912414 11:46708313-46708335 CAAAAATTAGCTGAGGGGCCTGG - Intergenic
1082080143 11:48006453-48006475 CAGAGCTTCTCTGAATGGGCAGG - Intronic
1082268306 11:50143034-50143056 TAAAAGTTTTCTGTAGGGGCGGG + Intergenic
1082287768 11:50335481-50335503 CAAAAGTTTTCTGTAGGGGTGGG - Intergenic
1083403563 11:62441296-62441318 TAAAAATTTTCTGTAGAGGCCGG - Intronic
1083772352 11:64875253-64875275 GAAAAGTTCTCTGAAAGGCCAGG + Intronic
1083802857 11:65057011-65057033 CAAAAATTCTGACTAGGGGCCGG - Intronic
1084628344 11:70327320-70327342 CACAAATTCCTTGAAGGAGCAGG - Intronic
1086044962 11:82521847-82521869 GGAAAATCCTCTGAGGGGGCTGG + Intergenic
1086969525 11:93065761-93065783 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1087057882 11:93951410-93951432 CACAAATATTCTGAAGTGGCTGG - Intergenic
1087541911 11:99531858-99531880 CAAAAGTTTCCTGTAGGGGCGGG + Intronic
1087763678 11:102127556-102127578 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
1088442795 11:109890204-109890226 TAGAATTTCTCTGCAGGGGCAGG - Intergenic
1089085988 11:115817177-115817199 TAAAAACTTTCTGAAGGGCCAGG + Intergenic
1090964050 11:131582807-131582829 CAGTAAATCTCAGAAGGGGCTGG - Intronic
1092652232 12:10647006-10647028 CAAAAGTTTCCTGCAGGGGCGGG + Intronic
1093634336 12:21446607-21446629 CAAAAATTATGTGAAGAGTCAGG + Intronic
1094706076 12:32915606-32915628 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1097360472 12:58654029-58654051 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1098508678 12:71285152-71285174 CAAAAACCCTCAGAAGGTGCAGG + Intronic
1099780090 12:87183210-87183232 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1099817997 12:87673069-87673091 CAAAAATTACCTGAAGGTGGTGG + Intergenic
1101255153 12:102969524-102969546 CAAAAATTAGCTGAAGGTGCTGG + Intergenic
1101663553 12:106788497-106788519 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
1101942838 12:109112847-109112869 CAAACTTTCTGTGAAGGGTCAGG + Intergenic
1102136082 12:110576869-110576891 TAAAAATTCACTCAAGGGGCTGG + Intronic
1102190210 12:110981827-110981849 CAAAAATTATCTGGAGGTGGTGG + Intergenic
1102248872 12:111372259-111372281 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1102563381 12:113778754-113778776 AAATAAGTCTCTGAAGAGGCAGG + Intergenic
1102690087 12:114753564-114753586 CAGAAATTCCCTGAGGGAGCGGG - Intergenic
1102714480 12:114958196-114958218 TAAAAATTCTCTGGAAGGGCTGG - Intergenic
1102758774 12:115367104-115367126 CAAAACTTTGCTGCAGGGGCGGG + Intergenic
1102794732 12:115678999-115679021 CAAAAGTTTGCTGAAGGGGCGGG + Intergenic
1103731695 12:123032180-123032202 CAAAAAAACCCTGAAGTGGCTGG + Intronic
1105347929 13:19590901-19590923 CAAAAATTATCTGAAGGTGGTGG + Intergenic
1105774779 13:23647685-23647707 CTAAAATTCTTAGAAGAGGCTGG - Intronic
1105823674 13:24102768-24102790 AAAAATTTCTGTGAAGTGGCTGG - Intronic
1106826904 13:33532937-33532959 CAAAATTTTTCCAAAGGGGCTGG + Intergenic
1106973473 13:35175084-35175106 TATAAATACTCTGAAGTGGCCGG - Intronic
1107102156 13:36605496-36605518 TATAAATTCTCTTAAGAGGCTGG + Intergenic
1107183765 13:37493450-37493472 CAACAATTCTGTGAAGGGGATGG - Intergenic
1108718961 13:53110524-53110546 CAAGAATTCTCCAAAGGGACTGG + Intergenic
1108933983 13:55864557-55864579 CAAAAGTTTTCTGCAGGGGCAGG + Intergenic
1109255913 13:60081865-60081887 CAGAAAAGATCTGAAGGGGCTGG + Intronic
1109324648 13:60852799-60852821 CAAAAGTTAGCTGCAGGGGCAGG - Intergenic
1109702716 13:66047935-66047957 CAAACATTTGCTGCAGGGGCGGG - Intergenic
1110038425 13:70718263-70718285 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1112857786 13:103792294-103792316 CAAAAGTTTTCTGCAGGGGAGGG - Intergenic
1113375655 13:109763109-109763131 CAAACATTCTGTGAAAGGTCAGG - Intronic
1114986748 14:28239011-28239033 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1115021291 14:28684261-28684283 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1115130364 14:30046759-30046781 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
1115369681 14:32598480-32598502 CAATAACACTCTGAAGGGGAAGG - Intronic
1115459576 14:33645246-33645268 CAAAAACTCTGTGAAGCTGCAGG + Intronic
1115751370 14:36495080-36495102 CAAAAATTTTCTTAGGGGACAGG - Intronic
1116127042 14:40800986-40801008 CAAAAATTTGCTGCAGGGGTGGG - Intergenic
1116462731 14:45196483-45196505 CAAACATACTCTGCAGGTGCTGG - Exonic
1116564888 14:46432412-46432434 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1116762105 14:49027170-49027192 CAGAAATTTGCTGCAGGGGCAGG + Intergenic
1117198489 14:53364202-53364224 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1117531229 14:56662374-56662396 CAAAACTTCTCTGCAGAGCCCGG + Intronic
1118698968 14:68414282-68414304 CAAAAACTCTCTTAAGAAGCTGG + Intronic
1118772982 14:68954620-68954642 AAAATATTCTCTGTATGGGCCGG - Intronic
1118933461 14:70264305-70264327 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1119216339 14:72871952-72871974 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
1120798003 14:88656717-88656739 CAAAAATTTTCTAAAAAGGCAGG - Intronic
1121147024 14:91593150-91593172 CAAAAGTTTTCTGCAGGGGTGGG + Intronic
1121611536 14:95284283-95284305 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1123059641 14:105588733-105588755 CCAAAATCCTCTCTAGGGGCAGG - Intergenic
1123083968 14:105708982-105709004 CCAAAATCCTCTCTAGGGGCAGG - Intergenic
1124066302 15:26347206-26347228 GAAAAGTTTGCTGAAGGGGCAGG + Intergenic
1124908793 15:33897891-33897913 CAAAAAATAGCTGAATGGGCCGG + Intronic
1125573812 15:40741209-40741231 AAAAAATTCCCTAAAGGGGATGG + Intronic
1126018840 15:44379178-44379200 AAAAAAATCTGTGATGGGGCCGG + Intronic
1126185071 15:45823701-45823723 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1126945474 15:53814075-53814097 CAAGAATTCTCAGATGGGCCAGG - Intergenic
1127748906 15:62011694-62011716 AAAAAATTCTCTAGAGTGGCAGG + Intronic
1128279495 15:66383413-66383435 CAAAAATTATCTGAATGTGGTGG - Intronic
1128675884 15:69608078-69608100 TAGAAAGTCTCTGCAGGGGCCGG + Intergenic
1130416926 15:83702731-83702753 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
1130839651 15:87686005-87686027 CCAAAGCTCTCTGAAGGGTCTGG + Intergenic
1131064478 15:89425180-89425202 CAAAAATTATCTGAGGGCGGTGG - Intergenic
1132074078 15:98804990-98805012 TAAAAATTCTCTGCAGCGGCCGG - Intronic
1133315717 16:4882747-4882769 GAAACATTCTCTGTAGGTGCCGG + Exonic
1134619840 16:15679290-15679312 AAAAAACTCTCTGAGGAGGCCGG - Intronic
1135283178 16:21170675-21170697 TAAAAATTTTTTTAAGGGGCGGG + Intronic
1136191487 16:28617858-28617880 CAAAAAATCTCCAAATGGGCTGG + Intronic
1138695294 16:58807406-58807428 AAAGAATTCTCTGGAGGAGCTGG - Intergenic
1138826268 16:60323871-60323893 CAAAAATCAACTCAAGGGGCTGG - Intergenic
1139457470 16:67093117-67093139 TAAAAATTTTTTGTAGGGGCAGG + Intronic
1139751145 16:69109560-69109582 CAAAAAGGCTCTGAATGAGCAGG - Exonic
1141460033 16:84172870-84172892 CAAACATTCACTCAAGGGGATGG - Intronic
1142251277 16:88993155-88993177 CCAAGATCCTCTGGAGGGGCTGG + Intergenic
1142445440 16:90133104-90133126 CAAAACCCCCCTGAAGGGGCTGG - Intergenic
1142462071 17:102366-102388 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
1143883797 17:10051159-10051181 CAAAAATTCTATGAAGTAGGTGG - Intronic
1144299489 17:13910236-13910258 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1144835870 17:18156497-18156519 CAAAGGTTTTCTGAAGGAGCAGG - Intronic
1144861050 17:18302387-18302409 GAAAAATCCTCTGAAGCCGCAGG + Exonic
1146149349 17:30453729-30453751 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1148380732 17:47195035-47195057 AAAAAGTTCCATGAAGGGGCTGG - Intergenic
1149260722 17:54877167-54877189 CAAAAGTTTTCTGCAGGGGCAGG + Intergenic
1149452238 17:56758839-56758861 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1151090357 17:71432638-71432660 TAAAAATTCTATGAAGGGTTGGG + Intergenic
1151655747 17:75495207-75495229 AAAAAATTCTCTGCAGGGCAAGG + Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153011933 18:547285-547307 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1153214812 18:2809710-2809732 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1153539063 18:6134972-6134994 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1153607940 18:6853769-6853791 TAAAAATTTTCTGAATGGGCTGG - Intronic
1154296872 18:13159131-13159153 GAAAAATTCACTACAGGGGCTGG - Intergenic
1154313138 18:13282840-13282862 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
1157377837 18:47182475-47182497 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1158502019 18:58010931-58010953 CAAAAATTATCTGAATGTGGTGG - Intergenic
1158610940 18:58940187-58940209 CAAAAATCATCTTAAGAGGCTGG - Intronic
1158843035 18:61409139-61409161 CAAAAATGCTCAGAATGGGTTGG - Intronic
1159996618 18:74970891-74970913 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1160601338 18:80014821-80014843 CAAAAGTTTGCTGCAGGGGCTGG - Intronic
1161315771 19:3616825-3616847 AAAAAATTTTCAGAAGTGGCTGG + Intronic
1161383421 19:3978452-3978474 CACAAATGCTCTGGAGGGGTTGG - Intronic
1162407528 19:10484352-10484374 CAAAAATTATCTGGGGGTGCTGG - Intergenic
1162834297 19:13306231-13306253 CAAAGATGCTCTGAAGGTCCCGG + Intronic
1166386542 19:42385286-42385308 CAAAAATTTTTTGTAGAGGCCGG + Intergenic
1167966526 19:53152309-53152331 AAAACATTCACTGAAGGGCCGGG + Intronic
1168576870 19:57519077-57519099 CAACAATTTTCTGTAGAGGCAGG + Intergenic
1168702447 19:58449292-58449314 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
925394124 2:3519803-3519825 CAAGATTGCTCTGAAGGTGCAGG - Intergenic
925685859 2:6472849-6472871 AAAAAATTCTGTGAAGTGGCCGG + Intergenic
925805147 2:7641198-7641220 CAAAAGTTTGCTGAAGGGGTGGG - Intergenic
927241313 2:20922042-20922064 CAACAATTCTCTGTGGGGCCTGG - Intergenic
927450861 2:23208264-23208286 CAAAAAGTGTCTGAGAGGGCAGG - Intergenic
929528808 2:42732214-42732236 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
930935311 2:56942355-56942377 CACAAATTCACTAAAGGTGCAGG - Intergenic
931036827 2:58253233-58253255 CTAAAAATCTCAGAAAGGGCTGG + Intergenic
931354632 2:61524906-61524928 AAAAAATTCTTTGAAGAGACAGG - Intronic
931962638 2:67499233-67499255 CAAAATTTCTCTGAAGTGTCAGG + Intergenic
932229627 2:70072246-70072268 TAAAAATTTTCTGTAGAGGCTGG - Intergenic
932552467 2:72785445-72785467 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
932904401 2:75733820-75733842 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
932912268 2:75818288-75818310 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
933182509 2:79243418-79243440 CTAATATTCTCTGAAGGGAGGGG + Intronic
933578094 2:84092756-84092778 CAAAATTTTGCTGCAGGGGCAGG - Intergenic
933790775 2:85882187-85882209 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
933818850 2:86091415-86091437 TAAAAATTCTTTGTTGGGGCTGG - Intronic
934083963 2:88494035-88494057 TAAAAATTCTCTGCTAGGGCTGG + Intergenic
935923614 2:108042269-108042291 CAGAAGTTTTCTGCAGGGGCAGG + Intergenic
936547580 2:113405972-113405994 TAAAAATACTCTGAAAGGGAGGG - Intergenic
937183653 2:120018261-120018283 TAAAAATTCTGAGAAGTGGCCGG - Intronic
937373149 2:121316603-121316625 CAAAAATTATCAGAGGGGCCGGG - Intergenic
937501367 2:122482743-122482765 CAGAAATTCCCTGAAGCAGCCGG - Intergenic
937839874 2:126514186-126514208 CAAAAGTTCTTAGAAGGGGGTGG + Intergenic
938266253 2:129930256-129930278 CAAAAATTAGCTACAGGGGCTGG + Intergenic
939079187 2:137639401-137639423 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
939137616 2:138315567-138315589 CAAAAATTTGCTGCAGGGGCAGG - Intergenic
939508359 2:143076165-143076187 CAAAAGTTTGCTGAAGGGCCAGG + Intergenic
939559268 2:143714108-143714130 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
940408801 2:153336121-153336143 CAAAAGTTTGCTGCAGGGGCGGG + Intergenic
940439606 2:153698926-153698948 AAGAAATTCACTCAAGGGGCTGG + Intergenic
941477589 2:165968160-165968182 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
942569686 2:177301452-177301474 AAGAAATTATCTGAAGGGGCTGG - Intronic
942805790 2:179929913-179929935 CAAAAATTTGCTACAGGGGCAGG - Intergenic
943251224 2:185523566-185523588 CAAAAATTTGCTGCAAGGGCAGG + Intergenic
943391811 2:187279034-187279056 CAAAAGTTCTTTGATGGGGTTGG + Intergenic
943879660 2:193125217-193125239 GAAAAATAGTCTGAAGGAGCAGG + Intergenic
943944732 2:194044701-194044723 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
944497696 2:200325290-200325312 CAAAAATCCTTTGAATGGGACGG - Intronic
945695732 2:213101700-213101722 TAAAAATACTCTTAAGGTGCTGG - Intronic
946930109 2:224662604-224662626 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
947824483 2:233095465-233095487 CAAAAATTAGCTGGAGGGGGTGG + Intronic
947950633 2:234144047-234144069 CAAAGATTCTCTAAGGAGGCTGG + Intergenic
1169239857 20:3967698-3967720 CAAAAATGCTCAGAAGTGCCGGG + Intronic
1169766429 20:9152618-9152640 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
1169999235 20:11596457-11596479 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1170708648 20:18768725-18768747 TAAAAATATTCTGAAGAGGCCGG - Intergenic
1170953975 20:20961754-20961776 CATGATTTCTCTGTAGGGGCTGG - Intergenic
1174175697 20:48643314-48643336 CAAAAATTATCTGAATGTGGTGG + Intronic
1175380138 20:58557225-58557247 CACAAAATCTCTCAAGGGGAAGG - Intergenic
1175388794 20:58613709-58613731 CAAAAATGCCCTGATGAGGCCGG + Intergenic
1175559038 20:59902540-59902562 GAAAAACACTCTGAAGGAGCAGG + Intronic
1177258215 21:18693102-18693124 CAGAAGTTCACTGCAGGGGCAGG - Intergenic
1177290019 21:19098750-19098772 CTAAAATTCTCAGGATGGGCTGG + Intergenic
1177504289 21:22000678-22000700 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1178907349 21:36647668-36647690 CAGAAAGTCTCTGATGGGGAAGG - Intergenic
1180194848 21:46187145-46187167 AAAAAATGGGCTGAAGGGGCCGG - Intergenic
1180240840 21:46504020-46504042 TAGAAATTCCCTCAAGGGGCTGG - Intronic
1181091472 22:20475856-20475878 CAAAAATTAGAGGAAGGGGCTGG - Intronic
1182734824 22:32525409-32525431 TAAAGATGCTATGAAGGGGCCGG + Intronic
1183404375 22:37623246-37623268 CACACATTCTCTCAAGTGGCAGG + Intronic
1185070931 22:48655206-48655228 CAAACCGTGTCTGAAGGGGCTGG + Intronic
1185323524 22:50214299-50214321 AAAAAATTGTCAGAAGGGCCGGG - Intronic
950800756 3:15550334-15550356 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
951127011 3:18996141-18996163 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
951199701 3:19863141-19863163 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
952238260 3:31502734-31502756 CGAAATTTCTCAGATGGGGCTGG + Intergenic
952715068 3:36472038-36472060 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
955192656 3:56775920-56775942 CAAAGATTCCCTGAGGGAGCAGG + Intronic
956185676 3:66559865-66559887 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
956910050 3:73807730-73807752 CCAAAGTTTTCTGTAGGGGCAGG + Intergenic
957260612 3:77897059-77897081 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
957988161 3:87597190-87597212 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
958146542 3:89631688-89631710 CAAAAGTTTGCTGTAGGGGCAGG + Intergenic
959788808 3:110332596-110332618 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
961348304 3:126279085-126279107 AAAAAATCCTGTGATGGGGCGGG + Intergenic
962045786 3:131758010-131758032 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
962152120 3:132904040-132904062 CAAAAATTTACTGATGGGACAGG + Intergenic
963394554 3:144715327-144715349 CAAAAGTTTACTGCAGGGGCAGG - Intergenic
964023321 3:152041403-152041425 CAAGGATTCTCTGGAGGGGTAGG + Intergenic
964427413 3:156568344-156568366 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
964710288 3:159664856-159664878 CAAAAGTTCTCAGATGGTGCTGG - Intronic
964710410 3:159665814-159665836 AAAACAGACTCTGAAGGGGCAGG + Intronic
965472303 3:169109710-169109732 CAAAAATACTTAGAAGAGGCCGG - Intronic
966123383 3:176547946-176547968 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
966433396 3:179856491-179856513 GATAAATTCTATGAAGTGGCTGG + Intronic
966446562 3:180007600-180007622 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
966512171 3:180776404-180776426 CAGAAGTTTGCTGAAGGGGCAGG - Intronic
967154978 3:186683875-186683897 CAGAAATTTGCTGCAGGGGCAGG - Intergenic
968176211 3:196551498-196551520 TAAAAATAATCTGAAGAGGCTGG + Intergenic
968314482 3:197711536-197711558 TAAAAATTCTCTGGAAGGGCTGG + Intronic
968366056 3:198185234-198185256 CAAAACCCCCCTGAAGGGGCTGG - Intergenic
971192880 4:24444327-24444349 TAAAAAGCCTCTGATGGGGCAGG - Intergenic
971693145 4:29864046-29864068 CAAAAATTATCTGAGGGTGGTGG - Intergenic
973991675 4:56414622-56414644 AAAAAATTATCTGAAGAGGTTGG + Intronic
974322518 4:60369501-60369523 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
975214560 4:71738443-71738465 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
975403351 4:73962413-73962435 CAGAAATTTGCTGCAGGGGCAGG + Intergenic
975878247 4:78869093-78869115 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
976003625 4:80401609-80401631 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
976318647 4:83686479-83686501 CAAAATTTCTCAGAAGTGTCAGG + Intergenic
976405594 4:84658070-84658092 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
976417994 4:84801690-84801712 CAAACATCCGCTGCAGGGGCGGG + Exonic
976725625 4:88213073-88213095 TAAAAATTCTTTGTAGGGACGGG + Intronic
976921322 4:90447435-90447457 CAAAAATTCTCTGAAGGGGCAGG + Intronic
977744706 4:100532562-100532584 AAAAAATTCATTGAAGGGGATGG - Intronic
977996555 4:103502694-103502716 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
978582204 4:110243389-110243411 CAAAAATGGTATGCAGGGGCCGG - Intergenic
978634523 4:110788668-110788690 TGAAAATTCTCTGAATGAGCTGG - Intergenic
978792478 4:112677098-112677120 CAAAAATTATCTGAGTGTGCTGG + Intergenic
978818598 4:112937478-112937500 CAAAAATTATCTGGAGGTGGTGG - Intronic
978934135 4:114354902-114354924 CAAAAGTTTGCTGTAGGGGCAGG - Intergenic
979319628 4:119308188-119308210 CAAAAGTTCTCAAAAAGGGCCGG + Intergenic
979333862 4:119445620-119445642 CAAAACCCCCCTGAAGGGGCTGG + Intergenic
979659173 4:123233311-123233333 CAAACTTTCTCTGAGGGTGCGGG - Intronic
979810924 4:125034988-125035010 CAAAAATTAGCTAAAGGGGCTGG + Intergenic
980041261 4:127943307-127943329 AAAAAAATCTCTCAAGGGGCAGG + Intronic
980904974 4:138939435-138939457 CAAAAATTTTATCCAGGGGCTGG - Intergenic
982076020 4:151737927-151737949 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
982279152 4:153666144-153666166 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
982400932 4:154967008-154967030 CAAGAGCTCTCTGAAGGGTCAGG - Intergenic
983083394 4:163414775-163414797 CAGAAGTTCCCTGCAGGGGCAGG + Intergenic
984017317 4:174441695-174441717 CAAAAGTTTGCTGAAGGGGTGGG - Intergenic
984597808 4:181690656-181690678 AAAAAATTCCCTGAAAGGGAAGG + Intergenic
984919964 4:184754846-184754868 AAAAAATTCTTTTAAGGGGCAGG + Intergenic
985488394 5:164723-164745 CACTAATACTCTGACGGGGCGGG + Intronic
985488435 5:164983-165005 CACTAATGCTCTGACGGGGCAGG + Intronic
985488448 5:165067-165089 CACTAATGCTCTGACGGGGCGGG + Intronic
985488462 5:165153-165175 CACTAATGCTCTGACGGGGCGGG + Intronic
985488477 5:165237-165259 CACTAATGCTCTGACGGGGCGGG + Intronic
985488483 5:165263-165285 CACTAATGCTCTGACGGGGCGGG + Intronic
985488500 5:165347-165369 CACTAATGCTCTGACGGGGCGGG + Intronic
985488511 5:165403-165425 CACTAATGCTCTGACGGGGCGGG + Intronic
985488517 5:165431-165453 CACTAATGCTCTGATGGGGCGGG + Intronic
985488527 5:165487-165509 CACTAATGCTCTGACGGGGCGGG + Intronic
985488533 5:165515-165537 CACTAATGCTCTGACGGGGCGGG + Intronic
985488539 5:165543-165565 CACTAATGCTCTGACGGGGCGGG + Intronic
985488545 5:165571-165593 CAGTAATCCTCTGACGGGGCGGG + Intronic
985488558 5:165655-165677 CACTAATGCTCTGACGGGGCGGG + Intronic
985488568 5:165711-165733 CACTAATGCTCTGACGGGGCGGG + Intronic
985488574 5:165739-165761 CACTAATGCTCTGACGGGGCGGG + Intronic
985488590 5:165823-165845 CACTAATGCTCTGACGGGGCGGG + Intronic
985488605 5:165907-165929 CACTAATGCTCTGACGGGGCGGG + Intronic
985488616 5:165963-165985 CACTAATGCTCTGACGGGGCGGG + Intronic
985488622 5:165991-166013 CAGTAATCCTCTGACGGGGCGGG + Intronic
985488628 5:166019-166041 CACTAATGCTCTGACGGGGCAGG + Intronic
985488634 5:166047-166069 CACTAATGCTCTGACGGGGCGGG + Intronic
985488650 5:166131-166153 CACTAATGCTCTGACGGGGCGGG + Intronic
985488661 5:166187-166209 CACTAATGCTCTGACGGGGCGGG + Intronic
985488667 5:166215-166237 CAGTAATCCTCTGACGGGGCGGG + Intronic
985488674 5:166243-166265 CACTAATGCTCTGACGGGGCGGG + Intronic
985488680 5:166271-166293 CACTAATGCTCTGACGGGGCGGG + Intronic
985488691 5:166327-166349 CACTAATGCTCTGACGGGGCGGG + Intronic
985488697 5:166355-166377 CACTAATGCTCTGACGGGGCGGG + Intronic
985488716 5:166467-166489 CACTAATGCTCTGACGGGGCGGG + Intronic
985488726 5:166523-166545 CACTAATGCTCTGACGGGGCGGG + Intronic
985488732 5:166551-166573 CACTAATGCTCTGACGGGGCGGG + Intronic
986625620 5:9721114-9721136 CAAAAATTCTCTGACAGGCTAGG + Intergenic
987097915 5:14566368-14566390 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
987391758 5:17382970-17382992 AAAAAGTTGTCTGAAGTGGCTGG + Intergenic
987659571 5:20855056-20855078 CAGAAATTTGCTGCAGGGGCAGG + Intergenic
987984909 5:25134114-25134136 CAGAAGTTTTCTGCAGGGGCAGG + Intergenic
988014102 5:25530583-25530605 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
988129112 5:27080074-27080096 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
988456584 5:31392394-31392416 CAATAATTCTTTGTTGGGGCAGG - Intergenic
988620302 5:32816198-32816220 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
988694254 5:33604242-33604264 TAAAAATCATCTGAAGGAGCAGG + Intronic
988764073 5:34350591-34350613 CAGAAATTTGCTGCAGGGGCAGG - Intergenic
988863874 5:35313630-35313652 CTAACACTCTCTGGAGGGGCAGG + Intergenic
990075733 5:51843848-51843870 CAAAAGTTTACTGCAGGGGCGGG - Intergenic
990125936 5:52518084-52518106 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
990256333 5:53974406-53974428 CAGAAATTCCTTAAAGGGGCAGG - Intronic
990296323 5:54405440-54405462 TAAAAATTATCTAAAAGGGCTGG - Intergenic
990429173 5:55717727-55717749 CAAAAGTTTTCTGCAGGGGTGGG + Intronic
993015650 5:82532008-82532030 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
993091755 5:83434869-83434891 CTACAAATCCCTGAAGGGGCTGG + Intergenic
993893694 5:93505503-93505525 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
993953034 5:94199470-94199492 CAAAAGTGCTCTGATGGGGAAGG + Intronic
994271492 5:97782823-97782845 CATAAATTCACTGCAGGGGCAGG - Intergenic
994523203 5:100868608-100868630 CAAAAATTCTGGGTAGGGGAGGG - Intronic
994524215 5:100882905-100882927 CAGAAGTTCGCTGCAGGGGCGGG + Intronic
994828541 5:104747186-104747208 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
995072822 5:107943791-107943813 CAAACTTTCTCTGAAGGACCAGG - Intronic
996630308 5:125623730-125623752 AAAAAATTTTCTTGAGGGGCTGG + Intergenic
997081723 5:130747093-130747115 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
997108229 5:131045853-131045875 CAAAATTTTGCTGCAGGGGCAGG - Intergenic
997953797 5:138262761-138262783 CAAACATTCTCAGAAAGGGGAGG - Intronic
998144676 5:139720411-139720433 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
998722999 5:144975593-144975615 CAAAAGTTCACTGCAGGGGCAGG + Intergenic
998889363 5:146729829-146729851 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
999668120 5:153934473-153934495 CAAAAATTTGCTGCAGGGGCAGG - Intergenic
999996511 5:157097554-157097576 TAAAAATTCTTTGAGGAGGCCGG - Intronic
1000324882 5:160164723-160164745 AAAAAATTATCTGTAGAGGCAGG + Intergenic
1000648416 5:163785702-163785724 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1000926375 5:167199454-167199476 TAAAAAGCCTCTGAAGGTGCCGG - Intergenic
1000986492 5:167866343-167866365 CAAAAATTATCTGAATGTGGTGG + Intronic
1001118236 5:168957359-168957381 CTAAAATGGGCTGAAGGGGCTGG - Intronic
1002459066 5:179363823-179363845 CAAGAATTCACTGAGGGGCCAGG + Intergenic
1002725284 5:181290459-181290481 CAAAACCCCCCTGAAGGGGCTGG - Intergenic
1003021468 6:2513624-2513646 TAAAAATTCTCTGAAGAGTAAGG + Intergenic
1003401741 6:5796300-5796322 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1003682995 6:8274289-8274311 CAAAATTTCTCTCATGTGGCTGG - Intergenic
1003863505 6:10343126-10343148 TAAAAATTCTTTGTAGAGGCAGG + Intergenic
1005008098 6:21310164-21310186 AGAAAATTCTCTGAAGCGACGGG + Intergenic
1005904980 6:30254756-30254778 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1005921731 6:30407677-30407699 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1007656231 6:43452561-43452583 CAAAAATTAGCTGAAGTGGCGGG + Intronic
1008460678 6:51766033-51766055 GATAAATTCTGTGAAGGGGCGGG - Intronic
1008859677 6:56133929-56133951 CAGAAATTTGCTGCAGGGGCAGG + Intronic
1009348480 6:62646370-62646392 CAAAAGTTTGCTTAAGGGGCAGG + Intergenic
1009538657 6:64924089-64924111 GCAAAATTTGCTGAAGGGGCGGG - Intronic
1009731043 6:67607322-67607344 CCAAAACTCTCTGAATGGGCAGG + Intergenic
1010884381 6:81218212-81218234 CAGAAATTTGCTGCAGGGGCAGG + Intergenic
1011020393 6:82806436-82806458 CAAAAAGTCAATGAATGGGCTGG - Intergenic
1012306366 6:97663073-97663095 CATAAATTCTCTAAAGGAGGAGG + Intergenic
1012690755 6:102308119-102308141 CAGAAATTTTCTGCAGTGGCAGG - Intergenic
1012858263 6:104528406-104528428 CAAAAATTCTTTGTAGTGGGGGG + Intergenic
1013086662 6:106863299-106863321 CAAAAGTTCGCTGCAGGGGCAGG + Intergenic
1013235782 6:108196913-108196935 CAAAAATCGTGTGTAGGGGCTGG + Intergenic
1013404619 6:109831804-109831826 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1013863152 6:114660616-114660638 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1014691691 6:124570677-124570699 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1015053804 6:128875354-128875376 CAAAAGTTTGCTGTAGGGGCAGG + Intergenic
1015325859 6:131922739-131922761 CAAAACTTCATTGAAGGGGTGGG - Intergenic
1015815689 6:137208712-137208734 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1016442207 6:144095750-144095772 GCAACATTCTCTGATGGGGCGGG - Intergenic
1016810772 6:148259285-148259307 CCAAAATTCTATGAAGGGACAGG + Intergenic
1017930472 6:158949637-158949659 TAAAAAATCACTGTAGGGGCAGG - Intergenic
1018666140 6:166140300-166140322 AAAAAATTATTTGAAGGGGAAGG + Intergenic
1018721588 6:166577168-166577190 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
1020069119 7:5213979-5214001 AAGAAATGCCCTGAAGGGGCCGG - Intronic
1020585046 7:10055312-10055334 CAGAAGTTTTCTGCAGGGGCAGG + Intergenic
1020631830 7:10649403-10649425 CAAAATTTTGCTGCAGGGGCGGG - Intergenic
1021035330 7:15791129-15791151 AAAAAATTCTATGAAGTTGCAGG + Intergenic
1021746686 7:23747662-23747684 CAAAAATAATCTGAACAGGCCGG - Intronic
1022549723 7:31227436-31227458 CAAAAGTTTGCTGCAGGGGCGGG + Intergenic
1022607861 7:31834200-31834222 CAGAAATTTGCTGCAGGGGCAGG + Intronic
1023284812 7:38608131-38608153 CAGAAAATCTCTGAAGGGCCAGG - Intronic
1023877101 7:44292713-44292735 CAAAAAGGCTCTGGAGGGCCAGG + Intronic
1024137916 7:46429693-46429715 CAAAAGTTTGCTGAAGGGGTAGG - Intergenic
1024289812 7:47794546-47794568 CAAAAGTTTTCTGCAGGGGCGGG + Intronic
1025771562 7:64512151-64512173 AAAAAAGTTTCTTAAGGGGCTGG + Intergenic
1026484484 7:70806606-70806628 CAAAAGTTCAGTGAAGGGCCAGG - Intergenic
1026573348 7:71551841-71551863 CAAAAATTCTCACTAGAGGCAGG - Intronic
1026730527 7:72907805-72907827 CAAAAAACATCTGAAGAGGCTGG - Intronic
1026743106 7:72990969-72990991 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1026802976 7:73411422-73411444 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1027029221 7:74875673-74875695 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1027100629 7:75374109-75374131 CCAAAGGTCTCTGAAGGGCCAGG - Intergenic
1027113440 7:75459301-75459323 CAAAAAACATCTGAAGAGGCCGG + Intronic
1027285689 7:76643896-76643918 CAAAAAACATCTGAAGAGGCCGG + Intergenic
1027300396 7:76827880-76827902 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1027842254 7:83327904-83327926 ATAAAATTCTTGGAAGGGGCTGG + Intergenic
1028249688 7:88526230-88526252 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1028568228 7:92256887-92256909 GAAAAATTGTCACAAGGGGCTGG + Intronic
1028583302 7:92428723-92428745 CAGAAATTATTTGAGGGGGCTGG - Intergenic
1029082966 7:97989223-97989245 CAAGAAATCACTGAAGGGCCAGG - Intronic
1030225469 7:107145717-107145739 AAAAAATCATCTGAAGAGGCTGG - Intronic
1030806836 7:113929788-113929810 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1030970059 7:116045597-116045619 CAAAAGTTTGCTGCAGGGGCAGG + Intronic
1031145743 7:117995190-117995212 CAAAAGTTTACTGAAGGGGCAGG + Intergenic
1031288928 7:119908059-119908081 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1031298827 7:120039137-120039159 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1031428107 7:121632457-121632479 CAAATATTCTCTAAAGCAGCAGG + Intergenic
1032047586 7:128622364-128622386 CAAAACCCCCCTGAAGGGGCTGG - Intergenic
1032264745 7:130363071-130363093 CAAAGAGGCTCTGAAGGGGCTGG - Intronic
1033423062 7:141219631-141219653 ACAAGATTCTCTGCAGGGGCCGG - Intronic
1033826176 7:145192306-145192328 CAAAAATTCACTTCATGGGCTGG + Intergenic
1034037290 7:147837961-147837983 CAGAAATTTGCTGCAGGGGCGGG - Intronic
1034115951 7:148583803-148583825 TAAATATTCTCAGAAAGGGCTGG + Intergenic
1034185630 7:149174482-149174504 TAAAAATTTTCTGAATGGGCTGG - Intronic
1034870066 7:154676018-154676040 AAAAACTTCTCTCCAGGGGCGGG + Intronic
1034886927 7:154805292-154805314 CAAAAAATCTGTGGTGGGGCAGG - Intronic
1037043527 8:14267630-14267652 CAAAAACTCTCTGAAGCATCAGG - Intronic
1037418374 8:18675565-18675587 CAAAATTTTTCTGAACGGGCTGG - Intronic
1037706463 8:21319614-21319636 CAAAAATTCTATGATGGAGGTGG + Intergenic
1037975644 8:23209246-23209268 CAAAAGTTTGCTGTAGGGGCAGG + Intronic
1042073918 8:64967574-64967596 CAAAAGTTTGCTGCAGGGGCTGG - Intergenic
1042602547 8:70512681-70512703 CAAAAGTTTTCTGCAGGGGTGGG + Intergenic
1042728336 8:71903065-71903087 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1043527754 8:81114343-81114365 AAAGAATTCTTTGAAGGAGCTGG + Intergenic
1044782977 8:95762645-95762667 CAAGAATTCTATGAAGTGGGTGG - Intergenic
1045713192 8:105010901-105010923 CAGAAATTCTCTTAAGCTGCAGG - Intronic
1046024500 8:108705988-108706010 TCAGAATTCTCTGAAGTGGCTGG - Intronic
1046656349 8:116899313-116899335 CAAAAGTTTGCTGCAGGGGCAGG + Intergenic
1046724403 8:117658751-117658773 CAAATATTTTCTGAGGGGACTGG - Intergenic
1047725542 8:127680970-127680992 CCAAAATTCTTTGAAGGACCAGG + Intergenic
1048465419 8:134661387-134661409 GAGAAACTGTCTGAAGGGGCTGG + Intronic
1048782981 8:138021957-138021979 CAAAAGTTTGCTGCAGGGGCTGG + Intergenic
1048923383 8:139250379-139250401 CAAAAATTTGCTGCAGGGGTGGG + Intergenic
1051382270 9:16470793-16470815 CAAAAGTTTGCTGCAGGGGCGGG + Intronic
1051733179 9:20169401-20169423 CACAAATTCTCTGAAGGAAGTGG + Intergenic
1052006983 9:23360740-23360762 CAAAAATTTGCTGCAGGGGCAGG - Intergenic
1052161717 9:25269727-25269749 AAAAAATTCTCTCAAAGAGCTGG - Intergenic
1052351754 9:27465637-27465659 CAAAAGTTTGCTGCAGGGGCGGG - Intronic
1052385364 9:27817120-27817142 CAAAATTTCTGTGAAGGGCCAGG - Intergenic
1052684763 9:31741087-31741109 GAAAATTTCACTAAAGGGGCTGG - Intergenic
1053286638 9:36853867-36853889 CTAAAATTCTCAGAAGTGACAGG + Intronic
1055080804 9:72266124-72266146 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1055679383 9:78699283-78699305 AAAAAATACTCTAAATGGGCTGG - Intergenic
1056129205 9:83567052-83567074 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1056831179 9:89918678-89918700 TAAAATGTCTCTAAAGGGGCTGG - Intergenic
1056924376 9:90820368-90820390 CAAAAGTTCGCTGCAGGGGCAGG - Intronic
1057344293 9:94234562-94234584 CAAAAAGTCTATGAAGGAACAGG + Intergenic
1059214520 9:112548282-112548304 CAAAGATTTTCTGAATGGCCGGG - Intronic
1059482293 9:114600821-114600843 CAAAAGTTTGCTGAAGGGGCGGG - Intergenic
1059620432 9:115998753-115998775 GAAAAATGCTCTGAAGGGGTTGG + Intergenic
1059753603 9:117272079-117272101 CAAAAGTTTGCTGCAGGGGCAGG - Intronic
1059986299 9:119823734-119823756 CAAAAGTTTGCTGCAGGGGCGGG + Intergenic
1060178348 9:121514243-121514265 CAAAGGTTTTCTGCAGGGGCGGG - Intergenic
1060669519 9:125457283-125457305 AAAAAATTCACTAAATGGGCCGG - Intronic
1062750425 9:138248101-138248123 CAAAACCCCCCTGAAGGGGCTGG - Intergenic
1185433661 X:24611-24633 TAAAAATACTTTAAAGGGGCCGG + Intergenic
1185442866 X:236679-236701 TAAAAATACTTTAAAGGGGCCGG + Intergenic
1186165289 X:6820975-6820997 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1187408290 X:19024277-19024299 CAAAAATTTTCGAGAGGGGCAGG + Intronic
1188426879 X:30058864-30058886 AAGAAATCGTCTGAAGGGGCTGG - Intergenic
1188541856 X:31259479-31259501 CAAAAACATTCTGTAGGGGCTGG + Intronic
1189087994 X:38047260-38047282 CAAAAGTTTGCTGGAGGGGCAGG - Intronic
1189371779 X:40434550-40434572 CAAAAATCCTATGGAGGGCCGGG - Intergenic
1192422384 X:71045244-71045266 GAAGAATTCTTTGAAGGGCCTGG + Intergenic
1193013414 X:76704608-76704630 CACAAATTCACTGAAGTGGCAGG + Intergenic
1193098786 X:77583929-77583951 AAGAAATTCTGTGAAGTGGCAGG + Intronic
1193167660 X:78300857-78300879 CAGAAATTTGCTGGAGGGGCAGG - Intronic
1193655198 X:84188997-84189019 CCAACATTCTCAGAGGGGGCTGG - Intergenic
1193808022 X:86016664-86016686 CAGAAGTTTTCTGCAGGGGCGGG + Intronic
1194089064 X:89563542-89563564 CAGAAGTTTTCTGCAGGGGCAGG - Intergenic
1194496323 X:94621287-94621309 CAAAAGTTTGCTGCAGGGGCGGG - Intergenic
1194503804 X:94708510-94708532 CAAAAGTTTCCTGAAGGGACTGG - Intergenic
1195279638 X:103318523-103318545 CTAAAACTCTCTGAAGGAGAGGG + Intergenic
1196368277 X:114947105-114947127 CAAAAGTTTGCTGCAGGGGCAGG - Intergenic
1196480469 X:116141671-116141693 CAAAAGTTTGCTGAAGGGGCGGG + Intergenic
1196503350 X:116411330-116411352 CAGAAATTTGCTGTAGGGGCAGG + Intergenic
1197267201 X:124387673-124387695 CAATAATTCTCAGAAGGGTAGGG - Intronic
1197317064 X:124980073-124980095 CAAAAATTCATGGAAGAGGCTGG + Intergenic
1197891084 X:131271222-131271244 AAAAAATTTTCTGAAGTGGCCGG + Intergenic
1197914581 X:131521130-131521152 CAAAAGTTTGCTGCAGGGGCGGG + Intergenic
1198101116 X:133422552-133422574 AAAGAATGATCTGAAGGGGCGGG + Intergenic
1199278102 X:145970051-145970073 CAGAAGTTTGCTGAAGGGGCAGG + Intergenic
1199570432 X:149262059-149262081 GCACATTTCTCTGAAGGGGCAGG - Intergenic
1199865388 X:151843665-151843687 CAAAAATTGACAGAAGGGGAGGG + Intergenic
1200385898 X:155890654-155890676 CAAAAACTGACTGAAGGGCCAGG - Intronic
1200441732 Y:3219592-3219614 CAGAAGTTTTCTGCAGGGGCAGG - Intergenic