ID: 976922212

View in Genome Browser
Species Human (GRCh38)
Location 4:90454708-90454730
Sequence CCTGACTACTGTGGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976922212_976922218 29 Left 976922212 4:90454708-90454730 CCTGCTTTTCCACAGTAGTCAGG 0: 1
1: 0
2: 5
3: 11
4: 202
Right 976922218 4:90454760-90454782 CCAGGAGAGTTAAAATACTTGGG No data
976922212_976922215 11 Left 976922212 4:90454708-90454730 CCTGCTTTTCCACAGTAGTCAGG 0: 1
1: 0
2: 5
3: 11
4: 202
Right 976922215 4:90454742-90454764 AAGTAACATAATGTTCTTCCAGG 0: 1
1: 2
2: 9
3: 31
4: 250
976922212_976922216 28 Left 976922212 4:90454708-90454730 CCTGCTTTTCCACAGTAGTCAGG 0: 1
1: 0
2: 5
3: 11
4: 202
Right 976922216 4:90454759-90454781 TCCAGGAGAGTTAAAATACTTGG 0: 1
1: 17
2: 50
3: 35
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976922212 Original CRISPR CCTGACTACTGTGGAAAAGC AGG (reversed) Intronic
901907289 1:12424619-12424641 CCTGATTAGGGTGGAAAAGGGGG - Intronic
906860253 1:49351692-49351714 CATGACTTCTGTGGATAAGAGGG - Intronic
907412765 1:54294208-54294230 GGTGACTACTCTTGAAAAGCAGG - Intronic
907513650 1:54980257-54980279 TCTGACTGCTGTGAAAAAGCAGG + Intergenic
908641151 1:66225023-66225045 CCAGAGTACAGTGGAAATGCTGG - Intronic
915029816 1:152868709-152868731 CCTGACAACTGTCTAACAGCTGG + Intergenic
916551654 1:165855689-165855711 TCTGACTAGTGTGTAGAAGCTGG + Intronic
917136480 1:171792828-171792850 CCTGAGCACTGTGGAAATTCTGG - Intronic
921366946 1:214383397-214383419 CCTGACTAGTGTGAAGGAGCGGG - Exonic
921683272 1:218059812-218059834 TCTTGCTACTTTGGAAAAGCAGG + Intergenic
922741133 1:228014817-228014839 CCTCACTTCTGTTGAAAGGCTGG - Intronic
923526983 1:234780218-234780240 CCAGACTATGGTGGAACAGCAGG - Intergenic
923827566 1:237516838-237516860 ACTGACTGCTGTGGAAAGGCAGG - Intronic
924841793 1:247718610-247718632 GCTGAGTACTTTGGAAAAACTGG + Intergenic
1067765267 10:49081158-49081180 GCTGACCAATGTGGAAAGGCAGG - Intronic
1068474012 10:57502134-57502156 CTTGACCACTGGGGAAAAGAGGG - Intergenic
1068704685 10:60061203-60061225 CCAGACTCTTGTTGAAAAGCTGG + Intronic
1071954416 10:90742499-90742521 GCTGACTACTGTAGAAAAAAAGG - Exonic
1073890031 10:108090822-108090844 CCTAACGACTGTGGTCAAGCTGG - Intergenic
1077803719 11:5568647-5568669 CCTTAATACTCTGCAAAAGCAGG + Intronic
1078939445 11:15985515-15985537 CCTGACTACTGTGGTTATGAGGG + Intronic
1079181955 11:18201566-18201588 CTTGACTACTGTGCACTAGCAGG + Intronic
1079937833 11:26639941-26639963 CCTGACTATTGGGGAAGAACTGG + Intronic
1081473215 11:43396841-43396863 CCTGAGGAATGTGGAAAATCAGG - Intronic
1081521036 11:43881146-43881168 CCTGTTTACTGAGGAAAAACTGG + Exonic
1081955983 11:47093703-47093725 CCTTACTACTGGGGAAACTCAGG - Intronic
1082131779 11:48498863-48498885 CCAGACTACAGAGGAGAAGCAGG - Intergenic
1082245302 11:49914698-49914720 CCGGACTACAGAGGAGAAGCAGG + Intergenic
1083122683 11:60531369-60531391 CCAGACTACAGGGGAAAAGTAGG - Intronic
1083870814 11:65487404-65487426 CTTGACTACTCTGGAAAATGAGG + Intergenic
1084147375 11:67272248-67272270 CTTGACCTCTGTGGAAGAGCTGG - Intronic
1084489898 11:69472540-69472562 CTTGACAACTCTGGAAAATCGGG + Intergenic
1087131485 11:94672738-94672760 GCTGACTGCTGTGGCAGAGCAGG - Intergenic
1090087730 11:123665671-123665693 CCTTGCTACTGTGGTAAAGATGG + Intergenic
1090765630 11:129873833-129873855 CCCGACTGCTGGGGAACAGCAGG + Exonic
1091005586 11:131950279-131950301 CCTGTGTGCAGTGGAAAAGCAGG - Intronic
1093427168 12:19041163-19041185 TCTGAGTACTTTGGAAAAGGTGG + Intergenic
1095045361 12:37497541-37497563 CCTGACAAATGTGTAAAGGCAGG + Intergenic
1095279111 12:40328844-40328866 TCTGACTACTGTGGAGTATCAGG - Intronic
1095334690 12:41011012-41011034 CCTAACCACAGTGGAAAAGCAGG - Intronic
1095766091 12:45897527-45897549 CCTAACTACTGTGTAAAACAGGG + Intronic
1097077810 12:56408239-56408261 CCTGAACACTGCTGAAAAGCAGG - Intergenic
1097130480 12:56807549-56807571 CCTGACCACCGCTGAAAAGCAGG - Intergenic
1099848181 12:88056679-88056701 CCTGACTACTGGGACAAACCAGG - Intronic
1101083762 12:101214733-101214755 CTTGACTTCTGTGCACAAGCAGG - Intergenic
1105643181 13:22287325-22287347 CCTGACCAGTCTGGAAAACCAGG - Intergenic
1105713161 13:23033114-23033136 CCTGACCAGTGTGGAAAATAAGG - Intergenic
1107678230 13:42818812-42818834 CCTGACTTCTGTGGACTGGCAGG + Intergenic
1108835385 13:54539863-54539885 CATGAGTACTGAGGTAAAGCAGG + Intergenic
1116558019 14:46337875-46337897 ACTGATGTCTGTGGAAAAGCAGG - Intergenic
1118741306 14:68741381-68741403 CCTGACTACTATGGAAATTGAGG + Intergenic
1121028903 14:90641002-90641024 GCTCACTACTCTGGAGAAGCAGG - Intronic
1121230221 14:92352118-92352140 CCTGACCACTAGGGAAAAGTAGG + Intronic
1123809818 15:23912505-23912527 ACTGACTCCTGAGGAAAGGCAGG - Intergenic
1125341951 15:38684092-38684114 CCTGACAACTCTGGAAACCCGGG - Intergenic
1125928257 15:43581256-43581278 GCTGACTGCCATGGAAAAGCTGG - Exonic
1125941423 15:43681091-43681113 GCTGACTGCCATGGAAAAGCTGG - Intergenic
1126289779 15:47060956-47060978 CCTGACAAATGTGTAAAGGCAGG - Intergenic
1127546166 15:59995917-59995939 CCTAACAACTATGGAAAATCTGG + Intergenic
1130078666 15:80711979-80712001 TCTGACGACTGCAGAAAAGCAGG - Intronic
1130358978 15:83162932-83162954 CATGAATACTGTGGAATAGTTGG - Intronic
1135207320 16:20494257-20494279 CCTGACTACCGTTGAAAAGCAGG + Intergenic
1135211565 16:20529375-20529397 CCTGACTACCGTTGAAAAGCAGG - Intergenic
1135998521 16:27271791-27271813 GCTGACTGCTCTGGAAAAGTGGG + Intronic
1137691874 16:50434032-50434054 CTTGACTACTGTTGAGAGGCTGG - Intergenic
1138219141 16:55236224-55236246 CAAGACTACTGTGGAAAGGCAGG - Intergenic
1138556916 16:57776159-57776181 GCTGTCTGCTGAGGAAAAGCGGG + Intronic
1139694712 16:68665948-68665970 CATGTTTACTGTGGAAAAACTGG + Intronic
1142881469 17:2885441-2885463 CCTGGCTCCTGTGGACATGCAGG - Intronic
1144076861 17:11727393-11727415 CCTCACCACTCTGGAAAACCTGG + Intronic
1149654716 17:58304225-58304247 CTGGACTACAGTGGGAAAGCTGG + Intronic
1150828134 17:68494657-68494679 CCTGACCACTGTGGAAAAGTTGG + Intergenic
1151179602 17:72317388-72317410 GCTCACTAGTGTGGAAATGCAGG + Intergenic
1156751829 18:40467866-40467888 TCTGACTACTATGGAAGAGGAGG + Intergenic
1157272851 18:46289979-46290001 ACTGACCACTGAGGAATAGCAGG + Intergenic
1157979602 18:52365645-52365667 TCTGACTACAGTGGAGAAGGAGG - Intronic
1159648019 18:70942947-70942969 CCATACTACTGTGGCTAAGCTGG - Intergenic
1160000039 18:75009191-75009213 ACTGACTACATAGGAAAAGCTGG - Intronic
1162794294 19:13078615-13078637 CCTGACTTCTTTAGAGAAGCCGG - Exonic
1163359075 19:16834242-16834264 CCTGAATGCTGTGGAAACTCTGG + Intronic
1165431813 19:35777245-35777267 CCAGGCTATTGCGGAAAAGCTGG + Intronic
1168401340 19:56087680-56087702 CCGGACAACTGAGGAAGAGCAGG + Exonic
924964122 2:59713-59735 CCTCACCACTGCTGAAAAGCAGG + Intergenic
925451446 2:3973034-3973056 CCTGCCTGCTGTGGGAAATCAGG - Intergenic
927047779 2:19297495-19297517 CCTGACTTCTGGGGAGAAACAGG + Intergenic
927479787 2:23443304-23443326 AATGACCACTGTGGCAAAGCAGG - Intronic
927544821 2:23943278-23943300 CCTGACTGCTGTGTAGAAACTGG + Intronic
932791643 2:74658692-74658714 GCTGACTACTGTGTAACAGATGG - Intronic
934487904 2:94735161-94735183 CATCCATACTGTGGAAAAGCTGG - Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
936770371 2:115905680-115905702 ACTGACTTCTGTTGAAAAGGGGG - Intergenic
937052370 2:118902864-118902886 CCTCACCACAGTGGAAAAACAGG + Intergenic
938820333 2:134951409-134951431 CCACACTACTTTGGAAAAGTGGG + Intronic
941108336 2:161388825-161388847 ACTCACTGCTGTGGAAAAGCAGG - Intronic
943213514 2:185000304-185000326 CTTGACTACAGTGCAAACGCTGG + Intergenic
943441475 2:187932648-187932670 CCTGACTACTGCTGAAAAGCAGG - Intergenic
946057016 2:216911380-216911402 CCTGCCTAGTGTGTAAAACCTGG + Intergenic
948313827 2:237011372-237011394 CCACACTACTGTGTAAAGGCTGG + Intergenic
1171304470 20:24093471-24093493 GCTGACTGCCCTGGAAAAGCTGG - Intergenic
1171539912 20:25941146-25941168 CCTGACAAATGTGTAAAGGCAGG + Intergenic
1171801148 20:29619174-29619196 CCTGACAAATGTGTAAAGGCAGG - Intergenic
1171842830 20:30236364-30236386 CCTGACAAATGTGTAAAGGCAGG + Intergenic
1171908320 20:30919742-30919764 CCTGCCAACTGTGGAAAGCCCGG + Intergenic
1172506512 20:35466868-35466890 CCTGACTACTGAGGGAAGGAAGG - Intronic
1173247140 20:41344699-41344721 CCTGTCTGGTGTGGGAAAGCTGG + Intronic
1176732665 21:10516253-10516275 CCTGTGTACTGTGGAAACGTAGG + Intergenic
1176990402 21:15489757-15489779 CCTGATAACTGTTTAAAAGCAGG - Intergenic
1179056115 21:37936208-37936230 CATGACTACTGTAGATGAGCAGG - Intergenic
1180584073 22:16870100-16870122 CCTGAAAACTGTAGAAAGGCAGG + Intergenic
1184352882 22:43956043-43956065 CCTGTCTACCGTGCAAAAGACGG + Intronic
1184611122 22:45603972-45603994 CTTGAGAACTTTGGAAAAGCTGG - Intergenic
952156857 3:30652752-30652774 CTTGTCTACTGTAGACAAGCTGG - Intronic
952341331 3:32449973-32449995 CCTGAATACTGTTAAAAATCAGG - Intronic
953493613 3:43369042-43369064 CCTGGCTACTGTGGAGCAGGGGG - Intronic
953702190 3:45205422-45205444 CCTGCCCACTGTGAAACAGCTGG - Intergenic
953791576 3:45951704-45951726 CCTGACTTCTGGAGAAAAGATGG - Intronic
954638981 3:52086934-52086956 CCTGAGTGCTATGGAAATGCAGG + Intronic
954853968 3:53626915-53626937 CCTTACTACAGTGGCAAGGCAGG - Intronic
961024008 3:123536300-123536322 CTTCAATACTGTGGAAATGCAGG + Intronic
961103545 3:124221979-124222001 CCTGAACACTGGGGAAATGCTGG - Intronic
964555658 3:157935180-157935202 TCTGACTCTTTTGGAAAAGCAGG - Intergenic
965086912 3:164111877-164111899 CTTGACTACTGTGCACATGCAGG + Intergenic
966051031 3:175618076-175618098 CCTGACTACTGCTGAGAAGGAGG - Intronic
966373117 3:179268849-179268871 CCTTTTTACTCTGGAAAAGCAGG - Intergenic
967852908 3:194095605-194095627 TCTTCCTACTGTGGAACAGCAGG - Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968490580 4:888754-888776 CCTGGCTGCGGTGGAACAGCTGG - Intronic
969218714 4:5745287-5745309 CCTGGCTGATGTGGAAAAGAAGG + Exonic
969299833 4:6291407-6291429 CCTGGCTCCTGTGGGAAGGCTGG - Intronic
969463126 4:7339328-7339350 CCTGACTGCAGTGCAACAGCTGG + Intronic
971034628 4:22679538-22679560 TCTGACCACTGTAGAAAAGGGGG + Intergenic
971582658 4:28362507-28362529 CCTGACTCCTTTGAAGAAGCTGG + Exonic
974697595 4:65396421-65396443 CCTGACTACCACTGAAAAGCAGG + Intronic
976030158 4:80742050-80742072 CATGACTACTGTGGGAGAGATGG + Intronic
976922212 4:90454708-90454730 CCTGACTACTGTGGAAAAGCAGG - Intronic
979374746 4:119933005-119933027 CCTGACTCTTGTGGAGAGGCAGG - Intergenic
981858531 4:149325943-149325965 ACAGACTATTGTGGAAAAGGTGG + Intergenic
984145372 4:176053831-176053853 CCTGGTTAGTATGGAAAAGCTGG + Intergenic
989185088 5:38616021-38616043 CCTGACTGCTGTGAACCAGCTGG + Intergenic
990537414 5:56736468-56736490 CCAGGCTGCTGTGGAAAGGCCGG - Intergenic
991165917 5:63565416-63565438 CCTGACTACCACTGAAAAGCAGG + Intergenic
995039609 5:107572538-107572560 CTTGACTACTGGAGAAAATCTGG + Intronic
997394966 5:133552372-133552394 GGTGAGGACTGTGGAAAAGCAGG + Intronic
998800206 5:145861444-145861466 GCTGACTTCTGGGGACAAGCAGG - Intronic
1000146611 5:158459536-158459558 CCTGACCACTGTTGAATTGCAGG - Intergenic
1003507576 6:6752336-6752358 CCTGGCTGCTGTGGGGAAGCTGG - Intergenic
1003892997 6:10580203-10580225 TCTGAATACACTGGAAAAGCTGG + Intronic
1007637481 6:43308041-43308063 CTTGACCACAGTGGAAATGCTGG - Intronic
1009242849 6:61201430-61201452 CCTGACTACCATGGAAAAGCAGG - Intergenic
1010197330 6:73253204-73253226 TCAGATTACTGTGGAAAAGGCGG + Intronic
1010199486 6:73270143-73270165 TCAGATTACTGTGGAAAAGGCGG - Intronic
1012022855 6:93947260-93947282 TCTGAGTAGTGTGGAAAAGAGGG - Intergenic
1012460625 6:99456423-99456445 CCTGACTACTGTGGGAAGTCAGG + Intronic
1016524883 6:144990445-144990467 CCTGGGTAATGTGGAGAAGCTGG + Intergenic
1017946589 6:159100983-159101005 CCAGGCTGCTGTGGAACAGCTGG - Intergenic
1019871841 7:3770953-3770975 CCTGCCTATTGTGAATAAGCAGG - Intronic
1020067431 7:5199618-5199640 CCTTTCTTCTGTGGATAAGCTGG + Exonic
1021677784 7:23098171-23098193 GCTGGCTACTGTGGCAAGGCAGG - Intergenic
1021786395 7:24156828-24156850 TCTGACTCCTGTGGAGAAGAGGG - Intergenic
1023801474 7:43838816-43838838 CCTGACTACTGAGGAGCAGTTGG - Intergenic
1024771231 7:52725524-52725546 CCAGAACACTGTGGAAAATCAGG - Intergenic
1025291351 7:57727383-57727405 CCTGACAAATGTGTAAAGGCAGG + Intergenic
1025907627 7:65800127-65800149 CATGTCTACTGTGGAAATGTGGG - Intergenic
1027599909 7:80227224-80227246 CCTAAATACTGTGGAAAAACAGG - Intergenic
1028728297 7:94114765-94114787 CCTGCCAACAGTGAAAAAGCAGG + Intergenic
1031165693 7:118224702-118224724 CCTGACGAAAGTGGAAATGCTGG - Exonic
1031290284 7:119925888-119925910 CTTGCCTTCTCTGGAAAAGCTGG + Intergenic
1033178536 7:139150747-139150769 CCTGTTTACTTTAGAAAAGCAGG - Intronic
1034596919 7:152205268-152205290 CCTGTGTACTGTGGAAATGTAGG - Intronic
1034869503 7:154671384-154671406 CCTGACTACTATAAAAAGGCTGG - Intronic
1036263557 8:7258125-7258147 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036264858 8:7265747-7265769 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036266159 8:7273369-7273391 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036267460 8:7280991-7281013 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036268762 8:7288613-7288635 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036270066 8:7296235-7296257 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036297830 8:7550820-7550842 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036299134 8:7558468-7558490 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036300439 8:7566118-7566140 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036301742 8:7573762-7573784 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036303039 8:7581411-7581433 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036315598 8:7716664-7716686 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036316906 8:7724312-7724334 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036318213 8:7731960-7731982 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036319522 8:7739607-7739629 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036320829 8:7747255-7747277 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036322139 8:7754903-7754925 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036323448 8:7762551-7762573 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036324743 8:7770198-7770220 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036351291 8:8014109-8014131 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036352596 8:8021755-8021777 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036353888 8:8029403-8029425 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036629218 8:10498763-10498785 CATGACGAGTTTGGAAAAGCAGG + Intergenic
1036846558 8:12174528-12174550 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1042739360 8:72026182-72026204 CCTGACTTCTGTGCCACAGCTGG + Intronic
1044008459 8:86964443-86964465 CCTGACCACTGCTGAAAAGCAGG - Intronic
1044016431 8:87052729-87052751 CCTGACTGCTGTGGAGAAACAGG - Intronic
1044777520 8:95707091-95707113 ACTGTGTACTGTGGAAAAGAGGG - Intergenic
1046845362 8:118909190-118909212 CCTGACTTCTGGGGAAACGGAGG + Intergenic
1049790474 8:144470034-144470056 CCAGACACCTGTGGAAAAGCAGG + Intronic
1050439944 9:5650925-5650947 CTTTACTAATGTGGAAATGCAGG + Intronic
1053919689 9:42975512-42975534 CATCCATACTGTGGAAAAGCTGG + Intergenic
1054165151 9:61718303-61718325 CCTGACAAATGTGTAAAGGCAGG - Intergenic
1055470939 9:76609798-76609820 ATTGAATACTGTGGGAAAGCAGG + Intergenic
1057312306 9:93950043-93950065 TCTGACTTCTGTGGAAAGGGAGG - Intergenic
1058013774 9:100007120-100007142 CCTAACTACAGAGGAAAAGCTGG + Intronic
1058453437 9:105117608-105117630 CCTGACTGCCTTGGAAGAGCCGG + Intergenic
1058870849 9:109200282-109200304 CCAGCCAGCTGTGGAAAAGCCGG - Exonic
1059610264 9:115884659-115884681 CCTGATTTCTGTGGAGGAGCCGG - Intergenic
1060136569 9:121161279-121161301 CTTGCTTACTGTAGAAAAGCTGG - Intronic
1061310694 9:129760319-129760341 TCTTACAAATGTGGAAAAGCGGG + Intergenic
1187274454 X:17805748-17805770 CCTGACTACTCAGCCAAAGCAGG + Intronic
1191009082 X:55742505-55742527 CCTGACTACTATGGGGAAACTGG - Intronic
1193574713 X:83183788-83183810 CCTGACTACCACTGAAAAGCAGG - Intergenic
1194640376 X:96396698-96396720 ACTTAATACTGTGGACAAGCCGG - Intergenic
1195047626 X:101068308-101068330 CCTGAATACTCTGGAAATTCTGG - Intergenic
1197391949 X:125878217-125878239 CCTGTCTTGTGTGGATAAGCTGG + Intergenic
1198018155 X:132632526-132632548 CCTGACCACTGAGGGAAAACTGG - Intronic
1201058205 Y:10017053-10017075 CCTGACTAAAGTGGAAGGGCTGG + Intergenic