ID: 976922757

View in Genome Browser
Species Human (GRCh38)
Location 4:90458196-90458218
Sequence GGCCCTGCCCCCTTACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 9, 3: 34, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976922757_976922761 9 Left 976922757 4:90458196-90458218 CCAACTTGTAAGGGGGCAGGGCC 0: 1
1: 1
2: 9
3: 34
4: 127
Right 976922761 4:90458228-90458250 TCCTCCTTCCACCTGCTCCATGG 0: 1
1: 1
2: 11
3: 105
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976922757 Original CRISPR GGCCCTGCCCCCTTACAAGT TGG (reversed) Intronic
900233871 1:1577375-1577397 AGCCCTGCCCCCTTCCAAGTTGG + Intergenic
900267299 1:1764455-1764477 GGCCCAGCCCTCTCACATGTTGG - Intronic
900726573 1:4220206-4220228 GGCTCTGCCCCCTTTTTAGTAGG + Intergenic
904518063 1:31072292-31072314 GGACTTGCCCGCTTTCAAGTAGG - Intergenic
907985216 1:59523950-59523972 AGCCCTGTCCCCTACCAAGTTGG + Intronic
910259722 1:85283723-85283745 AGCCCTGCCCACTTCCAAGTTGG + Intergenic
911288807 1:96029331-96029353 AGCCCTGCCCCCTTCTGAGTTGG - Intergenic
912631431 1:111249685-111249707 GGCTCTGCCACCTTACGAGTTGG + Intergenic
914392890 1:147237542-147237564 GGCCCTGCCTCCTTCTGAGTTGG - Intronic
915563620 1:156701746-156701768 GGCTCAGCCCCCTTACAGGCTGG + Intronic
916966263 1:169945410-169945432 AGCCCTGCCCCCTGCCAAGTTGG - Intronic
917848929 1:179043415-179043437 AGCCCTGCCCTCTTCCAAGATGG - Intronic
919205844 1:194420867-194420889 AGCCCTGCTCACTTCCAAGTTGG - Intergenic
920223983 1:204424755-204424777 GGCCCTGGCCCTTCACAAGGAGG + Exonic
923462149 1:234216699-234216721 GGCCCTGCCCCTTTTCCAGTTGG + Intronic
1063458793 10:6202822-6202844 GTCCCAGCCCCCTTCCACGTGGG - Intronic
1067830431 10:49608703-49608725 TGCCCGGCCCCCTTAGCAGTAGG + Intergenic
1068919138 10:62464966-62464988 AGCCCTGCACCCTATCAAGTTGG + Intronic
1069912200 10:71766378-71766400 GGCCCTGCCTCCTTACCTGGTGG - Intronic
1070770872 10:79081664-79081686 GGCCCTGCCCCCTGCCACTTAGG + Intronic
1071052841 10:81472970-81472992 CGCCCTGCCCCCTTCCAAGTTGG + Intergenic
1071819550 10:89265328-89265350 AGCCCTGTCCCCTTCCGAGTTGG - Intronic
1072690268 10:97568135-97568157 GGCCCTGCCCACTTACCATGAGG - Exonic
1072908392 10:99476967-99476989 CGCCCAGCCCCCTTAAAAGGGGG - Intergenic
1075132206 10:119749263-119749285 AGCGCTGCCCCCTACCAAGTTGG - Intronic
1079984574 11:27187206-27187228 GGGCCTTTCTCCTTACAAGTAGG - Intergenic
1079996847 11:27304620-27304642 AGCCCTGCCTCCTTCCAAGTTGG + Intergenic
1081767508 11:45621714-45621736 AGCACCACCCCCTTACAAGTTGG - Intergenic
1082687825 11:56260917-56260939 AGCCCTGCCCCGTAACAAGTTGG - Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1086850014 11:91798432-91798454 GGGCCTGCACCCTACCAAGTTGG + Intergenic
1088288113 11:108207803-108207825 TGCCCTGTCCCCTTCCAAGTTGG - Intronic
1090041803 11:123298706-123298728 AGCCCTGCCTCCTTCCGAGTTGG + Intergenic
1092204496 12:6606986-6607008 GGCCCGGCCCCCTTCCCGGTGGG - Intronic
1092501305 12:9050741-9050763 GAACCTCCCCCCTTTCAAGTTGG + Intergenic
1094548920 12:31431257-31431279 CGCCCTAGCCCTTTACAAGTTGG + Intronic
1095603080 12:44037092-44037114 AGCCCCGCTCCCTTCCAAGTGGG + Intronic
1097078688 12:56413509-56413531 AGCCCCGCCCCCTTTCAAGTTGG - Intergenic
1099317359 12:81100906-81100928 GGCCATGCCTCATTTCAAGTGGG + Intronic
1100382187 12:94072338-94072360 GGTATTGCCCCCTTTCAAGTAGG + Intergenic
1101042474 12:100770838-100770860 GTCCCTGCCCCTTTATAAGAAGG - Intronic
1101287897 12:103334965-103334987 TGCTTTGCCCCCTTTCAAGTAGG + Intronic
1102038740 12:109787134-109787156 GCAGCTGCCCCCTTACACGTGGG - Intronic
1103446725 12:120999661-120999683 GTCCCTGCCCCCTTCCATGTTGG + Intronic
1107170856 13:37341144-37341166 AGCCCTGCCCCCTTCCAACTTGG + Intergenic
1108542570 13:51457204-51457226 AGCCCTGCCCGCTTCCAAGTTGG - Intergenic
1108844463 13:54660463-54660485 AGCCCCGCCCCCTTCCGAGTTGG - Intergenic
1109345755 13:61113350-61113372 GGCCCTGCCCCCTACTAAGTTGG + Intergenic
1109525126 13:63566004-63566026 AGCCTTGCCCCCTTCCGAGTTGG + Intergenic
1110329231 13:74251896-74251918 GACCCTGCCCGCTTGCAACTGGG - Intergenic
1111237651 13:85430799-85430821 AGCCCTGCCCCCTTACAAGTTGG + Intergenic
1112487572 13:99834036-99834058 AGCCCTGCCTCCTTGGAAGTGGG + Intronic
1112598655 13:100833270-100833292 GGCCCTGATCCCATACAACTGGG + Intergenic
1116617151 14:47154399-47154421 ATTCCTGCCCCCTTCCAAGTTGG + Intronic
1120109281 14:80534525-80534547 GGCCCTGCTCCCTTAACAGTGGG - Intronic
1122273829 14:100581019-100581041 GCCCCTGCCCTATTACCAGTGGG + Intronic
1125241443 15:37581967-37581989 AGCCCCGCCCGCTTCCAAGTTGG + Intergenic
1126394246 15:48195922-48195944 GGCTCTTCTCCCTTACTAGTTGG + Intronic
1128501801 15:68231768-68231790 GGCCCAGCCCCCTGCCAGGTTGG - Intronic
1129183424 15:73891492-73891514 AGCCCCGCCCCCTTCCAAGTTGG + Intergenic
1129649774 15:77476059-77476081 AGCCCAGCCCCCTTACTAGGCGG + Intronic
1130328265 15:82899144-82899166 GGCCCTGCCCTCTCACCAGAAGG + Intronic
1133221372 16:4320513-4320535 GGCCCTGACCCCTGAAATGTCGG + Intronic
1137588507 16:49679306-49679328 ATCTCTGCCCCCTTCCAAGTTGG + Intronic
1140103370 16:71938030-71938052 AGCCCTGCCCCCTTCTGAGTTGG + Intronic
1141063712 16:80897636-80897658 GGGCCTGCCCCATTTCGAGTGGG - Intergenic
1141631732 16:85291592-85291614 GGCCCAGCCTCCTTACCAGGCGG - Intergenic
1142571985 17:880723-880745 AGCCCTGCCCCCTTAGGAGAAGG - Intronic
1144389864 17:14783907-14783929 AGCCCTGCCCCCTACCGAGTTGG + Intergenic
1144969056 17:19095688-19095710 GGCCCTGCCAGCTTACCTGTTGG - Intronic
1144978860 17:19156378-19156400 GGCCCTGCCAGCTTACCTGTTGG + Intronic
1144989362 17:19221854-19221876 GGCCCTGCCAGCTTACCTGTTGG - Intronic
1146425160 17:32731706-32731728 AGCCCCGCCCCCTTCCAAGTTGG + Intronic
1146691804 17:34882040-34882062 GTCCCTGCCCCCTCCCAAGGTGG - Intergenic
1148050898 17:44769526-44769548 GACCCTGCTCCTTTACTAGTGGG - Intronic
1148120603 17:45208003-45208025 GGCTCTGCCACTTTATAAGTGGG + Intergenic
1150482159 17:65518869-65518891 TGCCCTGCCCCCTTACCTATTGG - Intergenic
1151766858 17:76137341-76137363 GGGCCTGGCCTCTTACAAGAAGG + Exonic
1152169924 17:78738810-78738832 TGACCTGCCCTCTTACAAGTTGG - Intronic
1155871959 18:31041484-31041506 GGCCCTCCACCCTGGCAAGTGGG - Intronic
1158774006 18:60555229-60555251 AGCCCAGCCCCCTAACAAGTTGG + Intergenic
1160763430 19:797043-797065 GGTCCTGCCCACTTGCAAGATGG + Intergenic
1161296760 19:3524012-3524034 GGCCCTGTCCCTTTACCAATGGG - Intronic
932303888 2:70687770-70687792 GGCACTGACCCCTAAGAAGTGGG + Intronic
932398390 2:71463459-71463481 AGCCCCGCCCCCTACCAAGTTGG - Intronic
940957064 2:159739205-159739227 AGCCCTGACCACTTCCAAGTTGG - Intronic
941998761 2:171626385-171626407 AGCCCTGCCCGCTTCCAAGTTGG + Intergenic
943858293 2:192827919-192827941 AGCCCCGCCACCTTCCAAGTTGG + Intergenic
944483700 2:200182006-200182028 GCCCCTTCCCCCTTCCAAGATGG + Intergenic
946032765 2:216717989-216718011 GGCCCTGCCCCCTCACCACCAGG - Intergenic
946084567 2:217157712-217157734 GGCCCTGCCTGCTTCCAAGTTGG + Intergenic
946616711 2:221517836-221517858 GGTCCTGACCACTTGCAAGTGGG + Intronic
948803499 2:240443268-240443290 GGCTCTGCCCCCTGACAAGTGGG - Intronic
1169309222 20:4521292-4521314 AGCCCTATCCCCTTCCAAGTTGG + Intergenic
1170546100 20:17436904-17436926 GGCCCCGGCCACTCACAAGTTGG + Intronic
1175812909 20:61868397-61868419 GCCCCTGCCCCATTAGAAGCTGG - Intronic
1175904160 20:62371635-62371657 GGCCCAGCCCCATGACAAGCAGG + Intergenic
1178937294 21:36874765-36874787 AGCCCTGCCCCCTACCAAGTCGG + Intronic
1179829532 21:43987947-43987969 GGCCTTGCCCTCTAACAAGAGGG + Intergenic
1180025752 21:45161215-45161237 AGCCCCACCCCCTTCCAAGTTGG + Intronic
1180869763 22:19139499-19139521 GGCCGTGCCCCCTTGCAGTTTGG - Intronic
957156370 3:76550539-76550561 AGCCCTGCCCCCTTCCAAGTTGG + Intronic
957614418 3:82509140-82509162 AGCCCTGCCCCTTTCCAAGTTGG + Intergenic
957787840 3:84904982-84905004 AGCCCCACCCTCTTACAAGTTGG + Intergenic
958498519 3:94875337-94875359 AGCCCTGCCCCCTTCTGAGTTGG - Intergenic
961525706 3:127496157-127496179 AGCCCTGCCTGCTTCCAAGTTGG + Intergenic
961832853 3:129633132-129633154 AGCCCTGCCCCGCCACAAGTGGG - Intergenic
962465136 3:135650518-135650540 GGCCCTGAGCCCTTAGAATTTGG + Intergenic
963250068 3:143095259-143095281 AGCCCTGCCCCCTTTCAAGTTGG + Intergenic
964927290 3:161974999-161975021 GGACCTGCCCCCTTCCAACCAGG + Intergenic
966620187 3:181954991-181955013 GGCCCTGCCCCATTTCAGGTGGG + Intergenic
968143083 3:196274278-196274300 AGCCCTGCCCGTTTCCAAGTTGG - Intronic
968838454 4:2982195-2982217 AGCCCTACCCCCTTCCAGGTTGG - Intronic
969604138 4:8193834-8193856 GGACCTGCCCCCATACCAGCAGG - Intronic
971867232 4:32189250-32189272 AGCCCTGCCCCCTACCGAGTTGG + Intergenic
971869508 4:32216692-32216714 AGCCCCACCCCCTTCCAAGTTGG - Intergenic
976922757 4:90458196-90458218 GGCCCTGCCCCCTTACAAGTTGG - Intronic
977099096 4:92786563-92786585 GACCCTTCCCCCTTGCAAATGGG + Intronic
978248689 4:106604808-106604830 AGCCCTGCCACCTTCCAAGTTGG - Intergenic
978347768 4:107789086-107789108 AGCCCTGCCCCCTACCAAGTTGG - Intergenic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
980472975 4:133273610-133273632 GGCCCTGCCCCATACCAAGAAGG - Intergenic
980480803 4:133385207-133385229 AGCCCCGCCCCCTTCCAAGGAGG + Intergenic
980582545 4:134773372-134773394 AGCCCTGCCCCCTTCCAAGTTGG + Intergenic
981939024 4:150262028-150262050 TGCCCTTCCTTCTTACAAGTAGG + Intergenic
982918984 4:161250233-161250255 AGCCCTGCTCACTTCCAAGTTGG - Intergenic
983125988 4:163950574-163950596 AGCCATGCCCCCTTCCAAGTGGG - Intronic
984375224 4:178921790-178921812 AGCCCTGACCCTTTCCAAGTTGG + Intergenic
985672782 5:1214797-1214819 GGCCCTGCCCCCTTGCACTGAGG - Intronic
987952059 5:24687796-24687818 AGCCCCACCCCCTTCCAAGTTGG - Intergenic
988205972 5:28135061-28135083 TCCCCTACCCCCTTAGAAGTAGG + Intergenic
988651254 5:33154044-33154066 CTCCCAGCCCCCTTACAAATGGG - Intergenic
989293913 5:39801402-39801424 GGCCCTGCCTAATTACAAGCAGG - Intergenic
991039784 5:62163074-62163096 ATCCCTGCCCCCTACCAAGTTGG - Intergenic
991638511 5:68730658-68730680 GGTCTTGCCCCCTTCCAATTTGG - Intergenic
992847399 5:80764954-80764976 GGCCCTGCCACCATACTTGTGGG + Intronic
994692490 5:103035167-103035189 AGCCCCGCCCCCTTCCAAGTTGG - Intergenic
995331949 5:110956431-110956453 AGCCCCACCCCCTTCCAAGTTGG + Intergenic
997887941 5:137648216-137648238 GGCACTGCCCCCTTCCACCTTGG - Intronic
999281985 5:150372131-150372153 GGCCCTGCCCCCAGCCAAGAGGG + Exonic
1003438865 6:6121602-6121624 GGCCCCACCCCCTACCAAGTTGG + Intergenic
1006387193 6:33737808-33737830 GGCCCAGCCCCCTCACCATTAGG - Intronic
1007214673 6:40227987-40228009 AGCCCTGCCCCCTTTCAAGTTGG + Intergenic
1007574440 6:42916045-42916067 GGTCCTGCCTCCTTCCGAGTGGG + Exonic
1009643220 6:66363289-66363311 AGTCCTGCCCCCTACCAAGTTGG - Intergenic
1010519590 6:76817485-76817507 AGCCCTGTCCCCTTGCAGGTTGG + Intergenic
1011284294 6:85706718-85706740 AGCCCTGCCCCCTAACAAGTTGG - Intergenic
1012100711 6:95083524-95083546 AGCCCTGCCCCCTACCAAGTTGG + Intergenic
1014969109 6:127792055-127792077 AGCCATGCCCCCTTCCAAGTTGG - Intronic
1016076882 6:139805644-139805666 AGCCTTGCCCCCTTCCAAGTTGG - Intergenic
1016648276 6:146434786-146434808 GACCCTTCCCCCTTACAGGGTGG - Exonic
1024024430 7:45399232-45399254 AGCCCCGCCTCCTTCCAAGTTGG + Intergenic
1024786349 7:52911637-52911659 TGCCCTGCCCGCTTCTAAGTTGG - Intergenic
1027575073 7:79921822-79921844 AGCCCTATCCCCTTCCAAGTTGG + Intergenic
1028402059 7:90434378-90434400 AGCCCTGCACCCTACCAAGTTGG - Intronic
1030484634 7:110149722-110149744 AGCTCTGCCCTCTTCCAAGTTGG - Intergenic
1031837150 7:126691491-126691513 AGCCCTGCCCCCTTCCAAGTTGG - Intronic
1039730289 8:40267869-40267891 CGCCCTGAGCCCTTGCAAGTGGG - Intergenic
1043702952 8:83313343-83313365 AGCCTTGCCCCCTTCCAAGTTGG - Intergenic
1045341021 8:101254571-101254593 GGCCCTGCCCCATACCTAGTAGG + Intergenic
1046140312 8:110083040-110083062 AGCCCCGCCCCCTTCCAAGTTGG + Intergenic
1048830782 8:138475228-138475250 CTCCCTGACCCCTTGCAAGTTGG + Intronic
1049222088 8:141432876-141432898 CCCCCTGCCCCCTAACAAGGTGG - Intergenic
1053444952 9:38145840-38145862 AGCCCTGCCCGCTTCCAAGTTGG + Intergenic
1186096728 X:6110395-6110417 AGCCCAGCCCCCTTGCAATTGGG - Intronic
1187446268 X:19363960-19363982 TGCTCTGCCCCATTACAAGCAGG - Intronic
1192267091 X:69546548-69546570 AGTCCTGCCCACTTCCAAGTTGG + Intergenic
1193490451 X:82142935-82142957 GGCCCGGCCACGATACAAGTTGG + Intergenic
1194212068 X:91082068-91082090 AGCCCTGCCCCCTTCTGAGTTGG + Intergenic
1197342091 X:125287079-125287101 AGCCCAGCCCCCTTCCAAGTTGG + Intergenic
1200424973 Y:3010009-3010031 AGCCCTGTCCCCTTCCAAGTTGG - Intergenic
1201593183 Y:15637651-15637673 GGACCTGCCCCTTTCCAACTAGG + Intergenic