ID: 976929804

View in Genome Browser
Species Human (GRCh38)
Location 4:90551972-90551994
Sequence CACCTTGATGTTGCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 1, 2: 18, 3: 52, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976929804 Original CRISPR CACCTTGATGTTGCATCCTC TGG Intronic
901158284 1:7155182-7155204 CACAGTGATGCTGCCTCCTCCGG - Intronic
903130164 1:21273955-21273977 CAGCTTCATGTTGCTGCCTCAGG - Intronic
903645429 1:24892922-24892944 CACCTTCATGGTCCAGCCTCAGG - Intergenic
904447104 1:30583092-30583114 CACATTGATTTTGTATCCTGAGG + Intergenic
904550344 1:31311606-31311628 CACCTTCCTGCTGCATCCTCTGG + Intronic
904725216 1:32541673-32541695 CACCGTGTTGCTGCATCCTCTGG + Intronic
906018280 1:42603204-42603226 CACTTTGTTGCTGCACCCTCTGG + Intronic
907108072 1:51901913-51901935 CACCTTGTTGCCGCAACCTCTGG - Intergenic
909875490 1:80797636-80797658 CACCTTGATGCTGCATCCTTTGG + Intergenic
910126176 1:83844991-83845013 CGCCTTGTTGTTGCATCCTTGGG - Intergenic
910232584 1:85001452-85001474 CACCTTGATCTTGGATTCTGTGG + Intronic
910751531 1:90636351-90636373 CACATTGATTTTGTATCCTGAGG - Intergenic
911467281 1:98271711-98271733 CACATTGATTTTGTATCCTGAGG + Intergenic
911763131 1:101639600-101639622 CGCCTTGATGCTACATCCTCTGG - Intergenic
912374523 1:109199487-109199509 CACTTTGATGCAGCTTCCTCGGG - Intronic
916382045 1:164222539-164222561 CACCTTGTGGCTGCATTCTCTGG - Intergenic
916636037 1:166669710-166669732 CACCCAGATTTTTCATCCTCTGG + Intergenic
916671412 1:167024671-167024693 CACGTTGTTGCTGCATCCTTTGG - Intergenic
917354438 1:174111535-174111557 TGCCTTGTTGCTGCATCCTCTGG - Intergenic
917354867 1:174116684-174116706 CACTTTGATTTTCCATCCTTTGG + Intergenic
918028204 1:180774938-180774960 CATCTTGTTGTTGTGTCCTCTGG + Intronic
919159118 1:193805738-193805760 GACCTTGTTGCTGTATCCTCTGG + Intergenic
919824753 1:201495525-201495547 CACCGTGATGCTGCACCCACTGG - Intronic
921493103 1:215803435-215803457 CACATTGATGTTGTATCCTGAGG - Intronic
921925611 1:220707968-220707990 CGCCTTGTTGCTGCGTCCTCTGG + Intergenic
922040535 1:221891890-221891912 CACCCTGATATTGCATTATCTGG - Intergenic
922129613 1:222764285-222764307 CACATTGATTTTGTATCCTGAGG - Intergenic
923889122 1:238191704-238191726 GGCCTTGTTGCTGCATCCTCGGG - Intergenic
924865337 1:247973430-247973452 CACATTGATTTTGTATCCTGAGG - Intronic
1064682085 10:17820274-17820296 CAGCTTGTTTTTGCATCCTAAGG - Intronic
1065460340 10:25956035-25956057 CACCTTGTTGCTACATGCTCTGG + Intronic
1066060080 10:31715528-31715550 CACATTGATTTTGAATCCTGAGG + Intergenic
1066699276 10:38109644-38109666 CACGTTGATTTTGTATCCTGAGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068622304 10:59199895-59199917 CACCTTGATTTTGTATCCTGAGG + Intronic
1069581531 10:69570034-69570056 CAGTTTGATGTTCCATCCTGTGG + Intergenic
1071455602 10:85849327-85849349 CCCCTTGATGTTGCATCCCTGGG - Intronic
1072058550 10:91786148-91786170 TGCCTTGTTGCTGCATCCTCTGG - Intergenic
1072329762 10:94336230-94336252 CATCTTGTTGCTGCATCTTCTGG - Intronic
1072387375 10:94944820-94944842 CACATTGATTTTGTATCCTGAGG - Intronic
1072774669 10:98178902-98178924 CACATTGATTTTGTATCCTGAGG + Intronic
1073869846 10:107850644-107850666 CACATTGATTTTGTATCCTGAGG - Intergenic
1075563863 10:123488942-123488964 CGCCTTGGTGCTGTATCCTCTGG - Intergenic
1076038148 10:127218894-127218916 CGCCTTGTTGCTTCATCCTCTGG + Intronic
1078587596 11:12607049-12607071 CACATTGATTTTGTATCCTGAGG - Intergenic
1079613153 11:22457884-22457906 CACTTTGTTGCTGCATCTTCTGG + Intergenic
1079938224 11:26643906-26643928 CACCTTGCTGCTGTATCCTCTGG - Intronic
1079982227 11:27163370-27163392 TGCCTTGTTGCTGCATCCTCTGG - Intergenic
1080191641 11:29557335-29557357 CACCTTGATATTTTATCATCAGG - Intergenic
1081539092 11:44017160-44017182 CACCTTGCTGTCCCTTCCTCTGG - Intergenic
1081696536 11:45113854-45113876 CACATTGATTTTGTATCCTGAGG + Intronic
1083062433 11:59888140-59888162 CACATTGATTTTGTATCCTGAGG + Intergenic
1083522421 11:63327149-63327171 CTCCTTGATGATGCATTTTCTGG + Intronic
1084306776 11:68290685-68290707 CGCCTTGCTGCTGCATCCTCTGG - Intergenic
1084398259 11:68929097-68929119 CAGCTTGATGGTGTCTCCTCTGG + Intronic
1086165275 11:83770424-83770446 GGCCTTGATGTTTCATCCTCTGG - Intronic
1086307185 11:85493977-85493999 TCCCTTGTTGCTGCATCCTCTGG + Intronic
1088922205 11:114268365-114268387 CCTCTTTATCTTGCATCCTCTGG + Intronic
1089486298 11:118848909-118848931 CACCTTCATGTCGCTACCTCAGG - Intergenic
1090755867 11:129791144-129791166 AACCTTGTTGCTGCATCCTTTGG - Intergenic
1091325033 11:134679672-134679694 CACCTTGGTCTTGCACCTTCAGG + Intergenic
1093420794 12:18972110-18972132 CAACTTGATTTTCCTTCCTCTGG - Intergenic
1094431637 12:30376101-30376123 CACATTGATTTTGTATCCTCAGG + Intergenic
1094635451 12:32222831-32222853 CACCTTGTTGCTGTGTCCTCCGG - Intronic
1094788613 12:33882037-33882059 CACATTGATTTTGTATCCTGAGG - Intergenic
1095669690 12:44844045-44844067 CACCTTGTTGCTGCAGCCTCTGG + Intronic
1097564719 12:61252910-61252932 CAGATTCATTTTGCATCCTCTGG + Intergenic
1097749344 12:63334863-63334885 CACATTGATTTTGTATCCTGAGG - Intergenic
1098182194 12:67859933-67859955 CACCTTGTCGCTGCATCCTATGG + Intergenic
1098414346 12:70215796-70215818 CATCTTATTGTTGCATCTTCTGG + Intergenic
1099556137 12:84110026-84110048 CACATTGATTTTGTATCCTCAGG - Intergenic
1101048571 12:100836870-100836892 CACCTGGATGGTTCATCCACAGG - Intronic
1101057591 12:100934930-100934952 CACATTGATTTTGTATCCTGAGG + Intronic
1104262905 12:127201066-127201088 CTCCTTGTTGTGGCATCCTGGGG + Intergenic
1105065456 12:133193509-133193531 CGCCTTGTTGCTGCATCCTCTGG + Exonic
1105518429 13:21110934-21110956 CACCTTGTGGCTGCATCTTCTGG - Intergenic
1105670157 13:22604437-22604459 CACCTTGATCTTGGACTCTCCGG + Intergenic
1107661236 13:42641949-42641971 CACGTTGATTTTGTATCCTGAGG + Intergenic
1108451346 13:50568604-50568626 CATCGTGATGGTGCATCCTCTGG + Intronic
1109358936 13:61270730-61270752 CACATTGATTTTGTATCCTGAGG - Intergenic
1110067647 13:71128963-71128985 CACATTGATTTTGTATCCTGAGG + Intergenic
1110560673 13:76908039-76908061 CATGTTGCTGTTGCAGCCTCTGG - Intergenic
1110792626 13:79602068-79602090 CACCCTGATGCTGCTTCCTCTGG - Intergenic
1113300585 13:109014802-109014824 CACATTGATTTTGTATCCTGAGG + Intronic
1114994144 14:28326590-28326612 CACTTTGATGTTTCATTCTATGG + Intergenic
1115194606 14:30782816-30782838 TATCTTGTTGCTGCATCCTCTGG + Intergenic
1116655998 14:47654600-47654622 CAACTTTATGTTCCATTCTCTGG - Intronic
1117087593 14:52217864-52217886 CACCTTGTTGCTACATCCTCCGG + Intergenic
1117190521 14:53285902-53285924 CACATTGATGCTTCATCCTCTGG + Intergenic
1120278447 14:82408726-82408748 TACCTTGTTGCTGCATTCTCTGG + Intergenic
1120440997 14:84539389-84539411 AACCTTGATGTTACCTACTCTGG - Intergenic
1120820401 14:88906945-88906967 TGCCTTGTTGTTGCATCCTCTGG + Intergenic
1121738973 14:96238201-96238223 CACCTTGAAAGTGGATCCTCTGG - Intronic
1123048272 14:105528690-105528712 CACCCTGATCTTGTCTCCTCCGG + Intronic
1124023009 15:25941057-25941079 CACCTTGATGTTGAATCTACAGG - Intergenic
1124889117 15:33715716-33715738 TACCATGTTGCTGCATCCTCTGG + Intronic
1125098359 15:35880534-35880556 CACATTGATTTTGTATCCTGAGG - Intergenic
1128341938 15:66828465-66828487 AAGCTTGAGGTTGCAACCTCAGG - Intergenic
1128874135 15:71188352-71188374 CACCTAGATGGAGCTTCCTCTGG + Intronic
1129578880 15:76784186-76784208 CACCTTGATTTTATATCCTGAGG - Intronic
1129592244 15:76927073-76927095 CACCTTGTTGCTGCACCCTCCGG - Intergenic
1129612708 15:77073157-77073179 CACCTGGAGTCTGCATCCTCAGG - Intronic
1130785784 15:87094456-87094478 CACCTTGTTGCTACATCCTCTGG - Intergenic
1131597400 15:93812507-93812529 CACCTTGTCGCTGTATCCTCTGG - Intergenic
1131597409 15:93812579-93812601 CACCTTGATCTTGGACTCTCCGG + Intergenic
1132181044 15:99753115-99753137 CACCTTGATCTTGGACTCTCAGG - Intergenic
1132188765 15:99829791-99829813 CACATTGATTTTGTATCCTAAGG + Intergenic
1133505758 16:6410663-6410685 CACACTGATGTTGCTGCCTCTGG + Intronic
1134565364 16:15247169-15247191 TACCTGGATGTTGCATCCGTAGG - Intergenic
1134737132 16:16509529-16509551 TACCTGGATGTTGCATCCGTAGG + Intergenic
1134930388 16:18202635-18202657 TACCTGGATGTTGCATCCGTAGG - Intergenic
1135290942 16:21237536-21237558 TGCCTTGTTGTTGCATCCTATGG + Intronic
1135670150 16:24368422-24368444 GCCCTTAATGCTGCATCCTCTGG - Intergenic
1135897702 16:26423539-26423561 CACATTGATTTTGTATCCTGAGG - Intergenic
1137461080 16:48664175-48664197 CACATTGATTTTGTATCCTGAGG + Intergenic
1137747131 16:50830805-50830827 CACCTTGACCCAGCATCCTCAGG + Intergenic
1138260754 16:55619732-55619754 CTCATTGATTTTGTATCCTCAGG - Intergenic
1138720772 16:59076542-59076564 CACATTGATTTTGTATCCTGAGG - Intergenic
1138722722 16:59100687-59100709 CACATTGATTTTGTATCCTGAGG - Intergenic
1139260148 16:65584125-65584147 CACCTTGTTGCTACATCTTCTGG + Intergenic
1139345977 16:66304184-66304206 TAGCTTGGTGTGGCATCCTCTGG - Intergenic
1140301412 16:73761136-73761158 CACATTGATTTTGTATCCTGAGG - Intergenic
1140690290 16:77477357-77477379 CACTTTTATGATGTATCCTCTGG + Intergenic
1148919629 17:51019138-51019160 TGCCTTGTTGCTGCATCCTCTGG - Intronic
1150162484 17:62910429-62910451 TGCCTTGTTGCTGCATCCTCTGG + Intergenic
1151168006 17:72221149-72221171 CATCCTCATGGTGCATCCTCAGG - Intergenic
1153094715 18:1387566-1387588 CACATTGATTTTGTATCCTGAGG - Intergenic
1155084983 18:22449477-22449499 CACATTGATTTTGTATCCTGAGG - Intergenic
1155503826 18:26513552-26513574 CTCTATGTTGTTGCATCCTCGGG - Intronic
1157178441 18:45473717-45473739 CACATTGATTTTGTATCCTGAGG + Intronic
1157660574 18:49438652-49438674 CACCCTGTTGTTGCTTCCTGTGG - Intronic
1158795676 18:60843328-60843350 CACATTGATTTTGTATCCTGAGG - Intergenic
1159063375 18:63540677-63540699 CACCTTGATATTCTATGCTCAGG + Intergenic
1160296379 18:77641413-77641435 CACATTGATTTTGTATCCTGAGG - Intergenic
1164916291 19:32054870-32054892 TGCCTTGCTGCTGCATCCTCTGG + Intergenic
925249846 2:2422732-2422754 CACCTTGATGCTGCTTCCGGGGG + Intergenic
925427348 2:3761581-3761603 AACCTGGCTGTTGCATCCTCAGG - Intronic
926115304 2:10209419-10209441 CACCTCCATGTTGCTTCCTGTGG + Intronic
926564659 2:14456004-14456026 CACCCTAATGGTGAATCCTCTGG - Intergenic
926970241 2:18460046-18460068 CACATTGATTTTGTATCCTGAGG + Intergenic
927952789 2:27184607-27184629 CACCTTGATCTTCAATCCTAAGG + Intergenic
928850404 2:35738554-35738576 CACATTGATCTTGTATCCTGAGG - Intergenic
929080003 2:38113025-38113047 CACATTGATTTTGTATCCTGAGG + Intergenic
929369459 2:41204705-41204727 CTCCTTGATGTGGCATCGTTTGG - Intergenic
930105669 2:47637410-47637432 CACCTTGAACTTGCTTCCTGTGG + Intergenic
930867775 2:56138975-56138997 CACATTGATTTTGTATCCTGAGG + Intergenic
931002833 2:57808040-57808062 CATCTTGTTGCTGCATCCTCTGG - Intergenic
931142396 2:59477326-59477348 CACATTGATTTTGTATCCTGAGG + Intergenic
931478745 2:62618246-62618268 CACATTGATTTTGTATCCTGAGG + Intergenic
931568268 2:63639942-63639964 CACCCTGAAGTTGCATTCTTGGG + Intronic
932002102 2:67894359-67894381 AACCTTGAGGTTGCAACCTTAGG - Intergenic
932516782 2:72359391-72359413 CAACTTATTGCTGCATCCTCTGG - Intronic
932649157 2:73536976-73536998 CAGCTCCATTTTGCATCCTCTGG - Intronic
933842771 2:86300858-86300880 CATCTTGAACTTGCATCCACTGG + Intronic
936916054 2:117640090-117640112 CTCCTTGATTCTGCTTCCTCAGG + Intergenic
937401044 2:121583996-121584018 TACCTTGTTGCTGCATCCTCTGG - Intronic
938706276 2:133930442-133930464 CACCATGTTGCTGCATCTTCTGG + Intergenic
938912878 2:135901511-135901533 TGCCTTGTTGCTGCATCCTCTGG - Intergenic
939288487 2:140163708-140163730 CACCTTATTGCTGCATCCTCTGG + Intergenic
939489958 2:142865516-142865538 TGCCTTATTGTTGCATCCTCTGG + Intergenic
939994939 2:148911341-148911363 CCCCTGGATGCTGCATTCTCTGG - Intronic
940049887 2:149451183-149451205 CACCTTGCTGCTGCATCCTCTGG + Intronic
940545024 2:155072133-155072155 CACCTTGTTGTTGTGTCCTCTGG - Intergenic
941197220 2:162467889-162467911 CACCTTCTTGTTGCATCCTCAGG + Intronic
941733624 2:168947790-168947812 CACCTAGATGCTGCCTACTCTGG + Intronic
941957381 2:171218659-171218681 CACCTTGTTGCTGCATCCTCTGG + Intronic
942870725 2:180731419-180731441 CACCTTGTTGTTGCATTCTCTGG - Intergenic
943431699 2:187810662-187810684 CACCTAGATATTGGATCCTTGGG + Intergenic
943898988 2:193407731-193407753 CACATTGATTTTGTATCCTGAGG - Intergenic
944495429 2:200303013-200303035 CACCTTGATGTTGCAGCACTAGG + Intergenic
945349460 2:208760239-208760261 CACATTGATTTTGTATCCTGAGG + Intronic
945349849 2:208764420-208764442 CACATTGATTTTGTATCCTGAGG - Intronic
947995610 2:234524709-234524731 CACCTTGCTGCTGCATCCTCTGG - Intergenic
1173169756 20:40714373-40714395 CACCCTGATGGGCCATCCTCGGG + Intergenic
1177208946 21:18045855-18045877 CACCTTGTTACTGCATCCGCTGG - Intronic
1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG + Intergenic
1180518077 22:16167298-16167320 CACATTGATTTTGTATCCTGAGG - Intergenic
1181954069 22:26575464-26575486 CTCCTTCCTGCTGCATCCTCCGG + Intronic
1183764810 22:39863005-39863027 CGCCTTGATGCTGCATCCTCTGG - Intronic
1184435530 22:44472460-44472482 CACCTTGATCTTGGACCTTCTGG + Intergenic
949114508 3:303571-303593 CACGTTGATTTTGTATCCTGAGG + Intronic
949904230 3:8845011-8845033 CGTCTTTTTGTTGCATCCTCTGG - Intronic
950963905 3:17132794-17132816 CACTTTGTTGCTGCATCCTCAGG - Intergenic
951024419 3:17814745-17814767 CACCTTGCTGCTGCATCCACTGG + Intronic
951048468 3:18067507-18067529 CATCTCGTTGCTGCATCCTCTGG - Intronic
951161714 3:19430823-19430845 CACATTGATTTTGTATCCTGAGG + Intronic
951636468 3:24783989-24784011 TGCCTTGATGTTGCATCCTCTGG + Intergenic
952574891 3:34762789-34762811 CACATTGATTTTGTATCCTTAGG - Intergenic
952725172 3:36575872-36575894 TGCCTTGTTGTTACATCCTCTGG - Intergenic
954345382 3:49993218-49993240 CATCTTGATGATGGTTCCTCAGG - Intronic
954619067 3:51985524-51985546 CAACTTGAGGTTGAATCCTGGGG - Intronic
958745242 3:98126366-98126388 ATCCTTCTTGTTGCATCCTCTGG + Intergenic
958832488 3:99106508-99106530 AACCTTGTTGATGCATCCTCTGG + Intergenic
959154782 3:102653536-102653558 TGCCTTGTTGTTGCATCCTCTGG - Intergenic
959236324 3:103727060-103727082 CACCTTGTTGCTGCATGCTCTGG - Intergenic
959264139 3:104116466-104116488 CACATTGATTTTGTATCCTGAGG - Intergenic
959292265 3:104489269-104489291 CACATTGATTTTGTATCCTGAGG - Intergenic
959351648 3:105272383-105272405 CACCTCGTTGCTGCATCCTCCGG - Intergenic
963006763 3:140733689-140733711 CACCTTGTTGCTGCATATTCTGG + Intergenic
963287884 3:143453997-143454019 CACCTTTATGCTGCCTTCTCTGG - Intronic
963415265 3:144987035-144987057 CACATTGATTATGCAACCTCAGG + Intergenic
964245547 3:154648529-154648551 CACATTGATTTTGCATCCTGAGG - Intergenic
965161242 3:165136225-165136247 CACATTGATTTTGTATCCTGAGG + Intergenic
967102886 3:186230709-186230731 CCCCAAGATGTTCCATCCTCAGG - Intronic
967853522 3:194099621-194099643 CTCACTGATGTTACATCCTCTGG - Intergenic
970043567 4:11823773-11823795 CATCTTATTGTTGCGTCCTCTGG - Intergenic
970510877 4:16780563-16780585 AACCTTAATGTTACCTCCTCTGG - Intronic
970685630 4:18563696-18563718 CACATTGATTTTGTATCCTGAGG - Intergenic
970871636 4:20822965-20822987 TACCTTGTTGCTGCATCCTCCGG - Intronic
971996532 4:33972594-33972616 CATCTTGTTACTGCATCCTCCGG - Intergenic
972120862 4:35700598-35700620 CACCTTCTTGCTGCCTCCTCAGG + Intergenic
974687440 4:65248112-65248134 TACCTTGTTGATGTATCCTCTGG - Intergenic
975241575 4:72066155-72066177 CACCTTGTTGCTGCATCCTCTGG + Intronic
975241835 4:72068297-72068319 CACCTTGTTGCTGCATCCTCTGG + Intronic
976425722 4:84901036-84901058 TGCCTTGTTGCTGCATCCTCTGG + Intronic
976680162 4:87746777-87746799 CACCTAGATATTTCATCCCCAGG + Intergenic
976929804 4:90551972-90551994 CACCTTGATGTTGCATCCTCTGG + Intronic
976991946 4:91378589-91378611 CACATTGATTTTGTATCCTGAGG + Intronic
977467335 4:97399142-97399164 CACATTGATTTTGTATCCTGAGG + Intronic
979288283 4:118951279-118951301 TGCCTTGTTGCTGCATCCTCTGG + Intronic
979490018 4:121315257-121315279 GACCTTTATGTTGCCTACTCTGG - Intergenic
979501382 4:121444394-121444416 CACATTGATTTTGTATCCTGAGG - Intergenic
980803926 4:137787946-137787968 CACATTGATTTTGTATCCTGAGG - Intergenic
981306041 4:143247914-143247936 CACCTTGTTGTTGCACCCTTGGG + Intergenic
983030783 4:162799192-162799214 CACATTGATTTTGTATCCTGAGG + Intergenic
984135486 4:175932371-175932393 CGCCTTGATGCTCCATCGTCTGG - Intronic
985254728 4:188058437-188058459 CACCTTGATGCTGTACCCTCTGG + Intergenic
986710774 5:10486602-10486624 CACCTTGATGTCACTGCCTCTGG + Intergenic
986906673 5:12502989-12503011 GACCTTGTTGCTGCATCTTCTGG + Intergenic
986958244 5:13182064-13182086 CACCTTGTCGCTGCATCCTCTGG - Intergenic
987128323 5:14836420-14836442 CACATTGATTTTGTATCCTGAGG - Intronic
987256875 5:16163976-16163998 GACTTTGTTGCTGCATCCTCTGG - Intronic
987687982 5:21229573-21229595 CACATTGATTTTGTATCCTGAGG - Intergenic
988174047 5:27697141-27697163 CGCCTTGTTGCTGCATCTTCTGG - Intergenic
989131462 5:38111360-38111382 CACCCTGATCCTGCATTCTCAGG + Intergenic
989954256 5:50338262-50338284 CACCTTGTTGCTGCATCCTCTGG + Intergenic
990294467 5:54386604-54386626 CAGCTTGTTGCTGCATCCTCTGG - Intergenic
990430291 5:55728195-55728217 CACCTTGTTGCTGCATTCTCTGG - Intronic
991663133 5:68970294-68970316 CTCCCTGATGGTGCATCCTCAGG + Intergenic
991923546 5:71681417-71681439 CAGCCAGTTGTTGCATCCTCTGG - Intergenic
992476286 5:77104544-77104566 CACCTTTTTGCTGCATCCTCTGG - Intergenic
992942677 5:81777953-81777975 CACCTTGAGGTAGAGTCCTCTGG - Intergenic
993091573 5:83433158-83433180 CACCTTGTTGCTACATCCACTGG + Intergenic
993708558 5:91198932-91198954 CACATTGATTTTGAATCCTGGGG - Intergenic
994926604 5:106123906-106123928 CACCTTGAAGCTGCATCCTTAGG + Intergenic
995257934 5:110068798-110068820 CACATTGATTTTGTATCCTGAGG + Intergenic
995380355 5:111524763-111524785 CACTTTGATGCTGCATCCTCTGG - Intergenic
996649382 5:125855150-125855172 CACATTGATTTTGTATCCTGAGG + Intergenic
996878770 5:128269532-128269554 CACATTGATTTTGTATCCTGAGG - Intronic
997088952 5:130833797-130833819 CACATTGATTTTGTATCCTGAGG + Intergenic
998398382 5:141834542-141834564 CACCTGGCTTTTGCATCCTAGGG - Intergenic
998971312 5:147595436-147595458 CGCCTTGTTGTTGCATCCCCTGG - Intronic
999441027 5:151600955-151600977 CAGCTTGTTGTTGCATCCTCCGG - Intergenic
999602971 5:153287233-153287255 CACATTGATTTTGTATCCTGAGG - Intergenic
1000156656 5:158558950-158558972 CTCCTTGATGCTCCATTCTCTGG - Intergenic
1001276587 5:170355689-170355711 CACTCTGATGTTGCTCCCTCTGG - Intronic
1001437264 5:171709733-171709755 CACCTTGCTGCTGCGCCCTCTGG - Intergenic
1001534812 5:172490982-172491004 CACCTCTCTGTTGCCTCCTCAGG + Intergenic
1003058614 6:2844397-2844419 CACCTTGTTGCTGCATCCAAGGG + Intergenic
1004352851 6:14905424-14905446 CAGCTTGTTGCTGCAACCTCTGG - Intergenic
1006330484 6:33386792-33386814 AGCCTTGTTGTTGCATCCTCCGG - Intergenic
1007281566 6:40716106-40716128 CACCTTGAAGTTTAATCCCCTGG + Intergenic
1007575502 6:42923113-42923135 GTCCTTGATGTTGCACCCCCTGG + Exonic
1008998241 6:57683783-57683805 CACATTGATTTTGTATCCTGAGG - Intergenic
1009599177 6:65775946-65775968 CACATTGATTTTGTATCCTGAGG - Intergenic
1009664095 6:66653689-66653711 CACATTGATTTTGTATCCTGAGG + Intergenic
1009706783 6:67262447-67262469 CACATTGATTTTGTATCCTAAGG + Intergenic
1010623932 6:78112755-78112777 CACATTGATTTTGTATCCTGAGG - Intergenic
1011858539 6:91725823-91725845 CACATTGATTTTGTATCCTAAGG + Intergenic
1013669640 6:112385936-112385958 CACATTGATTTTGTATCCTGAGG - Intergenic
1014317842 6:119889706-119889728 TACCCTGTTGTTGCATGCTCTGG - Intergenic
1014318078 6:119891864-119891886 CACCTTATTGCTACATCCTCTGG - Intergenic
1014584977 6:123186769-123186791 CACATTGATTTTGTATCCTGAGG - Intergenic
1014754037 6:125283468-125283490 CACATTGATTTTGTATCCTGAGG - Intronic
1014883550 6:126751717-126751739 CACATTGATTTTGTATCCTGAGG - Intergenic
1016568157 6:145481553-145481575 CACCTTGATAATGGATCATCTGG + Intergenic
1017885641 6:158597423-158597445 TACCTTGTTGCTGTATCCTCTGG + Intronic
1020211760 7:6163342-6163364 CACCTTGAATCTGCACCCTCTGG - Exonic
1021350801 7:19591858-19591880 CACATTGATTTTGTATCCTGAGG + Intergenic
1022220270 7:28307401-28307423 CACCTTGTTGCTGTGTCCTCTGG - Intronic
1022421709 7:30229746-30229768 TCCCTTGTTGCTGCATCCTCTGG + Intergenic
1023141459 7:37106426-37106448 TACCTTGGCGCTGCATCCTCTGG - Intronic
1027335776 7:77148631-77148653 CACATTGATTTTGTATCCTGAGG - Intronic
1027835742 7:83239104-83239126 GACTTTGTTGTTGGATCCTCAGG - Intergenic
1028332876 7:89618547-89618569 CACCCTGAAGTCGCAGCCTCAGG + Intergenic
1028521298 7:91734064-91734086 CACATTGATTTTGTATCCTGAGG - Intronic
1029780014 7:102722461-102722483 CACATTGATTTTGTATCCTGAGG + Intergenic
1029932889 7:104392024-104392046 CACATTGATTTTGTATCCTGAGG + Intronic
1030817167 7:114052521-114052543 CATCTTGATGCTGCATCCTCTGG - Intronic
1031634860 7:124090432-124090454 TACCTTGTTGCTGCATCTTCTGG - Intergenic
1031949692 7:127879478-127879500 CACCCTGTTGTTGAATCCTGTGG + Intronic
1033612633 7:142980079-142980101 CACATTGATTTTGCATCCTGAGG + Intergenic
1036026977 8:4919880-4919902 TACCTTGTTGCTGCACCCTCTGG - Intronic
1039647606 8:39304744-39304766 CACCTTGTTGCTCCATCTTCTGG + Intergenic
1039745897 8:40426337-40426359 CACCTTCTTGCTGTATCCTCAGG - Intergenic
1040394007 8:46977073-46977095 AACCTGGATGTTTCATCATCAGG + Intergenic
1040763315 8:50876177-50876199 CACATTGATTTTGTATCCTGAGG - Intergenic
1041016659 8:53598295-53598317 CTACTTGTTGCTGCATCCTCTGG + Intergenic
1041129588 8:54683642-54683664 CACATTGATTTTGTATCCTGGGG + Intergenic
1041485768 8:58374324-58374346 CACATTGATTTTGTATCCTGAGG - Intergenic
1041553456 8:59125863-59125885 CACCTTGATCTTGGATTTTCAGG + Intergenic
1043194644 8:77276545-77276567 CACATTGATTTTGTATCCTGAGG + Intergenic
1043962403 8:86432466-86432488 CACCTTTGTGTTGCATTATCAGG + Intronic
1044102634 8:88159501-88159523 CACATTGATTTTGTATCCTGAGG + Intronic
1044272225 8:90259637-90259659 CACATTGATTTTGTATCCTGAGG - Intergenic
1046022399 8:108680818-108680840 CACTTTGATTTTGTATCCTGAGG - Intronic
1046262556 8:111788045-111788067 TGCCTTGTTGCTGCATCCTCTGG + Intergenic
1046912037 8:119639030-119639052 CACTTTCATGTGGTATCCTCTGG + Intronic
1047564677 8:126031004-126031026 CTCCTTGATGTGGAATCCTTGGG - Intergenic
1047610741 8:126518439-126518461 CTCCATGATGTTCCACCCTCTGG - Intergenic
1048596692 8:135874144-135874166 CACCTTGATCTAGCATCTTCAGG + Intergenic
1048615182 8:136066578-136066600 TCCCATGATGTTACATCCTCTGG + Intergenic
1050240586 9:3630404-3630426 CATCTTGTTGCTACATCCTCTGG - Intergenic
1051674138 9:19542281-19542303 CACATTGATATTGTATCCTGAGG + Intronic
1051922875 9:22288272-22288294 CACCTTGATGCTGCATCCTCTGG + Intergenic
1052027788 9:23593138-23593160 CGCCTTGATGCAGCATCCTCTGG - Intergenic
1055616563 9:78079248-78079270 CACATTGATTTTGTATCCTGAGG - Intergenic
1058468743 9:105255691-105255713 CACAATGATGTTCAATCCTCTGG - Intronic
1058788813 9:108419962-108419984 CACCTTGATCGTACAACCTCTGG - Intergenic
1058848587 9:108987867-108987889 CACATTGATTTTGTATCCTGAGG + Intronic
1059060052 9:111026366-111026388 CACATTGATTTTGTATCCTGAGG + Intronic
1059686035 9:116636999-116637021 CACCTTGGTGCTGCATACTTGGG - Intronic
1059862756 9:118483280-118483302 TACGTTGTTGCTGCATCCTCCGG - Intergenic
1060006399 9:120003851-120003873 TATCTTGTTGCTGCATCCTCTGG - Intergenic
1061657873 9:132106741-132106763 CACCTTATTGTTGCATCCTCCGG + Intergenic
1062500634 9:136850541-136850563 AACCTTGATGGTGGATCCTGGGG - Intronic
1203442136 Un_GL000219v1:19362-19384 CACATTGATTTTGTATCCTGAGG + Intergenic
1203512944 Un_KI270741v1:138271-138293 CACATTGATTTTGTATCCTGAGG + Intergenic
1185642137 X:1594205-1594227 CACCTTGATGTTGCAGGCCACGG - Exonic
1186908390 X:14135583-14135605 CACATTGATGCTTCATCATCAGG - Intergenic
1188249900 X:27879976-27879998 CTCCTTGTTGCTGCATCCTCTGG + Intergenic
1188677690 X:32963352-32963374 CACGTTGAGGTTGCATACTAAGG + Intronic
1189199654 X:39182205-39182227 CACATTGATTTTGTATCCTGAGG + Intergenic
1189380098 X:40496502-40496524 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1190441499 X:50479439-50479461 CAATGTGATGTTGCATCCTAAGG - Intergenic
1191196313 X:57727316-57727338 CACATTGATTTTGTATCCTGAGG + Intergenic
1192003079 X:67177253-67177275 CACATTGATTTTGAATCCTGAGG - Intergenic
1192575679 X:72241395-72241417 TGCCTTGTTGCTGCATCCTCTGG - Intronic
1192940227 X:75903983-75904005 AAGCTCTATGTTGCATCCTCAGG - Intergenic
1193001151 X:76563845-76563867 CACATTGATTTTGTATCCTGAGG - Intergenic
1193171757 X:78345434-78345456 CACCTTGATTTTGTATCCTGAGG - Intergenic
1193384997 X:80859192-80859214 CACATTGATTTTGTATCCTGAGG - Intergenic
1193406624 X:81108718-81108740 CAACAGGAGGTTGCATCCTCTGG + Intergenic
1194262076 X:91708458-91708480 GTCCTTATTGTTGCATCCTCTGG + Intergenic
1194539565 X:95154383-95154405 CATATTGTTGCTGCATCCTCTGG + Intergenic
1194782743 X:98045206-98045228 CACATTGATTTTGTATCCTGAGG + Intergenic
1195531967 X:105967974-105967996 CACCTTGATGTTGAACTTTCTGG - Intergenic
1195854334 X:109313969-109313991 CACCTTATTGCTGCATCTTCTGG + Intergenic
1197705570 X:129632209-129632231 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1198194316 X:134344686-134344708 TGCCTTGTTGTTGCATCCTCTGG - Intergenic
1198315277 X:135459813-135459835 CACCTTGTTGGTGCATCTTCTGG - Intergenic
1198891791 X:141404591-141404613 CACCTTGATAGTGTGTCCTCAGG + Intergenic
1199026990 X:142951352-142951374 CACATTGATTTTGTATCCTAAGG + Intergenic
1199286740 X:146062477-146062499 CACCTTATTGCTGCATCCACTGG - Intergenic
1199346329 X:146745630-146745652 CACCTTGATCTTGTATGTTCTGG - Intergenic
1199920387 X:152396377-152396399 CACTTTGTTGTGGCATCCTTGGG + Intronic
1200344151 X:155431823-155431845 CACATTGATTTTGTATCCTGAGG - Intergenic
1200580723 Y:4947245-4947267 GTCCTTATTGTTGCATCCTCTGG + Intergenic
1201563139 Y:15339057-15339079 CACATTGATTTTGTATCCTGAGG + Intergenic
1201753200 Y:17457116-17457138 CACATTGATTTTGAATCCTGAGG - Intergenic
1201790043 Y:17829525-17829547 CACATTGATTTTGAATCCTGAGG - Intergenic
1201811511 Y:18076464-18076486 CACATTGATTTTGAATCCTGAGG + Intergenic
1201848353 Y:18448867-18448889 CACATTGATTTTGAATCCTGAGG + Intergenic
1201961417 Y:19684699-19684721 CACATTGATTTTGTATCCTGAGG + Intergenic
1202335375 Y:23803484-23803506 CACATTGATTTTGAATCCTGAGG - Intergenic
1202351686 Y:23999275-23999297 CACATTGATTTTGAATCCTGAGG - Intergenic
1202519093 Y:25670844-25670866 CACATTGATTTTGAATCCTGAGG + Intergenic
1202535392 Y:25866575-25866597 CACATTGATTTTGAATCCTGAGG + Intergenic