ID: 976929811

View in Genome Browser
Species Human (GRCh38)
Location 4:90552007-90552029
Sequence CTGTGTCCCCACATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2394
Summary {0: 1, 1: 2, 2: 87, 3: 586, 4: 1718}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976929809_976929811 -4 Left 976929809 4:90551988-90552010 CCTCTGGAGGGAAGGAAATCTGT 0: 1
1: 1
2: 9
3: 83
4: 377
Right 976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG 0: 1
1: 2
2: 87
3: 586
4: 1718
976929805_976929811 10 Left 976929805 4:90551974-90551996 CCTTGATGTTGCATCCTCTGGAG 0: 2
1: 4
2: 46
3: 95
4: 308
Right 976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG 0: 1
1: 2
2: 87
3: 586
4: 1718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976929811 Original CRISPR CTGTGTCCCCACATGGAGAA AGG Intronic
Too many off-targets to display for this crispr