ID: 976930555

View in Genome Browser
Species Human (GRCh38)
Location 4:90561889-90561911
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976930553_976930555 -1 Left 976930553 4:90561867-90561889 CCATACATAGGAAGGGATTTGAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 976930555 4:90561889-90561911 CTGTAAAGATAAATTTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr