ID: 976932248

View in Genome Browser
Species Human (GRCh38)
Location 4:90582035-90582057
Sequence CCCATTTCTGCATTTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976932248 Original CRISPR CCCATTTCTGCATTTCTTGG TGG Intronic
901896176 1:12314342-12314364 CCCTTCTCTGCCTTTCTTTGTGG + Intronic
904388505 1:30163384-30163406 CCCATAGGAGCATTTCTTGGAGG - Intergenic
904491791 1:30865026-30865048 GCCAGCTCTGCATTTCCTGGGGG + Intergenic
904711426 1:32433265-32433287 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
905499565 1:38426039-38426061 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
905727591 1:40266932-40266954 CTCATTTTTGTATTTCTTGTAGG + Intronic
906257090 1:44358635-44358657 CACCTTGCTGCATTTCCTGGTGG - Intergenic
908510808 1:64848764-64848786 CCCTTTTCTGCATTTCCAGGGGG - Intronic
908840364 1:68274207-68274229 CCCATTACTGTATTTCCTGTGGG + Intergenic
910049157 1:82956242-82956264 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
911513861 1:98843074-98843096 CCCATTTCTGGATTCCTTCTAGG - Intergenic
915258546 1:154656322-154656344 CCCCTTTGAGCATTTCTTGTAGG + Intergenic
916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG + Exonic
916332842 1:163637573-163637595 CACAGTTCTGCATGGCTTGGGGG - Intergenic
917067783 1:171115477-171115499 CCCATTTCTACACTTCTTATAGG - Intronic
917280483 1:173374345-173374367 CCCATCTATGGATTTCTTGTGGG + Intergenic
918567917 1:185953167-185953189 CCCTTCTCTGCTTTTCTGGGGGG - Intronic
918667538 1:187171061-187171083 CTCATTTGAGCATTTCTTGTAGG + Intergenic
919252711 1:195079026-195079048 CCCATTTATTCATTTCTTAAAGG - Intergenic
919300300 1:195753987-195754009 CCTACTTCTGAATTTCTTGAGGG + Intergenic
919651628 1:200155141-200155163 CCCACTTCTGCATTGGTTGGTGG - Intronic
919821757 1:201477467-201477489 CCATTTTCTGCATTTGTGGGTGG + Intergenic
921509052 1:216008936-216008958 CCCTTCTCTGCCTTTCTGGGGGG + Intronic
921673418 1:217951236-217951258 CCTGTTTCTGCCTTTTTTGGAGG - Intergenic
922934597 1:229413317-229413339 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
923387731 1:233482181-233482203 CCCAATTCTTCACTCCTTGGTGG + Intergenic
1063454835 10:6175693-6175715 CCCAGTTCTACATTTGGTGGTGG + Intronic
1064893918 10:20211951-20211973 CCCATGTCTGCATCTATTAGGGG - Intronic
1065328540 10:24570809-24570831 TCCATTTCTGCCTTTCCTGCCGG - Intergenic
1065977088 10:30851500-30851522 CCCTTTTCTGAAATTTTTGGAGG + Intronic
1066277591 10:33884285-33884307 ACCATCTCTGCCTTTCTTTGAGG - Intergenic
1067163153 10:43843888-43843910 CCAAATTCTGCTGTTCTTGGAGG + Intergenic
1068436519 10:56999132-56999154 CTCCTTTTTGCATTTCTTGTAGG - Intergenic
1068540210 10:58284168-58284190 CTAATTTCTGCATTTTTTTGTGG - Intronic
1069294143 10:66823111-66823133 CACAGTTCTGCATTAGTTGGAGG - Intronic
1071420424 10:85491815-85491837 CCCATTTCAGAGTTTCCTGGAGG + Intergenic
1071884602 10:89936197-89936219 CATATTTCCGTATTTCTTGGAGG + Intergenic
1072011440 10:91306060-91306082 CCCTTTCCTGCTTTTCTGGGGGG - Intergenic
1072678522 10:97487787-97487809 CCCTTTTCTGCATTGATTTGTGG - Intronic
1074061287 10:109968135-109968157 CCCATTTTGACATGTCTTGGTGG - Intergenic
1074145558 10:110714271-110714293 ACCATATCTGCAGTTCTTGGAGG + Intronic
1075784811 10:125041952-125041974 CCCATGTCTGGCTTTTTTGGGGG + Intronic
1075919401 10:126197937-126197959 CCCATTCCTGCAGTTCACGGAGG - Intronic
1076390731 10:130099690-130099712 ACCATTTTTGTATTTTTTGGTGG + Intergenic
1076509698 10:131004027-131004049 GCCATTTCTGCAGATCATGGGGG + Intergenic
1077679299 11:4224226-4224248 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1077688734 11:4320868-4320890 CCCTTCTCTGCTTTTCTGGGTGG - Intergenic
1077746718 11:4915087-4915109 CCAATTTCATCACTTCTTGGTGG + Exonic
1077755788 11:5025900-5025922 AGCAGCTCTGCATTTCTTGGAGG + Intergenic
1077883184 11:6366949-6366971 CCCTTCTCTGCTTTTCTAGGGGG + Intergenic
1078017016 11:7623743-7623765 CCCATTTCTCCCTTTCTTTGTGG - Intronic
1078262367 11:9722332-9722354 CCATTTTCTGCATTCCTTGTAGG - Intronic
1079727305 11:23891988-23892010 CCCTTCTCCGCCTTTCTTGGGGG - Intergenic
1081356653 11:42121758-42121780 CCCTTTTCTGCTTTTCTGGAGGG + Intergenic
1082874607 11:57975265-57975287 CCCATTTCTCTACTTTTTGGAGG - Intergenic
1083516497 11:63263587-63263609 ACCATTTTTGCTCTTCTTGGTGG + Intronic
1084674029 11:70624005-70624027 CCCATGGCTCCAGTTCTTGGTGG - Intronic
1085881907 11:80477339-80477361 CTCATATCTACATTTCTTGAGGG + Intergenic
1086265962 11:84998424-84998446 CACAGTTCTGCATGTCTTGGAGG - Intronic
1086667940 11:89507827-89507849 CCCATCACTGCTATTCTTGGTGG - Intergenic
1087621886 11:100552585-100552607 CGCATTTCTGCATTTCTAACAGG - Intergenic
1087789856 11:102394395-102394417 CTGATTTGTGCATTTTTTGGTGG + Intergenic
1087906258 11:103701215-103701237 GCCATTTCTGCAGTTCTTACTGG - Intergenic
1088169525 11:106979937-106979959 CCCTTTTCTCCTTTTCTAGGAGG - Intronic
1088277799 11:108107121-108107143 CCAATTTTTACATTTATTGGAGG + Exonic
1088522950 11:110718778-110718800 CCCCTTTGTGTATTCCTTGGGGG + Intergenic
1088888289 11:114024774-114024796 CCCAGTTCTGCAGGTCTTTGTGG - Intergenic
1089446317 11:118555441-118555463 CCAATATCTGCCTTTCCTGGTGG + Intronic
1089953040 11:122547542-122547564 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
1089987172 11:122825347-122825369 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
1091163015 11:133443437-133443459 GCCATCTCTGCATCTGTTGGTGG - Intronic
1091720759 12:2811694-2811716 TCCAGTTCTGCCTTTCTTTGGGG - Intergenic
1094316282 12:29139822-29139844 CCCTTCTCTGCTTTTCTAGGGGG - Intergenic
1096201793 12:49688950-49688972 CCCATTTTTGCCTTTCTTTAGGG - Intronic
1096527076 12:52216598-52216620 CCTTTTTCTGCATATCTGGGGGG - Intergenic
1096652733 12:53069839-53069861 CCCAGTTCTGCAATGCTGGGTGG - Intronic
1096784987 12:54011780-54011802 TCCTTTTCTGCATTTCGAGGGGG - Exonic
1097648929 12:62270939-62270961 CCCATCTCTTTATTTCTTAGAGG + Intronic
1097771123 12:63586825-63586847 CCCATTTCTGTATTTCCTGGTGG - Intronic
1099020290 12:77395352-77395374 TCCAGTTCTGCATGTGTTGGTGG + Intergenic
1099416867 12:82400021-82400043 CCTATTTATACATTTCTTTGGGG - Intronic
1099870001 12:88335304-88335326 CCCATTCCTGGACTTCTTCGGGG + Intergenic
1102831642 12:116007441-116007463 CCCTTGTTTGCATTTCTTGTTGG + Exonic
1103025796 12:117572799-117572821 CCCCTATCTGCATTTCTTGCAGG - Intronic
1107279495 13:38717338-38717360 ACCTTTACTGCATATCTTGGTGG - Intronic
1107595963 13:41963355-41963377 ACCATTTTTCCATTTCCTGGAGG - Intergenic
1107937269 13:45355570-45355592 CTCATTTCTGCCTTTATGGGGGG + Intergenic
1108057023 13:46495266-46495288 CCCATTTCCTCATTCCATGGAGG + Intergenic
1108578274 13:51807583-51807605 CCAATGTCTGCAGTCCTTGGAGG - Intergenic
1108599731 13:51982289-51982311 CCTACTTCTGAATTTCTTGAGGG + Intronic
1109021327 13:57096488-57096510 CATATTTCTGCATTTCTTTTTGG - Intergenic
1109158962 13:58948470-58948492 CACAGCTCTGCATTGCTTGGAGG - Intergenic
1109576740 13:64269163-64269185 CACAGTTCTGCATGGCTTGGAGG - Intergenic
1110221286 13:73077355-73077377 CCGATTTCTGCTTTTCATGTAGG - Exonic
1110705565 13:78600165-78600187 CCCGTTTCTTCCTCTCTTGGAGG - Exonic
1110941652 13:81358638-81358660 CACATTTGTGCATTTCTTTTAGG - Intergenic
1110978246 13:81867021-81867043 CCCTTTTCTGCTTTTTTGGGTGG + Intergenic
1111159406 13:84373968-84373990 CACATTTGTGCATACCTTGGAGG + Intergenic
1112889549 13:104212894-104212916 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1113156358 13:107327218-107327240 CCCCTTTCTGTAGGTCTTGGTGG - Intronic
1113208355 13:107943481-107943503 CTCCTTTGTGCATTTCTTGCAGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1115529313 14:34312336-34312358 CCCATGTCTGCATTTCCTCTTGG - Intronic
1115743330 14:36410862-36410884 CATAGTTCTGTATTTCTTGGAGG - Intergenic
1116469768 14:45273545-45273567 CCACTTTTTGCATTTCTTTGTGG - Intergenic
1116534994 14:46017162-46017184 CCCTTCTCTGCCTTTCTGGGGGG - Intergenic
1118497635 14:66324587-66324609 CCCAATTGTTCATTTCTTTGAGG + Intergenic
1120234774 14:81877191-81877213 CACAGTTCTGCATAGCTTGGAGG - Intergenic
1120316659 14:82902993-82903015 AGCATTTGTGTATTTCTTGGTGG - Intergenic
1121645545 14:95515495-95515517 CCTGTTTCTGCTTCTCTTGGTGG + Intergenic
1122480290 14:102042802-102042824 CCCACTTCTGCATTTGGTGATGG - Intronic
1124943295 15:34238614-34238636 CCCATTACTACATTTCTAAGGGG + Intronic
1125091652 15:35799833-35799855 TCCATTTCTGTAGTTCTTGATGG + Intergenic
1126530322 15:49703694-49703716 CCCTTTTCTGCTTTTCTGGAGGG - Intergenic
1126571924 15:50161925-50161947 CTCCTTTTAGCATTTCTTGGAGG + Intronic
1126755720 15:51923217-51923239 CTAATTTTTGCATTTTTTGGTGG - Intronic
1126843528 15:52739502-52739524 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
1131958511 15:97763704-97763726 CCCATTTATGGACTTCTTTGTGG - Intergenic
1132420778 15:101665974-101665996 CCAATGTTTGCATTTATTGGAGG - Intronic
1135008314 16:18848663-18848685 TCCATTTCTCCACGTCTTGGTGG + Intronic
1137541740 16:49367649-49367671 TCTATTTCTGCAGTTCTTGTGGG - Intergenic
1138972853 16:62167732-62167754 CTCCTTTCAGCATTTCTTGTAGG + Intergenic
1139351953 16:66342549-66342571 CCCATTTCTTCCTTCCTTGCAGG - Intergenic
1140149365 16:72346455-72346477 CACATTACTGTATTTCTTGATGG + Intergenic
1140224154 16:73065312-73065334 CCCATGCTTGCATTTCTTGCAGG + Intergenic
1141243557 16:82285419-82285441 CCCCTTACAGCAGTTCTTGGAGG + Intergenic
1141893069 16:86940512-86940534 TCCATTTCTCCATTTCTTTGGGG - Intergenic
1142632884 17:1237043-1237065 CCCATTTCTGTATTTTTTGTGGG - Intergenic
1144662993 17:17083465-17083487 CAAATTTCTGCAATTTTTGGTGG + Intronic
1144765066 17:17728102-17728124 CCCATTTGTGCATTTCTGGGGGG + Intronic
1145930681 17:28683073-28683095 CACCTTTCTACCTTTCTTGGTGG - Exonic
1146592322 17:34138114-34138136 CCCTATTCTGCCTTTCTAGGTGG - Intronic
1147164742 17:38587160-38587182 CCCAATTCTGCCCTTCTGGGTGG - Intronic
1147894066 17:43738937-43738959 CTTATTTGTACATTTCTTGGGGG + Intergenic
1148236933 17:45975235-45975257 GCCTCTTCTGCATTTCTTGTTGG - Intronic
1148382172 17:47207927-47207949 CAAGTTTCTGCATTTATTGGAGG - Intronic
1149089948 17:52765601-52765623 CTCTTTTTAGCATTTCTTGGAGG - Intergenic
1149169834 17:53796084-53796106 TCCATGTCTGCCTTTCATGGTGG - Intergenic
1150203317 17:63379352-63379374 CCCAATTCTGCTTTGGTTGGGGG - Intronic
1151139240 17:71975808-71975830 CCCACTTCTGGATTTGGTGGGGG + Intergenic
1151825372 17:76521077-76521099 CCCATTTCACTATTTCCTGGGGG - Intergenic
1153888738 18:9492668-9492690 TCCATTGCTGCCTTTTTTGGGGG + Intronic
1154506697 18:15047107-15047129 CACAGTTCTGCATGGCTTGGAGG + Intergenic
1156855137 18:41773081-41773103 CCCATTCCTGATTTTCCTGGTGG - Intergenic
1157479440 18:48044154-48044176 TCCACTTCTGCATTTCTCTGGGG + Intronic
1158137880 18:54225749-54225771 CACATTTCTAAATTTCTTGTAGG - Intergenic
1158153320 18:54396612-54396634 ATCAGTTCTGCATTTTTTGGGGG + Intergenic
1158394880 18:57071511-57071533 CCCTTCTCTGCCTTTCTGGGGGG - Intergenic
1160111994 18:76041884-76041906 ACCATTCATGCATTTCTTTGGGG - Intergenic
1160244987 18:77150776-77150798 CCAAATTATTCATTTCTTGGAGG + Intergenic
1160748997 19:725088-725110 CTAATTTTTGTATTTCTTGGTGG + Intronic
1161443893 19:4307218-4307240 CTCATTTTTGTATTTTTTGGTGG + Intronic
1164568996 19:29355235-29355257 CACAGTTCTGCATGGCTTGGGGG - Intergenic
1164569351 19:29360165-29360187 CCCTCTTCTCCATTTCTTTGGGG - Intergenic
1164913899 19:32034506-32034528 CCCTCCTCTGAATTTCTTGGCGG - Intergenic
1166689686 19:44814874-44814896 CCTTTCTCTGCATTTCTTGGGGG + Intronic
1168212332 19:54899664-54899686 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
925522935 2:4767915-4767937 TCCATTGCTTCATTTGTTGGAGG + Intergenic
925693763 2:6552398-6552420 CCCAGTTCTGCATGGCTGGGAGG + Intergenic
926239411 2:11073629-11073651 CCCACTTCAGAATATCTTGGAGG + Intergenic
927203291 2:20591691-20591713 CGCATGTCTGCATTTTTTGGAGG - Intronic
928019662 2:27693445-27693467 CTCCTTTTTGCATTTCTTGTAGG + Intronic
928044989 2:27921849-27921871 CACACTTTTGCCTTTCTTGGAGG + Intronic
928778102 2:34790741-34790763 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
930000343 2:46856901-46856923 CCCCTTTCGGCAGCTCTTGGAGG - Intronic
930578140 2:53177412-53177434 GTCATTTCTACAGTTCTTGGAGG - Intergenic
931042478 2:58315073-58315095 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
931067156 2:58599780-58599802 CCCATCTCTGCATCTCTTACAGG - Intergenic
931182653 2:59918382-59918404 CCCATTTCCCCATTTCTGTGAGG + Intergenic
931196232 2:60054488-60054510 CCCATTTCTCCATCCTTTGGTGG - Intergenic
932239763 2:70147421-70147443 CCCATTTCTGCCTCTCTCTGGGG - Intergenic
932295637 2:70621535-70621557 CCCTTCTCTGCCTTTCTGGGGGG + Intronic
933012864 2:77089251-77089273 CCCTTCTCTGCTTTTCTGGGAGG + Intronic
934111227 2:88745440-88745462 CTCATTTTAGCATTTCTTGTAGG + Intronic
934949890 2:98569094-98569116 CCCATCTCGGCATCTCCTGGAGG + Intronic
935291204 2:101612461-101612483 CCCTTTTCTGCATTGCTGGTGGG - Intergenic
937127520 2:119483944-119483966 CCCATTCCTGCTTGGCTTGGGGG - Intronic
937828119 2:126389711-126389733 CACAGTTCTGCATGGCTTGGGGG - Intergenic
938289768 2:130142978-130143000 CCCATTTCAGCTCTACTTGGAGG + Intronic
938466758 2:131529960-131529982 CCCATTTCAGCTCTACTTGGAGG - Intronic
939885477 2:147676694-147676716 CCCATTACTGTTTCTCTTGGTGG - Intergenic
940107165 2:150113683-150113705 CCCTTTTCTGCTTTTCTGGAGGG + Intergenic
940575501 2:155498632-155498654 CACTTTGCTGGATTTCTTGGAGG - Intergenic
941731706 2:168925027-168925049 CTCATTTCTGCATTTCTTTTAGG + Intronic
942732257 2:179073383-179073405 CACAGTTCTGCATGGCTTGGTGG - Intergenic
943461358 2:188173751-188173773 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
943951494 2:194135596-194135618 CCCTTCTCTGCTTTTCTGGGTGG - Intergenic
944636164 2:201678169-201678191 CCCAATTATGGGTTTCTTGGGGG - Intronic
945220454 2:207478251-207478273 CACATTTACCCATTTCTTGGGGG + Intergenic
945375881 2:209078987-209079009 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
945973420 2:216252370-216252392 ACGATTTCTGCATTTCTTCTTGG + Intergenic
946322339 2:218961184-218961206 CCCATTTCTCCATTTCTGCCGGG + Exonic
946871936 2:224092420-224092442 CACTTTTCTGCTTTTCTGGGGGG - Intergenic
948608709 2:239153280-239153302 CCCATTTCTGCATCTCTAAAGGG - Intronic
1169549288 20:6685605-6685627 CCCATTTCTCCATTTTTAGGAGG - Intergenic
1170204450 20:13783647-13783669 CTCATTTTTGTATTTCTTGTGGG - Intronic
1170738710 20:19033833-19033855 CCAATTTTTGTATTTCTTGTAGG - Intergenic
1170982920 20:21231682-21231704 CCACTTTCTGCTTTTCTTTGGGG - Intronic
1172175341 20:32968960-32968982 CTCAATGCTGCAGTTCTTGGAGG + Intergenic
1174118915 20:48247751-48247773 CCCATTTCCCCATTTCATAGTGG - Intergenic
1174666498 20:52262859-52262881 CACAGTTCTACATGTCTTGGGGG + Intergenic
1174849780 20:53981743-53981765 CCCTTTTCTGCTTTCCTTTGGGG - Intronic
1175558697 20:59897781-59897803 CCCATTTTTTGATTTCTTCGTGG - Intronic
1176693975 21:9950830-9950852 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1176791169 21:13321994-13322016 CACAGTTCTGCATGGCTTGGAGG - Intergenic
1177292994 21:19139644-19139666 CACATTTCTGCATTGCTGGGAGG + Intergenic
1177888464 21:26775783-26775805 TGCATTTCTGCAATTCTTAGAGG + Intergenic
1177891877 21:26814508-26814530 CCAATTTCTGCCATACTTGGAGG + Intergenic
1178019052 21:28388450-28388472 TCCATTTCTCCATTTCTGAGAGG - Intergenic
1178380488 21:32103553-32103575 CCCATTTCTGCATGTGTGGTGGG - Intergenic
1178782685 21:35619966-35619988 CCCATTGCTGGGTTTCTTGCAGG - Intronic
1178788189 21:35673789-35673811 CCCATCTGTGCATTTTTCGGAGG - Intronic
1178865004 21:36320108-36320130 CCCAATTCGGCATTGCCTGGAGG + Intergenic
1180629793 22:17220589-17220611 CCCATGTCTGCATTTCTAATTGG - Intronic
1180865158 22:19114456-19114478 GCCTTTGCTGCAGTTCTTGGAGG - Intronic
1184611760 22:45608427-45608449 GCCTTTTCTGCATTTCTTGCAGG + Intergenic
949827220 3:8177933-8177955 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
951750333 3:26028006-26028028 CCCATTTCTGCATTGCTTCAAGG + Intergenic
953176955 3:40561811-40561833 CCCTTCTCTGCCTTTCTGGGGGG + Intronic
953355498 3:42253014-42253036 CCAATTTATGCCTATCTTGGGGG + Intergenic
953853256 3:46481776-46481798 CCAATTTCTACATCTGTTGGTGG - Intronic
955602982 3:60668211-60668233 CCCACTTCAGTATTTCTTGGTGG + Intronic
956162270 3:66367647-66367669 TCCTTTTCTTCCTTTCTTGGGGG + Intronic
956772268 3:72536704-72536726 CCCATTCCTGCCTTGCCTGGAGG - Intergenic
956962729 3:74421618-74421640 CACATTTCTTCATTTCTTCTTGG - Intronic
958181983 3:90072211-90072233 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
958182020 3:90072354-90072376 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
960471642 3:118073705-118073727 CCCACTTTAGCATTTCTTGCAGG + Intergenic
962726655 3:138234786-138234808 CCCACTTCTATATTTCTAGGAGG + Intronic
963058382 3:141205824-141205846 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
963381317 3:144534029-144534051 CCCAGTTCTGCATGGCTGGGAGG + Intergenic
963928958 3:150982099-150982121 CACATGTCTGAAATTCTTGGGGG + Intergenic
964087726 3:152836742-152836764 CCCCATTCTCTATTTCTTGGCGG + Exonic
964125703 3:153231576-153231598 CCCTTCTCTGCTTTTCTTGGGGG - Intergenic
964200048 3:154108846-154108868 CCCATGCCTCCATTTCTTTGTGG - Intergenic
964300442 3:155279858-155279880 CCCTTCTCCGCTTTTCTTGGAGG - Intergenic
964379319 3:156081972-156081994 CCCATTTCTGCTTTGCTAGCTGG + Intronic
964564410 3:158034123-158034145 CCCATTTTAGCATTTCTTGTAGG - Intergenic
964635718 3:158856673-158856695 TTTATTTCTGCATTTCTTGTAGG + Intergenic
964759184 3:160117292-160117314 CCCACTTAAGCATTTCTTGTAGG - Intergenic
964941158 3:162158828-162158850 CCCTTTTCTGCTCTTCTGGGGGG - Intergenic
964941216 3:162159013-162159035 CCCATTTCTACTTTCCTGGGGGG - Intergenic
965070110 3:163908452-163908474 CCCTTCTCTGCTTTTCTAGGGGG + Intergenic
965626566 3:170688268-170688290 CCCTTCTCTGCCTTTCTGGGGGG - Intronic
965640274 3:170822829-170822851 CCCTTCTCTGCCTTTCTGGGGGG - Intronic
966066582 3:175828450-175828472 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
966279036 3:178208335-178208357 CCCTTCTCTGCTTTTCTTGGGGG + Intergenic
968026999 3:195450911-195450933 CCCAAATCTAAATTTCTTGGAGG + Intergenic
968577683 4:1375601-1375623 GCCTTTTCTGGATATCTTGGTGG + Intronic
969290322 4:6234979-6235001 CCCATTTCCACTTTTCTTGGTGG + Intergenic
970213717 4:13737058-13737080 CTCAGCTCTGCATTTCTTGAAGG + Intergenic
970545942 4:17130579-17130601 CCAATGTCTACATTTTTTGGAGG - Intergenic
970854260 4:20635030-20635052 CCCTTTTCTACTTTTCTGGGGGG - Intergenic
972238295 4:37160160-37160182 CTCACTTCTCCATTTCTTGCAGG + Intergenic
974336115 4:60546957-60546979 TTCATTTTTGCATTTCTTGATGG + Intergenic
974379956 4:61126646-61126668 GCCATTTCTGTATTTCTTTAGGG + Intergenic
974919974 4:68226642-68226664 CTCATTTCTTCATTTGTTTGTGG - Exonic
974954198 4:68618407-68618429 CTCATTTTTGTATTTCTTGTAGG - Intronic
975416314 4:74109359-74109381 TTCTTTTCTGCATTTCTTAGTGG - Intergenic
975861058 4:78677393-78677415 TCCATTCCTGCATTACTTGTAGG - Intergenic
976047292 4:80965748-80965770 CCCATCCCTGCTTTTTTTGGTGG - Intergenic
976932248 4:90582035-90582057 CCCATTTCTGCATTTCTTGGTGG + Intronic
977971540 4:103218791-103218813 AGCAGCTCTGCATTTCTTGGAGG + Intergenic
978027763 4:103898490-103898512 CTCATTTTAGCATTTCTTGTAGG - Intergenic
978031310 4:103942294-103942316 CCCTTCTCTGCTTTTCTAGGGGG + Intergenic
978456073 4:108893361-108893383 TCAATTTCTACATTTATTGGTGG + Intronic
978945761 4:114494312-114494334 CACAGTTCTGCATTGCTGGGTGG + Intergenic
978951432 4:114563924-114563946 CACATTTCTGCTTTTCTAGCTGG - Intergenic
979146408 4:117253022-117253044 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
979882805 4:125984100-125984122 ACCATTTCTGAATTTTTGGGAGG - Intergenic
980003561 4:127516218-127516240 CCCTTGTCTGCTTTTCTGGGGGG - Intergenic
980286194 4:130781561-130781583 CCCATTTCTTTATTCCTTAGTGG - Intergenic
980366596 4:131811028-131811050 CTAATTTCTGCCTTTCTTTGAGG - Intergenic
981020135 4:140018542-140018564 AACTTTTCTGCATTTCTTTGTGG + Intronic
981238114 4:142442244-142442266 CTAATTTCTGTATTTTTTGGTGG - Intronic
981660695 4:147163119-147163141 TACATTTCTGCATTTATTGCCGG - Intergenic
981789493 4:148520566-148520588 CACAGTCCTGTATTTCTTGGAGG + Intergenic
982313932 4:154012142-154012164 TTCATTTCTGTAGTTCTTGGGGG + Intergenic
984099244 4:175466123-175466145 CCCTTCTCTGCATTTCTGGGGGG - Intergenic
984184356 4:176524735-176524757 CACCTTTCAGCATTTCCTGGTGG - Intergenic
984256259 4:177393182-177393204 CCCATATCTGCTTTTCTAGAGGG + Intergenic
984299364 4:177895178-177895200 CCCATCTCTGTCTTTCTTTGGGG + Intronic
984322022 4:178208295-178208317 CCCTTTTCTGCTTTTCTAGGGGG + Intergenic
984424692 4:179568427-179568449 CTCACTTCAGCATTTCTTAGAGG + Intergenic
984437057 4:179721449-179721471 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
985526615 5:406262-406284 CTCTTGTCTGCATTTCTTGCAGG + Intronic
985856210 5:2429424-2429446 CCCGTTTCTGCACTCCTGGGTGG + Intergenic
987755566 5:22095572-22095594 CCCTTCTCTGCTTTTCTGGGGGG + Intronic
987907911 5:24102859-24102881 GGCATTTCTGCATTTCTTTCAGG - Intronic
988952804 5:36281858-36281880 CCCATTTCTGCATAATTTGAAGG + Intronic
989264319 5:39455551-39455573 CCAATCTCTGGATTTATTGGGGG - Intronic
992887810 5:81176497-81176519 CTCATATCTGAAATTCTTGGCGG + Intronic
993741295 5:91543629-91543651 TCCTTTTCTGTATTTTTTGGGGG + Intergenic
994446512 5:99880420-99880442 AGCATTTCTGCATTTCTCTGAGG + Intergenic
994775484 5:104032623-104032645 CCCCTCTCTGCCTTTCTTGGGGG + Intergenic
995727193 5:115193692-115193714 CCCATTTTTTAATTTCTAGGAGG - Intergenic
995957953 5:117802487-117802509 CACAGTTCTGCATTACTTAGGGG - Intergenic
996587309 5:125104356-125104378 TACATTTCTGCATTTCTTTTTGG + Intergenic
997201849 5:132014725-132014747 CCCATTACTGCATCTCCTAGTGG + Intergenic
997679069 5:135736558-135736580 CCCTTTTCCGCTTTTCTTAGGGG - Intergenic
998878791 5:146626721-146626743 TCCCATTCTGCATGTCTTGGGGG + Intronic
999279122 5:150353377-150353399 TCCAGTTCTGCATTTCTTCCAGG + Intergenic
999936253 5:156488635-156488657 CTCCTTTAAGCATTTCTTGGAGG - Intronic
1000438369 5:161240892-161240914 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
1000439489 5:161249336-161249358 CCCTTCTCTGCTTTTCTGGGGGG + Intergenic
1000978741 5:167793668-167793690 CTAATTTTTGCATTTTTTGGTGG - Intronic
1003512243 6:6791221-6791243 CCCACTTCTGCAGTGCTTGCTGG - Intergenic
1004106020 6:12668217-12668239 CCCTTCTCTGCCTTTCTGGGGGG + Intergenic
1004106052 6:12668338-12668360 CCCTTCTCTGCCTTTCTTGGGGG + Intergenic
1004515965 6:16322563-16322585 CACATTTCTGAATTTCTCTGTGG + Intronic
1005467053 6:26125645-26125667 CCCAGATCTCCATTTCTTGTGGG - Intronic
1005649420 6:27873004-27873026 CCCCTTTCAGCATTACTTAGTGG - Intergenic
1007599946 6:43075499-43075521 CCCCTCTCAGCATATCTTGGAGG + Intergenic
1008108198 6:47463202-47463224 ACCATTTCTACATTTCTTGGGGG + Intergenic
1008430906 6:51415600-51415622 ACTATTTCTGGATTTCTTTGTGG + Intergenic
1009265602 6:61550936-61550958 CCAATTTTTGTATTTTTTGGTGG + Intergenic
1009359166 6:62792536-62792558 CCCTTCTCTGCTTTTCTAGGGGG + Intergenic
1010381666 6:75232507-75232529 CCCATTTCTTGATTTTTTGATGG - Intergenic
1010607940 6:77915294-77915316 CTCCTTTCAGCATTTCTTGTAGG + Intronic
1010719953 6:79271778-79271800 CCCCCTTCTGCAATTCTTAGGGG + Intergenic
1010786750 6:80011739-80011761 CCTATTTCTGCATCTTGTGGTGG - Exonic
1011368067 6:86602900-86602922 CCCTTCTCTGCTTTTCTGGGTGG - Intergenic
1013679169 6:112503877-112503899 CCCATTTCTGAATTTTTTAAAGG + Intergenic
1014275201 6:119380317-119380339 CCCAGTTCTGCATGGCTAGGAGG + Intergenic
1014290734 6:119554710-119554732 CCCAATAGTGGATTTCTTGGTGG + Intergenic
1014668849 6:124273431-124273453 CACAATTCTGCATGTCTGGGAGG - Intronic
1014912538 6:127111861-127111883 CCCTTTTCTGCCTTGCTTTGAGG - Intergenic
1015801576 6:137066028-137066050 CCCTTTTCTGCTTTTCTGGAAGG - Intergenic
1016876141 6:148867252-148867274 CCCATTTCTACCTTTCTTTGAGG + Intronic
1017779571 6:157705549-157705571 CCCTTCTCTGCCTTTCTAGGGGG - Intronic
1019951303 7:4375279-4375301 TCCCTTTCTGCATTGATTGGAGG + Intergenic
1020541324 7:9463207-9463229 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1020654563 7:10914040-10914062 CCTATTTATGCATTTCTTAAGGG - Intergenic
1021445948 7:20733802-20733824 CTAATTTCTGCATGTTTTGGTGG + Intronic
1021545537 7:21809396-21809418 CCCACTTTTGCATTTGTTTGTGG + Intronic
1022032618 7:26506157-26506179 TCCTTTTCTCCATTTCTTGGGGG + Intergenic
1022930605 7:35109091-35109113 CCCATTTCTATATTTCCTGGTGG - Intergenic
1023172602 7:37404254-37404276 CCCATCTCTGAATGTCTAGGTGG + Intronic
1023996722 7:45163079-45163101 CCCATGTCTGAATCACTTGGAGG + Intronic
1024335737 7:48203579-48203601 CTCATTCCTGCCTTTGTTGGGGG + Intronic
1026194308 7:68159566-68159588 CACAGTTCTGCATGGCTTGGGGG + Intergenic
1026624018 7:71976424-71976446 CCCATTTCTGCATTTGGGGAGGG - Intronic
1026655629 7:72254076-72254098 TCCATTTCTGCTCTTCTTGGTGG + Intronic
1028038318 7:86014734-86014756 ACTCTTTCTGCATGTCTTGGGGG - Intergenic
1029112877 7:98222579-98222601 CCCATTTCTGCTGGTCCTGGAGG - Intronic
1029500023 7:100923181-100923203 CCCTTTTCTGCTTTTCTAGGGGG + Intergenic
1029826504 7:103201602-103201624 CCCATTTCTATATTTCCTGGTGG - Intergenic
1030604970 7:111630896-111630918 CTCCTTTATGCATTTCTTGTAGG + Intergenic
1030797046 7:113802026-113802048 TACATTTCTGCATGTCTTGTGGG + Intergenic
1031226002 7:119038636-119038658 CACATTTCTGTTTTTCTTTGTGG - Intergenic
1033147465 7:138883623-138883645 CACATTTCTACATACCTTGGAGG - Intronic
1034085014 7:148314670-148314692 CCCTTCTCTGCTTTTCTGGGGGG - Intronic
1036472572 8:9064257-9064279 CCCTTCTCTGCTTTTCTGGGGGG - Intronic
1037375951 8:18228446-18228468 CCCATCTTTGCATCTCTAGGAGG - Intergenic
1038078551 8:24105644-24105666 CCCATATCTGCATGCCCTGGTGG + Intergenic
1038818683 8:30932323-30932345 CCCTTTTCTGCATTTCTCCCAGG + Intergenic
1039705065 8:39998147-39998169 GCCATTTCTGTTTCTCTTGGGGG + Intronic
1040108955 8:43557454-43557476 CCCCTTTCTGGCTTTTTTGGTGG + Intergenic
1040699682 8:50046366-50046388 CCCATTTCTGCATATCTACTTGG + Intronic
1041430556 8:57776904-57776926 CACAGTTCTGCATTGCTCGGAGG - Intergenic
1042686453 8:71446432-71446454 CACAGTTCTGCATGGCTTGGGGG - Intronic
1042711462 8:71721981-71722003 GCAAGTTCTGCATTTCTTAGTGG - Intergenic
1042882826 8:73513326-73513348 CCCATGTCTGCATAGCTTAGTGG + Intronic
1044627623 8:94249710-94249732 CCCAATTCTATATGTCTTGGTGG + Exonic
1044710453 8:95052394-95052416 GCCATTTCTGTATTTCTCAGAGG + Intronic
1045286236 8:100794030-100794052 CCCATTTCATCCCTTCTTGGAGG - Intergenic
1046778942 8:118194713-118194735 ACTATTTCTGGATTTCTAGGAGG + Intronic
1046887852 8:119387690-119387712 CACAGTTCTGCATGGCTTGGGGG - Intergenic
1047456272 8:125015756-125015778 CTCACTTCGGCATTTCTTGTGGG + Intronic
1047532745 8:125692144-125692166 CACAGTTATGCATTTTTTGGTGG + Intergenic
1047742740 8:127819850-127819872 TCCACCTCTGCATTTCTTAGAGG - Intergenic
1047833228 8:128658867-128658889 CTCTTTTCTGCATCTCTTGAAGG - Intergenic
1047837644 8:128711744-128711766 CATATTTCTTGATTTCTTGGAGG + Intergenic
1047854584 8:128896159-128896181 CATATTTCTTGATTTCTTGGAGG + Intergenic
1047856167 8:128915383-128915405 CCCTTCTCTGCTTTTCTGGGAGG + Intergenic
1048273505 8:133047977-133047999 CGCATTCCTGCCTTTCCTGGGGG - Intronic
1048985225 8:139731428-139731450 CCCATTCCTGAATTGTTTGGGGG + Intronic
1049869036 8:144959051-144959073 CCCTTCTCTGCCTTTCTGGGGGG - Intergenic
1050117414 9:2276671-2276693 CCCTTTTCTGCTTTTCTGGAGGG + Intergenic
1050310510 9:4348231-4348253 CCTATTTCTGAATTTCTTTCAGG - Intronic
1050472397 9:6007469-6007491 CCCCTTTCTGCAGCCCTTGGGGG - Exonic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1051052459 9:12949487-12949509 CCCTTTTCTGCTTTTCTGGAGGG + Intergenic
1051764816 9:20512160-20512182 ACCATTGCAGCCTTTCTTGGAGG - Intronic
1053630947 9:39936929-39936951 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1053774821 9:41526576-41526598 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1054212940 9:62313769-62313791 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1055131460 9:72779741-72779763 CATAATTCTGTATTTCTTGGAGG - Intronic
1055165541 9:73186990-73187012 CTCATTTAGGCATTTCTTGTAGG - Intergenic
1055347902 9:75356401-75356423 CCCTTTTCTGCTTTTCTGGAGGG - Intergenic
1055881595 9:81010163-81010185 CCCTTCTCTGCATTTCTGGAAGG + Intergenic
1056458446 9:86786097-86786119 CCCATTTTTATATTTCTTGTGGG + Intergenic
1057130519 9:92651363-92651385 CCCTTTTCTGCACTTGCTGGTGG - Intronic
1057254868 9:93537648-93537670 CTCCTTTCGGCTTTTCTTGGTGG - Intronic
1057340353 9:94195754-94195776 CTCATTTTAGCATTTCTTGTAGG + Intergenic
1057458638 9:95238405-95238427 CCCCCTTCTCCATTTCTTTGAGG + Intronic
1058100017 9:100908661-100908683 CACATTTCTGTTTTTCTTTGAGG - Intergenic
1058795664 9:108496156-108496178 CTCCTAACTGCATTTCTTGGTGG - Intergenic
1059546325 9:115179204-115179226 CCCTTTTCTGCTTTTCTGGAAGG - Intronic
1059629396 9:116104203-116104225 CCCATTTCTGCAAATGTTGTTGG - Intergenic
1059917097 9:119116285-119116307 CACTTTTCTCCATTTCTAGGTGG - Intergenic
1060776509 9:126378564-126378586 CCCAGTACTGCCTTCCTTGGAGG + Intronic
1060817222 9:126641467-126641489 CCCATGTCTGCATATCTTCATGG + Intronic
1062264994 9:135682957-135682979 CCCCTCTGTGCATTTCTGGGAGG + Intergenic
1062708367 9:137957613-137957635 GTCATTTCTGCTCTTCTTGGTGG - Exonic
1185566236 X:1097500-1097522 CCCATTTCTGCTTCTCTTTGGGG + Intergenic
1185958005 X:4513506-4513528 CCTATTTCTACAGGTCTTGGTGG - Intergenic
1186392290 X:9173082-9173104 ACCAATTCTCCAATTCTTGGTGG - Intergenic
1187623781 X:21087736-21087758 CTCCTTTTTGCATTTCTTGTAGG - Intergenic
1187793726 X:22978907-22978929 CACATTTCTGCTTTTCTAGTTGG + Intergenic
1188056626 X:25548660-25548682 CACATTTCTGCATGGCTGGGGGG + Intergenic
1188669027 X:32860467-32860489 CCCAGTTTTGCAATTCTTTGTGG - Intronic
1189605769 X:42676290-42676312 CCCACTTCAGCATCTCTCGGTGG + Intergenic
1190037731 X:47041389-47041411 CCCATTTTTGCTTTTGTTGTGGG + Intronic
1190811250 X:53886298-53886320 CAAATTTCTGCATTTCTTCTAGG + Intergenic
1191781743 X:64875953-64875975 CCCCCTTCAGCATTTCTTGGAGG - Intergenic
1191886677 X:65895601-65895623 CCCATTTCTGCCATTCTTCATGG - Intergenic
1192959482 X:76112213-76112235 CTCCTTTCAGCATTTCTTGTAGG - Intergenic
1193114606 X:77764516-77764538 ACCATTTCTTCATTACTTGTGGG - Intronic
1193709561 X:84862753-84862775 CCCTTATATGCATTTCCTGGAGG + Intergenic
1194354038 X:92858173-92858195 CTCCTTTCAGCATTTCTTGTAGG - Intergenic
1194503207 X:94703638-94703660 CCCTTCTCTGCCTTTCTGGGGGG - Intergenic
1194874027 X:99164249-99164271 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1195874660 X:109526780-109526802 GCCATTTCTGCATCTATTGGTGG - Intergenic
1196484763 X:116192981-116193003 CCTAATTCTAAATTTCTTGGAGG + Intergenic
1196525648 X:116725526-116725548 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1196525662 X:116725584-116725606 CCCTTCTCTGCTTTTCTGGGGGG - Intergenic
1197470744 X:126864026-126864048 CCCTTCTCTGCTTTTCTGGGAGG + Intergenic
1197524287 X:127543578-127543600 CTCACTTCAGCATTTCTTGTTGG + Intergenic
1197602407 X:128546227-128546249 TCCTTTTTTGCATTTCTTGTAGG + Intergenic
1197953359 X:131921030-131921052 CTCCTTTCTGCATTTCTTGTAGG - Intergenic
1197971784 X:132122001-132122023 CCCATTTCTGCGCTTCCTGTAGG - Intronic
1198201702 X:134426815-134426837 CACATTTATGCATTTCTTTATGG + Exonic
1198599614 X:138269094-138269116 CCCTTCTCTGCCTTTCTGGGGGG - Intergenic
1200662393 Y:5975237-5975259 CTCCTTTCAGCATTTCTTGTAGG - Intergenic