ID: 976938200

View in Genome Browser
Species Human (GRCh38)
Location 4:90665897-90665919
Sequence CAGTGGGAGGTGTGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 583}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976938200 Original CRISPR CAGTGGGAGGTGTGGGAAAA GGG Intronic
900654418 1:3747980-3748002 CTGTGGGAGGTGTGGGCCCAGGG + Intergenic
901388394 1:8926240-8926262 CGGAGTGAGGTGTGGGAAGACGG - Intergenic
901610639 1:10495154-10495176 CAGTGAGAGATGTGAGAAAGAGG + Intronic
902665242 1:17933064-17933086 GAGTGGGAGGTGGGGGACACAGG - Intergenic
903182918 1:21614093-21614115 CAGTGGGAGGTGGGGGCCAGGGG + Intronic
903499308 1:23792816-23792838 CTGGAGGGGGTGTGGGAAAATGG + Intronic
904079108 1:27860954-27860976 AAGTGGGAGGTCGGGGATAAGGG - Intergenic
904273350 1:29364624-29364646 TGGTGGGAGGTGGGGGAACATGG + Intergenic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
905007087 1:34718456-34718478 TAGTGGGAAGTGTGGGAGAGTGG - Intronic
905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG + Intergenic
905750398 1:40457572-40457594 AAGATGGAAGTGTGGGAAAAGGG - Intronic
905825519 1:41023486-41023508 AAGTGGGAGCTGTGGGGAAGAGG - Intergenic
906128125 1:43439904-43439926 CGATTGGATGTGTGGGAAAAGGG + Exonic
906421121 1:45668128-45668150 CAGTCAGAGCTGTGGGAGAAAGG - Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
907047310 1:51307113-51307135 AAGTGGGAGATGTGGCAAGAAGG + Intronic
907281598 1:53350612-53350634 CAGATGGAGGGGTAGGAAAATGG - Intergenic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
908163474 1:61434899-61434921 CACTTGGAACTGTGGGAAAAGGG + Intronic
908946015 1:69498141-69498163 CAGTGAGGGCTGTGGGAGAAAGG + Intergenic
909458924 1:75885395-75885417 AGGTGGGAGGTGGAGGAAAAGGG - Intronic
910796726 1:91104739-91104761 CAGTGAGAAGTGTGGGGGAAGGG - Intergenic
911485492 1:98500209-98500231 CAGTAGGTGGTGCTGGAAAAAGG - Intergenic
911849660 1:102802058-102802080 CAGTGGGAGATGGGGGTGAACGG - Intergenic
912865780 1:113255057-113255079 CAGTGGTAGGTGAGGTGAAATGG - Intergenic
912909907 1:113747761-113747783 CAGTGGAAGGTGAGGGACAATGG - Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917123722 1:171667197-171667219 CAGTGAGATGTGTTGTAAAACGG - Intergenic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917404506 1:174690045-174690067 CACAGGGAGATGTTGGAAAATGG - Intronic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
917806782 1:178620955-178620977 CAGTGGGAGATGTTGGATCATGG - Intergenic
918919855 1:190694458-190694480 TAGGGTGAGGTGTGGGAGAAGGG + Intergenic
919798651 1:201337293-201337315 CAGAGGGTGGTGTTGGAGAAGGG - Intergenic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920773899 1:208916967-208916989 CAGTGAGGAGTGTGGGAAAGTGG - Intergenic
921156454 1:212442686-212442708 CACTTGGAGGTGTGAGGAAAGGG + Intronic
922216233 1:223522438-223522460 AAGTGGGATGTGTGGGGAAGGGG - Intergenic
922240938 1:223755264-223755286 CAGCGGGAGATGTCAGAAAATGG - Intronic
922880064 1:228974165-228974187 CAGGGAGAGGGGTGGGGAAATGG - Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923596161 1:235362091-235362113 CCCTGGGAGGTGTGTGAAAGTGG - Intergenic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924444488 1:244116626-244116648 CAGAGGGAGGTGAGGAACAAAGG - Intergenic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1063181249 10:3602582-3602604 CAGTGGCAGGTATGGACAAAGGG + Intergenic
1063356087 10:5399718-5399740 GAGTGGGAGGGGTGGAGAAAAGG - Intronic
1064729635 10:18317091-18317113 CAGGGGGTGGTGTGGGGAATGGG - Intronic
1066047609 10:31607015-31607037 CAGTGGGAGTTTTGAGAAAGAGG - Intergenic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067189335 10:44056615-44056637 GGATGGGAGGTCTGGGAAAATGG + Intergenic
1067722233 10:48736855-48736877 CAGTCAGAGGTGTGGAAACACGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067888724 10:50114192-50114214 CAGTGTCAGGTGTAGGAACAAGG + Intronic
1070358063 10:75659631-75659653 GACTGGGAGGTGGGGGAAATGGG + Intronic
1070813534 10:79310229-79310251 AAGTGGGATGTCTAGGAAAAGGG + Intronic
1071312068 10:84352378-84352400 CAAGGTGAGGTGTGGGAACAGGG + Intronic
1071709242 10:88032940-88032962 CAATGAGATGAGTGGGAAAATGG + Intergenic
1072166030 10:92813952-92813974 CAGTGGGTGGTGGGGGTAAAAGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072474299 10:95744651-95744673 CAGAGGGAGGTAGAGGAAAAGGG - Intronic
1072567081 10:96625672-96625694 TTGTTGGAGGTGTGGCAAAAGGG - Intronic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1073044220 10:100626976-100626998 CAGAGGGTGTTGGGGGAAAAGGG + Intergenic
1073075892 10:100825805-100825827 GAGTTAGAGGTGTGGGTAAAGGG + Intronic
1073211552 10:101807340-101807362 GAGTGGGAGGAGTGCAAAAAGGG + Intronic
1073472279 10:103730354-103730376 GAGTTGGAGGTGTGGCACAAGGG + Intronic
1073849348 10:107596207-107596229 GAGAGAGAGGTGGGGGAAAAGGG - Intergenic
1074400834 10:113140255-113140277 GAGCGGGAGGTGGGGGAAAGAGG + Intronic
1074575181 10:114662350-114662372 CAGTGGGAAGGCTGTGAAAAAGG + Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074872422 10:117587661-117587683 GAGGGGAAGGTGTGGGAGAAAGG - Intergenic
1075012610 10:118887550-118887572 CAGGGGGTGGTGTGGGGGAATGG - Intergenic
1075427969 10:122356590-122356612 AACTGGGAGGCATGGGAAAAGGG + Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076069567 10:127476735-127476757 CATTGGGAGGTGTTGGTCAAAGG - Intergenic
1076252348 10:128994583-128994605 CAGGGGGAGGTGGAGGAGAAAGG + Intergenic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076542234 10:131221386-131221408 CAGTGGGAGGTGGGTGGGAAAGG + Intronic
1076797136 10:132803877-132803899 CAGAGGGAGGTGTGGGAGAGGGG + Intergenic
1077654750 11:4007829-4007851 TGGTGAGAGCTGTGGGAAAATGG + Intronic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1078085798 11:8232431-8232453 TACAGGGAGGTGTGGGGAAATGG + Intronic
1078810976 11:14762806-14762828 CAGTGTGATGTGTGAGAAAGAGG + Intronic
1079031122 11:16987251-16987273 CAGTGGGGGGTGTGGGGGATGGG - Intronic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1081870044 11:46379282-46379304 AAATGGGAGGGGTGGGGAAAAGG - Intronic
1083489284 11:63003324-63003346 CAGTTGGAAGTGAGGGAGAATGG + Intronic
1084424151 11:69075432-69075454 CAGTGGGAGTTTGGGGAATAAGG + Intronic
1084741792 11:71144933-71144955 CAGAGGGACGTGTCGGAACAGGG + Intronic
1085145582 11:74192616-74192638 TAGTGGGAGGTGTTGGATCATGG + Intronic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1086505709 11:87502090-87502112 CAGAGGGAGGAGTGGGGGAAGGG - Intergenic
1086729938 11:90236416-90236438 CAGGGTGAGGTATGGGAGAAGGG - Intergenic
1086926368 11:92644548-92644570 CAGTGAGAAGTATGTGAAAAGGG - Intronic
1087815701 11:102656121-102656143 TAGTGGGAGATGGGGGATAAAGG - Intergenic
1088673525 11:112167561-112167583 CGGCGGGAAGTGAGGGAAAATGG + Intronic
1089175613 11:116546952-116546974 CAGAGGAAGATGTGGGAAAATGG + Intergenic
1089389082 11:118087775-118087797 CAGTGGTAGGGGTGGGGAATAGG + Intronic
1089706788 11:120283838-120283860 CAGTGGAATATTTGGGAAAAGGG + Intronic
1089937523 11:122379547-122379569 TGGGGGGAAGTGTGGGAAAAAGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090741808 11:129668944-129668966 TAGTGGGAGGTGTTGGATCATGG + Intergenic
1091633768 12:2182058-2182080 CTGTGGGAGGTATTGGAGAAGGG + Intronic
1092177125 12:6417721-6417743 CAGGGTGAAGTATGGGAAAACGG + Intergenic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093958824 12:25251045-25251067 CTGAGGGCGGTGTGGGAAGAGGG + Intergenic
1094441712 12:30485427-30485449 CTGTGGCAGGGCTGGGAAAATGG - Intergenic
1094473577 12:30824579-30824601 CAATGGGAGGCATGGGGAAAGGG - Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1096258655 12:50077668-50077690 CAGAGAGAGATGGGGGAAAAGGG + Intronic
1096524553 12:52202766-52202788 CAGGGGGAGGGGTGGGATGAGGG + Intergenic
1096527030 12:52216233-52216255 GAGTCAGAGGTGTGGGAAAGAGG - Intergenic
1096684319 12:53277718-53277740 CAGTGGGAGGTTGGCGTAAAGGG + Intronic
1097691576 12:62739091-62739113 CAGTGGAAGCTGTGAGAAAATGG + Intronic
1098176426 12:67796833-67796855 CAGTCGCAAATGTGGGAAAAGGG - Intergenic
1100451806 12:94713731-94713753 CAGTGGGAAGTGTGTGGAGAAGG + Intergenic
1102262751 12:111454651-111454673 CAGTGCACAGTGTGGGAAAAAGG - Intronic
1102456205 12:113072152-113072174 CACTTGGAGGAGTGGGAAAGAGG - Intronic
1102555002 12:113720938-113720960 GAGAGGGAGGAGTGGGAGAAGGG + Intergenic
1103744283 12:123111583-123111605 CAGTGGGAGGTGTGGCTGCAGGG + Intronic
1105803791 13:23936887-23936909 CTTTGGGAGGTGAAGGAAAATGG + Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1107360010 13:39607621-39607643 CAGGGCGAGGTATGGGGAAAAGG - Intergenic
1108459756 13:50653281-50653303 CATGGGGAGGTCTGGGACAAGGG + Intronic
1108644424 13:52412285-52412307 AAGTGGAAGGTGTTGGGAAAAGG - Intergenic
1109004720 13:56857475-56857497 CTGTGGGGGGTGGGGGACAAGGG + Intergenic
1110528719 13:76571545-76571567 AAGTAGGAGGTGGGGGAAAAGGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1111848027 13:93536071-93536093 CCCTGGGTGGTGTGGGAACACGG + Intronic
1112559354 13:100498652-100498674 CTGGGGGAGGTGGGGGAATAGGG - Intronic
1112592472 13:100776306-100776328 CAGGGTGAGGTATGGGCAAAGGG + Intergenic
1113483489 13:110638340-110638362 CAGCAGGAGGTGTGGGGAAGTGG - Exonic
1113771896 13:112915537-112915559 AAGTAGTGGGTGTGGGAAAATGG - Intronic
1114848088 14:26348246-26348268 TAGTGTGAGGTGTGGGATCATGG - Intergenic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115134835 14:30095848-30095870 CTGGGGGAGCTGTGAGAAAAGGG + Intronic
1115677823 14:35700039-35700061 TTGGGGGAGGTGTGGGAAAGTGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115984061 14:39085249-39085271 TAGAGTGAGGTGTGGGAGAAGGG - Intronic
1116101657 14:40445867-40445889 CAGTGAGATTTGTGGGAAAGAGG - Intergenic
1116719093 14:48469790-48469812 AATTGGTTGGTGTGGGAAAAAGG + Intergenic
1116929308 14:50673929-50673951 TAGGGAGAGGTATGGGAAAAGGG - Intergenic
1117487049 14:56208423-56208445 CACTGGAAGGTGTAGGAGAATGG + Intronic
1118430355 14:65713037-65713059 TAGTGGGAGGTGGGGGGTAAGGG - Intronic
1119087161 14:71749299-71749321 CAGTGAGAGGAGTGGGGAACAGG - Intergenic
1119604415 14:76002341-76002363 CAAGGGGAAGTGTGGTAAAAAGG + Intronic
1119968440 14:78942966-78942988 GAGAGGGAGGGTTGGGAAAATGG + Intronic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120280285 14:82430216-82430238 TAGTGGTAGGTGTGGGCTAAGGG + Intergenic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1121323553 14:93006826-93006848 CAGTGGCAGGCCTGGAAAAAGGG - Intronic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123072085 14:105646873-105646895 TAGTGGGAGGTGGGCGAACAGGG - Intergenic
1202894211 14_KI270722v1_random:188738-188760 CAGTGGGATGGGTGGGGAATTGG - Intergenic
1124390396 15:29250507-29250529 CAGTCTGCGATGTGGGAAAACGG + Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124624882 15:31302158-31302180 CAGTGGGAACTGTGGGACAGAGG + Intergenic
1124801063 15:32833250-32833272 TAATGGGAGGTGGGGGGAAATGG + Intronic
1125759710 15:42088277-42088299 CAGTGGGTGCTGTGGGTGAAAGG + Intronic
1125932963 15:43613075-43613097 CAGAGGGAGGTGGGGGAGCAGGG + Exonic
1125946062 15:43712537-43712559 CAGAGGGAGGTGGGGGAGCAGGG + Intergenic
1126479238 15:49099521-49099543 CAGTGGGAGGTTTTGGACAGGGG + Intergenic
1126785394 15:52174450-52174472 CTGTGGGAGGAAGGGGAAAATGG + Intronic
1127394129 15:58529891-58529913 CAGTGGTTGGAGTGGGAGAAGGG + Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1128929915 15:71695043-71695065 CCGTGGGAGGTTTTGGAAAGAGG - Intronic
1129149838 15:73681661-73681683 CAGTGGGAAGTGGGGGGAAGTGG + Intergenic
1130086236 15:80780122-80780144 CACTGGGAGGCGAGGGAAACTGG - Intronic
1130092295 15:80831115-80831137 ATTTGGGAGGTGTGGGAAACGGG + Intronic
1130132723 15:81157727-81157749 GACTGGGAGGTGAGGGAAATGGG + Intergenic
1130334678 15:82948822-82948844 CAGTGGGAGGTATTTAAAAAGGG + Intronic
1130520938 15:84660148-84660170 CAGTGGGACTTCTGGGAAAGTGG - Intergenic
1130655295 15:85788362-85788384 GACAGGGAGGTGTGGGAAGATGG - Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131157928 15:90086293-90086315 AGGTGGTAGGTGTGGGAAACAGG - Intronic
1131224067 15:90609324-90609346 GAGTGGGGTGTGTGGGAAGAGGG + Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131680787 15:94720745-94720767 CACTGGGAGGGCTGGGAAAGAGG + Intergenic
1131683221 15:94745514-94745536 GTGTGGGAGGTCTGGGAACAGGG - Intergenic
1132947972 16:2543141-2543163 CAGTGGAACATGTGGGAAAGGGG + Intronic
1132966475 16:2658201-2658223 CAGTGGAACATGTGGGAAAGGGG - Intergenic
1133278773 16:4653283-4653305 CAGGGTGAGGTGTGGGGGAAGGG + Intronic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1134152724 16:11817821-11817843 TAGGGTGAGGTGTGGGGAAAGGG + Intergenic
1134276810 16:12783627-12783649 CAGTGTGATGGGTGGGAAAGTGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134771182 16:16811175-16811197 CAGTGAGAGGTGCAGGAAAAAGG - Intergenic
1134821654 16:17251915-17251937 GAGTGGGAGTTGTGGGGACAGGG + Intronic
1134887904 16:17810694-17810716 CTGTCGGGGGTGGGGGAAAAGGG - Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135236323 16:20759667-20759689 TAGGGCGAGGTGTGGGAGAAGGG - Intronic
1135619378 16:23942222-23942244 CAGAGGGAAGTGTAGGAAACTGG + Intronic
1136358233 16:29760704-29760726 TAGAGGGAGGAGAGGGAAAAGGG - Intergenic
1136417387 16:30112425-30112447 CTGGGGGTGGTGTGGGAAAAGGG + Intronic
1136932430 16:34431687-34431709 TAGAGGGAGGTGTGGGAGAGTGG - Intergenic
1136972142 16:34980127-34980149 TAGAGGGAGGTGTGGGAGAGTGG + Intergenic
1137744045 16:50807839-50807861 GCTTGGGAGGTGGGGGAAAATGG + Intergenic
1137770256 16:51010668-51010690 CAGGGGAAGAGGTGGGAAAAAGG - Intergenic
1137798479 16:51241402-51241424 CTGTGGGAGGTGTGGACTAATGG - Intergenic
1139366896 16:66439088-66439110 CAGTGGGAGGTAGGGGACACTGG + Intronic
1139558133 16:67725561-67725583 CAGTGGGAGGTGGGGTAGAGTGG + Exonic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1141157417 16:81606951-81606973 CAGTGTGAGGAGTGTGGAAAGGG + Intronic
1141185497 16:81784180-81784202 TAGAGGGAGGTGGGGGCAAAGGG + Intronic
1141389067 16:83649394-83649416 CAGTGGGAGGTGAGGAAATACGG + Intronic
1143383422 17:6510328-6510350 CGGAGGGAGGTGTGGGAAGCAGG - Intronic
1145974788 17:28977776-28977798 CAGCTGCAGGTGTGGGAAAGGGG - Intronic
1146194511 17:30800110-30800132 CTGGGAGTGGTGTGGGAAAAAGG - Intronic
1146200539 17:30853746-30853768 CAGTGGCAGGAGTGGGACAGAGG - Intronic
1146396357 17:32470758-32470780 TACTGGGAGATGTGGAAAAATGG + Intronic
1147250451 17:39150209-39150231 CAGTGGGAAGTATGGGCAGAGGG - Intronic
1147540275 17:41351424-41351446 CACTGGGAGGGGTGGAAAATAGG + Intergenic
1147575284 17:41595442-41595464 CAGTGGGAGGTCTGAGAGATGGG - Intergenic
1148932313 17:51137110-51137132 CAGTGGGAGTTGTCCAAAAATGG + Intergenic
1149232148 17:54546951-54546973 CTGGGGCAGGGGTGGGAAAATGG - Intergenic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1152020820 17:77779425-77779447 CAGCGGGAGGGGTGTGAAATCGG + Intergenic
1152020925 17:77779868-77779890 AAGCGGGAGGGGTGGGAAATCGG - Intergenic
1152610244 17:81311796-81311818 CTGTGCGGGGCGTGGGAAAAAGG - Exonic
1152640130 17:81445833-81445855 CATTGGGAGGACTGGGAAGAGGG - Intronic
1153575112 18:6512169-6512191 CTGGGGGATGAGTGGGAAAAGGG + Intronic
1154038954 18:10834833-10834855 TGGAGGCAGGTGTGGGAAAAGGG - Intronic
1154981634 18:21507014-21507036 CAGGATGAGATGTGGGAAAAGGG - Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156335440 18:36167527-36167549 CAGCGGGAGGTAGGGGAATAAGG + Intronic
1156432068 18:37085797-37085819 GAGAGGGAGGAGAGGGAAAAAGG - Intronic
1157297766 18:46458370-46458392 CAGTGGGGGGTGGGGCACAAAGG - Exonic
1157516730 18:48316504-48316526 TAGTGGGAGGTGTTGGACCATGG + Intronic
1157627560 18:49063198-49063220 CTGTGTCAGGTGTGGGAAATTGG - Intronic
1157874821 18:51262422-51262444 GGGTGGGAGGTGTGGGGGAATGG + Intergenic
1157994146 18:52534997-52535019 CAGGGGGAGATGGGGGAAAGTGG - Intronic
1158364147 18:56712144-56712166 CACTGGGAGCTGTTGGAAAGTGG + Intronic
1158616289 18:58990806-58990828 AAGCTGGAGCTGTGGGAAAAGGG + Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1161360425 19:3845887-3845909 CACAGGAAGGTGTGGGAAAAGGG + Intronic
1161619213 19:5289585-5289607 CAGAGGGAGGAGGGGGAGAAAGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161646508 19:5456467-5456489 CAGTGGTAGGTGTGGGAGCAGGG - Exonic
1161931844 19:7345811-7345833 CTGTGGCAGGTGTGGGATCACGG - Intergenic
1162267527 19:9588037-9588059 GAGTGAGCGGTTTGGGAAAAGGG + Intergenic
1162342969 19:10102876-10102898 CAGTGGAGGGTGTGGGGGAAAGG - Intergenic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1163648312 19:18502723-18502745 CAGGAGGAGGAGTGGGAACACGG + Intronic
1163870261 19:19815391-19815413 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1163948344 19:20561426-20561448 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1163969762 19:20780856-20780878 TGGTGGCAGCTGTGGGAAAAGGG - Intronic
1164000289 19:21092206-21092228 TGGTGGCAGCTGTGGGAAAAGGG - Intronic
1164022659 19:21322239-21322261 TGGTGGCAGCTGTGGGAAAAGGG + Intronic
1164048492 19:21563480-21563502 TGGTGGCAGCTGTGGGAAAAGGG + Intergenic
1164096244 19:22012320-22012342 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164199465 19:23004641-23004663 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164306443 19:24007884-24007906 TGGTGGCAGCTGTGGGAAAAGGG + Intergenic
1165550603 19:36581582-36581604 TAGTGGGAGGTGTTGGATTATGG + Intronic
1165740623 19:38203285-38203307 CAGAGGGAGATGGGGGCAAATGG - Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1165808400 19:38596044-38596066 CTGGGGGTGGTGTGGGGAAAGGG - Intronic
1165952634 19:39482809-39482831 CCGAGGGAGGAGTGGGATAAGGG - Intronic
1166219285 19:41354360-41354382 CAGTGGGAGGAGGGGGCAACAGG + Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166766247 19:45253160-45253182 CTGTCGGAGGTGAGGGAAACAGG - Intronic
1166788255 19:45382469-45382491 CAGTTGGGGGTTGGGGAAAAGGG - Intronic
1167480434 19:49727405-49727427 CAGGGGAGGGTGTGGGAAGAAGG - Intergenic
1168460117 19:56547649-56547671 TAGGGTGAGGGGTGGGAAAAGGG - Intronic
1168503886 19:56916586-56916608 CAGGGGGAGGAGTTGGAAAGAGG + Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926001508 2:9336995-9337017 AATTAGGAGGTTTGGGAAAACGG + Intronic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926429506 2:12771835-12771857 TAGTGGGAGTTTGGGGAAAACGG + Intergenic
926693897 2:15757179-15757201 CTGGTGGAGGTGTGGGAGAATGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
928925409 2:36573856-36573878 TGGCGGGAGGTGTGGGAAAATGG + Intronic
929048399 2:37813378-37813400 CAGTGGGAGGTAGGGGGAATGGG - Intergenic
929086962 2:38177613-38177635 CAGTGGTAAGGGTGGTAAAAGGG - Intergenic
929184103 2:39075202-39075224 CAGTGGGAGGTGGGAAAGAAGGG + Intronic
929611887 2:43276923-43276945 CTGTGGGAGGTGGGAGAGAAGGG - Intronic
929618064 2:43327893-43327915 CAGTGGGATCTCTGGGAGAAGGG - Intronic
929828051 2:45325371-45325393 GTGTGGTAGGAGTGGGAAAATGG + Intergenic
929974950 2:46624167-46624189 CTGTGCGATGTGTGGAAAAAAGG + Exonic
930058707 2:47271686-47271708 ACGTGTGAGGTGTGGGAAGATGG + Intergenic
931934056 2:67176259-67176281 CAGTTGGAGGTGTTGGATTAGGG + Intergenic
932222583 2:70011114-70011136 GGGTGGGGGGTGTGGGAAAAGGG + Intergenic
932715962 2:74100938-74100960 CAGTTGGAGCTCTGGGCAAAGGG - Exonic
932735777 2:74253217-74253239 CAGTGGGAGATGTGGTTCAAAGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
932968874 2:76514091-76514113 CAGTAGGAGTTGTGGGAGGAAGG - Intergenic
933389421 2:81651774-81651796 CTGTGAGAGGTTTTGGAAAAAGG + Intergenic
933498056 2:83076329-83076351 CAGTGAAATATGTGGGAAAATGG - Intergenic
933937354 2:87217327-87217349 CAGTGGGAGGTGTGGGCTACTGG + Intergenic
934954386 2:98605273-98605295 CACTGGAATGTGTGGGAAACAGG + Intronic
935669395 2:105542386-105542408 CAGTGGAGGGTGAGGTAAAAAGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936355786 2:111748475-111748497 CAGTGGGAGGTGTGGGCTACTGG - Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
938371543 2:130771664-130771686 CAAGGGGAGGTGGGGGAACAGGG + Intergenic
938583790 2:132670242-132670264 GAGTGGGAGGTGGGGAGAAAAGG - Intronic
938628922 2:133143746-133143768 CAGTGGCAGCTATGTGAAAAGGG - Intronic
938750024 2:134319558-134319580 CAGTGGGAGTGATGGGACAATGG + Intronic
939023549 2:136985704-136985726 CTGGTGGAGCTGTGGGAAAAAGG + Intronic
939287999 2:140157309-140157331 CAGAGAGAGCTGTGGGGAAAAGG - Intergenic
940087443 2:149876750-149876772 CTTGGGGAGGTGTGGGAAACAGG + Intergenic
941369548 2:164647189-164647211 CAGTAGGAAGTGTGGCAAACTGG - Intergenic
942224378 2:173802456-173802478 CAGGGTGAGGTATGGGAGAAGGG + Intergenic
942822191 2:180127189-180127211 AATTGGGAGCTTTGGGAAAAGGG + Intergenic
943281209 2:185935570-185935592 CTGTTGGAGATGTGGAAAAAGGG - Intergenic
943350475 2:186791300-186791322 CAGGGGGAGGGGTGGGGGAAGGG + Intergenic
943621263 2:190150492-190150514 CAGTGGGAGGTGTTTGGGAAAGG + Intronic
945180609 2:207087439-207087461 GAGGGGGAGGTGTGGGACACAGG + Intronic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
947046285 2:225990291-225990313 TGGTGGGAGGTGTTGGATAATGG + Intergenic
947443540 2:230144230-230144252 GAGTGGGAGACCTGGGAAAATGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
1168870062 20:1120064-1120086 CAGTGAGGGGTGGGGGAAAGGGG - Intronic
1168908174 20:1423423-1423445 GGGTGGGAGGTGAGGGAGAAGGG + Intergenic
1169552300 20:6713611-6713633 ATGTTGCAGGTGTGGGAAAAGGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172425671 20:34854474-34854496 CAGCGGTGGGTGTGGGGAAAGGG - Intronic
1172765463 20:37348405-37348427 CATGGGGAGGTTTGAGAAAATGG - Intronic
1172824203 20:37766642-37766664 CAGGTGGAGGAGTGGGAGAAGGG + Intronic
1173086750 20:39926965-39926987 AAGTGGCAGATGTGGGAGAAGGG + Intergenic
1173572414 20:44085974-44085996 AGGTGAGAAGTGTGGGAAAATGG + Intergenic
1175226134 20:57444996-57445018 CAGCAGGAGGTGTGGGAAGCAGG + Intergenic
1176190001 20:63804049-63804071 CAGTGAGAGGTGTTTGGAAAGGG - Intronic
1176940168 21:14913559-14913581 CAGTGGGAGGTGGAGCAAGATGG - Intergenic
1177167894 21:17623690-17623712 TAGTGGGAGTTGTGGGACAAGGG - Intergenic
1177442395 21:21143220-21143242 CATTGGAAGATGTGAGAAAATGG + Intronic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1178806700 21:35845463-35845485 TAGGGGGAGGTGGGGGAGAAGGG - Intronic
1179489427 21:41730596-41730618 CTGGGGGAGGTGTGGGGAAGTGG - Intergenic
1179557907 21:42192388-42192410 GAGGGGGTGGTGTGGGAACAGGG - Intergenic
1182110525 22:27719861-27719883 CACAGGGAGGGGTGGGAAATGGG + Intergenic
1182767463 22:32768495-32768517 CAGAAGGAGGTCTGGGATAAAGG - Intronic
1183340159 22:37275661-37275683 GGGTAGGAGCTGTGGGAAAAGGG - Intergenic
1184059387 22:42073065-42073087 CAGTAGGAGGTGGGGGTAGAAGG - Intergenic
1184105706 22:42366468-42366490 CAGTGGGGGGTGTGGGAGACTGG + Intergenic
1184180182 22:42816467-42816489 CAGTGAGAGGTCTGCTAAAAAGG - Intronic
1184447222 22:44555882-44555904 TAGTGAGAGGGGTTGGAAAAGGG + Intergenic
949197162 3:1325541-1325563 ACTTGGGAGCTGTGGGAAAAGGG - Intronic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949608729 3:5681908-5681930 CAGTGGGAGGTGTTGGATCACGG - Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
951008404 3:17646887-17646909 AAGTGGGAGGGGTTGGAACAGGG - Intronic
952347021 3:32497471-32497493 TAGTGTGAGGGGTGGGAAAGTGG + Intronic
952539429 3:34352004-34352026 GAGGGGGAGGTGTGATAAAAGGG - Intergenic
953055877 3:39386854-39386876 TGGTCGGAGGTGTGGGAGAAAGG + Intronic
953395994 3:42570559-42570581 CAATGGAAGGTGTGGAGAAATGG - Intronic
953552832 3:43917703-43917725 CAGTGGCAGGTGTGGGCTCATGG + Intergenic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953970467 3:47343431-47343453 CTGTGGGAGGTATGGGGACAAGG - Intronic
954744458 3:52779218-52779240 CAGTGGCATATCTGGGAAAAGGG - Intronic
955195320 3:56800740-56800762 CAGAGTGAGGTGTGGGAGAGTGG + Intronic
955796462 3:62642475-62642497 AAGTGGGAGGGGTGGAGAAAAGG + Intronic
955863337 3:63355668-63355690 CACTGGGAGGTGACGGAGAATGG - Intronic
956307482 3:67842125-67842147 CAGTCTGCAGTGTGGGAAAAAGG + Intergenic
956326436 3:68057794-68057816 CAGTGGGTGGAGTGGCACAATGG + Intronic
956624320 3:71251940-71251962 GAGTAGGAGGTGGGAGAAAAGGG - Intronic
956665416 3:71637543-71637565 GAGGGGGAGGAGGGGGAAAAGGG + Intergenic
956705589 3:71996222-71996244 CAGTGGGGGATCTGGGTAAAAGG + Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958433670 3:94071977-94071999 CAGTGGCAGGTGTGTGCAAGGGG + Intronic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
959357481 3:105351113-105351135 CAGTGGAAGAAATGGGAAAAGGG + Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
959481617 3:106879525-106879547 AACTGGGAGGTGGGGGAAATGGG + Intergenic
960338638 3:116447889-116447911 CTGTTGGTGGTGTGGGGAAAGGG - Intronic
961032846 3:123621760-123621782 CAGTGTGATGTGTGTGAGAAGGG - Intronic
961357242 3:126346784-126346806 CAGTGGGGGATGTGGGAACCCGG + Intronic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
962907151 3:139814333-139814355 CAGTGGGAGGTGGGGCAATAAGG + Intergenic
963530100 3:146463725-146463747 CAGTAGGAGGAGTTGGTAAAAGG - Intronic
963602408 3:147389971-147389993 CAGGGGTTGGGGTGGGAAAAAGG + Intronic
963814871 3:149818434-149818456 CACTGGGAGGAAGGGGAAAAGGG - Intronic
964386373 3:156152236-156152258 TAGTGGTAGGTGTGTTAAAAGGG + Intronic
965863067 3:173170322-173170344 GAGTGGGAGGTGTGAGGAAAGGG + Intergenic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
965977021 3:174638390-174638412 CATAGGGAGATGTGGGACAAAGG + Intronic
967157097 3:186703321-186703343 CATTGGGGTGTCTGGGAAAATGG - Intergenic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
968486129 4:863424-863446 CAGTGGCAGGTTTGGGAGGACGG + Intronic
968509224 4:988036-988058 CGGCGGGAGGTGGGGGAACAAGG - Exonic
968589306 4:1449726-1449748 GAGTGGGGGGTTGGGGAAAAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
969067285 4:4496543-4496565 CAGTGGGTGGTGTGGGAGAGTGG - Intronic
969252819 4:5980990-5981012 TTGTGGGAAGTGTGGCAAAATGG + Intronic
969435211 4:7185539-7185561 CTGGGGGAGGTCTGGGAAAGTGG - Intergenic
969798292 4:9542820-9542842 CCGTCGGAGGTGGGGGACAAGGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971000068 4:22311847-22311869 CAGCAGGAGGTTTGGGGAAAAGG + Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972299369 4:37770672-37770694 CAGTGGAAGATGGGGGAAAGGGG + Intergenic
972316967 4:37935793-37935815 CATTGGGAGGGGTAGGATAATGG - Intronic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973190592 4:47381108-47381130 CAGGGGTAGGTGTGGCACAACGG - Intronic
973685947 4:53370135-53370157 CAGTGGCAAGTGTCAGAAAAGGG + Intergenic
975557502 4:75678952-75678974 CAGTGGGCAGTCTGCGAAAAAGG - Intronic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
976135252 4:81929135-81929157 AAGTGGGATATCTGGGAAAAGGG - Intronic
976369988 4:84276586-84276608 CAGTGGGAGGCATGGCAAATAGG + Intergenic
976703389 4:87995519-87995541 CAGGAGGAGGAGGGGGAAAAGGG + Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
978617828 4:110613590-110613612 CAGTGGTAGTTGTGGAAAACAGG - Intergenic
979529591 4:121755031-121755053 CAGTTGGAGGTGGGGGATGAGGG + Intergenic
979787913 4:124739842-124739864 CGGTGGGATCTGTGGGAAAATGG + Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
980508554 4:133756079-133756101 TGTTGGGAGGTGTGGGAAAAGGG - Intergenic
980761451 4:137239056-137239078 CAGTGGGCTGTGTGGGAGCAGGG - Intergenic
982417914 4:155158185-155158207 TAGTGGGAGGTGTTGGATCATGG + Intergenic
983188518 4:164728828-164728850 CAGTGGGAGGAGTGAGGCAATGG - Intergenic
985226136 4:187763784-187763806 CTGGGGAACGTGTGGGAAAATGG - Intergenic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
987082747 5:14440420-14440442 CATTGTGTGGTGTGGGACAAGGG + Intronic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
988351160 5:30108776-30108798 CAGTGGGAAGTGTGGATTAAAGG + Intergenic
988474017 5:31566769-31566791 CAGTGGGAGGTATTGAAACATGG - Intergenic
988541087 5:32110686-32110708 CAATGAGATGTGTGGGAAGATGG - Exonic
989099734 5:37812581-37812603 CAGTGGGCTGTGTGGTAAGAAGG + Intergenic
989308677 5:39987585-39987607 CAGTGGCAGGTGCAGGCAAATGG - Intergenic
989757927 5:44978615-44978637 TAGTGGGAGGTATTGGAATATGG - Intergenic
989985198 5:50689208-50689230 GAGTGGATGGTGTGGAAAAAAGG - Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990294860 5:54390730-54390752 CAGTGGGAGGTGATTGAATATGG + Intergenic
990369407 5:55102090-55102112 CTGTGGCAGGTGTGGGAACATGG - Intergenic
990797968 5:59565597-59565619 CACTGGGAGGTGTGGGTAGTGGG + Intronic
990851851 5:60213775-60213797 CAGAGGGAGGTCTAGGAAAATGG - Intronic
991988128 5:72310401-72310423 AAGAGGGGGGTGGGGGAAAATGG + Intronic
991994018 5:72369771-72369793 CAGTGGGAAGTGTGAAAGAAAGG - Intergenic
992158936 5:73981896-73981918 CAGTGGTAGGGAAGGGAAAAGGG - Intergenic
992319898 5:75603481-75603503 CAGTGGAATGAGTAGGAAAAGGG + Intergenic
993190623 5:84674761-84674783 TAGGGGGAGGTATGGGGAAAGGG - Intergenic
993243902 5:85426897-85426919 GAGTTGGGGGTGGGGGAAAAAGG + Intergenic
993767568 5:91879851-91879873 GGGTGGGGGGTGTGGGAAATGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994737004 5:103567783-103567805 TAGTGGCAGGTTTGAGAAAATGG + Intergenic
995852393 5:116559784-116559806 CAGTTGGATGTGTGGGGTAAGGG - Intronic
995858330 5:116616305-116616327 CAGTGGGAGGAGTATGAGAAGGG - Intergenic
997475731 5:134141348-134141370 AAGTGGGAGGTGTGTGTACATGG + Intronic
997580549 5:135014157-135014179 TAGTGGGAGGTGTTGGATCATGG - Intergenic
997650992 5:135520508-135520530 TAGGGTGAGGTATGGGAAAAGGG + Intergenic
998885213 5:146686898-146686920 CAGCGGGAGGTTGGGGAAGAAGG + Intronic
999325529 5:150641197-150641219 CAGTGGGAGGAATGGGGAAGGGG + Intronic
999612801 5:153388639-153388661 CAGCGGGTGGGGTGGGGAAAAGG - Intergenic
1000294404 5:159900694-159900716 CAGTGGGGGGTATGGCAGAAGGG - Intergenic
1000480441 5:161767250-161767272 AAGTGGCAGGTGAGGGACAAAGG - Intergenic
1000811999 5:165874657-165874679 GAATGTGAGGTGTGGGAAAGAGG + Intergenic
1000926435 5:167200042-167200064 CAGTGGGTGGTGTGGAAAATGGG - Intergenic
1001266333 5:170277141-170277163 TGGTGTGAGTTGTGGGAAAAGGG - Intronic
1001578559 5:172781926-172781948 CACTGGGAGGTAGGGGAAATGGG + Intergenic
1002122794 5:177018562-177018584 CAGTAGGATGTGTTGGAAAATGG + Intronic
1002134201 5:177097991-177098013 CAGGGGGAGGTGTGGGGAAAGGG - Exonic
1002416366 5:179122875-179122897 CAGGAGGAGGTGTGGGACAGTGG + Intronic
1004139168 6:12999791-12999813 CAGGAAAAGGTGTGGGAAAAGGG + Intronic
1004199077 6:13531294-13531316 CAGTGGGAGGGTGTGGAAAATGG - Intergenic
1004298296 6:14434217-14434239 CAGTAGGAGGTGTTGGATCAGGG + Intergenic
1005774062 6:29110059-29110081 AAGTGGGAGGGGCAGGAAAATGG - Intergenic
1005824153 6:29622454-29622476 CAGTGGTAGGAGTGGGTGAATGG - Intronic
1007590702 6:43019017-43019039 GAGTGGGAGGTATTTGAAAAGGG + Intronic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1008897685 6:56576210-56576232 CAGGGTGAGGTATGGGAGAAGGG - Intronic
1008908957 6:56712355-56712377 AAGTAGGAGGAGTAGGAAAAAGG - Intronic
1009648701 6:66445059-66445081 GGCTGGGAGGTGGGGGAAAAGGG - Intergenic
1009903785 6:69843047-69843069 GAGTAGGAGGTATAGGAAAAGGG - Intergenic
1009923021 6:70086415-70086437 AAGAGGAAGGTGAGGGAAAAAGG + Intronic
1010108484 6:72196006-72196028 CAGTGGGAGGTGATGGATCATGG - Intronic
1010676124 6:78745587-78745609 CAGTGGGCTGGGTGGGTAAATGG + Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1011565995 6:88672549-88672571 CAGGGGGAAGTGTGGGATGAGGG + Intronic
1011741444 6:90364533-90364555 CAGTGGGAGGGGTCAGCAAAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013663264 6:112320539-112320561 TAGTGGGGAGTGGGGGAAAATGG + Intergenic
1014659961 6:124157228-124157250 CGGTGGGAGGTGTGTCATAATGG + Intronic
1015484451 6:133752467-133752489 TAGTGGGAGGTTTGGCAAAATGG + Intergenic
1015809014 6:137142700-137142722 CATGGGTAGGTGTGGGAAAGGGG - Intergenic
1015962176 6:138661271-138661293 GAGTGGGAGGTGGGAGAAATAGG - Intronic
1016433492 6:144011687-144011709 CAAGGAGAGGTGGGGGAAAAGGG + Intronic
1017320989 6:153092895-153092917 CAGTGAAAGGTGGGGGGAAATGG + Intronic
1019165258 6:170094238-170094260 CAGGGGGAGGTTTGGGAACAAGG - Intergenic
1019208571 6:170384686-170384708 CAGTGGGACGTGTGAGCACAGGG + Intronic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1019918437 7:4148226-4148248 CAGTGGCGGGTGTGGGAGGAGGG - Intronic
1020198793 7:6063150-6063172 TAGTGGGAGGTGTTGGACATGGG + Intergenic
1021093753 7:16511884-16511906 CCGTGCTGGGTGTGGGAAAAGGG + Intronic
1021570730 7:22062431-22062453 CAGAGGGAGCTGTGTGGAAAAGG + Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023822639 7:43988486-43988508 CTGTGGGAGGTCTAGGACAATGG + Intergenic
1024305916 7:47929518-47929540 CCGTGGGAGCTGTGGGAGAGAGG + Exonic
1025775627 7:64558379-64558401 GGGTGGCAGCTGTGGGAAAAGGG + Intronic
1026126875 7:67586966-67586988 GAGTGGCAGGTGTGGGTAGAGGG + Intergenic
1027436056 7:78165583-78165605 CAGTGCTGTGTGTGGGAAAAGGG - Intronic
1028436115 7:90806595-90806617 CACTGGGAAGTGTTGGAAAGTGG + Intronic
1028460257 7:91084527-91084549 CAGTGGGAGCTGTGTGGAAGAGG - Intronic
1028890096 7:95977427-95977449 TAGTGGGAGGTAGGGGTAAAGGG - Intronic
1028971927 7:96868690-96868712 CAGTGGGTTGTATGGGAGAAAGG + Intergenic
1029609957 7:101621543-101621565 CAGTGGGATGGGTGGGCAAAGGG + Intronic
1029750902 7:102541901-102541923 CTGTGGGAGGTCTAGGACAATGG + Intronic
1029768856 7:102641012-102641034 CTGTGGGAGGTCTAGGACAATGG + Intronic
1030278163 7:107742444-107742466 AATAGGGAGGTATGGGAAAAAGG + Intergenic
1030346364 7:108437274-108437296 GAGTGGGAAGTGGGGGAAATGGG + Intronic
1030569989 7:111211431-111211453 CAATGGGAGGAGTAGGAAATAGG + Intronic
1030595648 7:111535763-111535785 CAGTGGTGACTGTGGGAAAAGGG + Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032431765 7:131867920-131867942 CAGGGAGAGGTGTGGGGGAAGGG + Intergenic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1033042992 7:137935600-137935622 CAGAGAGAGGGGTGGGTAAACGG - Intronic
1033442838 7:141395830-141395852 CAGTGGTTTGTGTGGGAGAAAGG - Intronic
1034031449 7:147770378-147770400 AAGAGGGAGGAGTGGGGAAATGG + Intronic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035301979 7:157903278-157903300 GAGAGGGAGGTGGGAGAAAAGGG + Intronic
1035357397 7:158284696-158284718 CTGCGGGAGGTGTGGGTAGAGGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035440205 7:158890980-158891002 CAGTGAGAGGAGTGGATAAAAGG - Intronic
1035736360 8:1890109-1890131 CCGTGTGAGTTGTGAGAAAACGG + Intronic
1035782811 8:2242270-2242292 CTGTTGGAGGTGGGGGACAAGGG + Intergenic
1035809319 8:2477315-2477337 CTGTTGGAGGTGGGGGACAAGGG - Intergenic
1036547065 8:9782163-9782185 AAGTGGAGGGTGAGGGAAAAAGG - Exonic
1036744368 8:11393602-11393624 CCTAGGGAGGTGTGGGAACAGGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037102561 8:15065219-15065241 CAGGGGAAGGGGTGAGAAAATGG - Intronic
1037263008 8:17027982-17028004 CCGCTGTAGGTGTGGGAAAAAGG + Intronic
1037521564 8:19684948-19684970 CAGTAGAAAGTGTGGGAACAGGG - Intronic
1038009662 8:23464975-23464997 CACTGGTAGGTGAGAGAAAAGGG + Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038739939 8:30208245-30208267 TAGTGGGAGGTGTTGGATCATGG + Intergenic
1038914637 8:32007038-32007060 CAGTGGGATGTGAGGAAAAATGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039470027 8:37807710-37807732 CAGTGGCAGGTGTTGGAGACAGG + Intronic
1039804506 8:40986894-40986916 GAGGGTGAGGTGTGGGGAAAGGG + Intergenic
1040782325 8:51124374-51124396 CGGTGGAAGGTGTTGAAAAATGG - Intergenic
1041573710 8:59368755-59368777 CAGTGGAAGGTGTACGAAACAGG - Intergenic
1041615865 8:59906251-59906273 CAGTTTGAAGTCTGGGAAAATGG + Intergenic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1042376793 8:68061269-68061291 CGAGGGGAGGTGTGGCAAAAAGG + Intronic
1042685839 8:71439362-71439384 AAGTTGGAGGTGGGGGTAAAGGG + Intronic
1042875891 8:73439558-73439580 CAGTGACAGGGGTGGGAAAGAGG + Intronic
1043421484 8:80103011-80103033 TAGGGCGAGGTGTGGGAGAAGGG - Intronic
1043517380 8:81007198-81007220 TTGTGGGAAGTGCGGGAAAAAGG + Intronic
1044157850 8:88872199-88872221 CAGTTTGAGGAGTGGGAAAGAGG - Intergenic
1044466623 8:92514070-92514092 GGGTGAGAGGTGTGGAAAAAGGG + Intergenic
1044553367 8:93536173-93536195 CAGGGTGAGGTATGGGAAAAAGG + Intergenic
1046526917 8:115392488-115392510 CAATGACAGGGGTGGGAAAAGGG + Intergenic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047182084 8:122598482-122598504 TAGTGGGAGGTATGGCTAAAAGG + Intergenic
1047429257 8:124776414-124776436 CAGTGGCTGGGGTGGGGAAAAGG + Intergenic
1048100257 8:131343212-131343234 CAGTGGCAGGTCTGTGACAATGG + Intergenic
1048794977 8:138141431-138141453 CAGTGGGAGGTGGAGAACAATGG - Intronic
1049066900 8:140323243-140323265 CAGGGCGAGGTGTGGGAGAACGG - Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049180702 8:141220645-141220667 CCGTGGGAGGCGCGGGAGAAGGG + Intronic
1049342459 8:142120522-142120544 AAGAGGGAGGTGTGGGCACAGGG - Intergenic
1049401330 8:142428780-142428802 CAGTGGGCTGTGTGGGGAGATGG + Intergenic
1049604552 8:143523220-143523242 CAGTGGGAGGTGTGGGGGCCAGG - Intronic
1049790526 8:144470290-144470312 CAGAGGGATGTGTGGGATGAAGG - Intronic
1049821319 8:144635438-144635460 TAGGGTGAGGTGTGGGGAAAGGG - Intergenic
1049924768 9:398128-398150 CATTGGCAGGTGTGAGAATAAGG + Intronic
1050124524 9:2342909-2342931 GACTAGGAGGTCTGGGAAAAAGG + Intergenic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051256998 9:15224154-15224176 CAGTGGGAGGTGGGGAAGTAGGG - Intronic
1051698538 9:19794451-19794473 GAGGGGGAAGTGTGGGAGAAGGG + Intergenic
1052051156 9:23850873-23850895 CATAGGGAGGTGGGGGAAGAGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052616533 9:30849359-30849381 CAGAGGGAGGCTTAGGAAAATGG + Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1052892151 9:33711637-33711659 TAGTGGGAGGTGTTGGATCATGG + Intergenic
1052917088 9:33931710-33931732 CAGAGTGAGGTGGTGGAAAAGGG - Intronic
1053084371 9:35205534-35205556 TAGTGGGAGGTTGGAGAAAATGG - Intronic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054873384 9:70069984-70070006 CAGGGGGAGGTGTTTGCAAAAGG + Intronic
1054943877 9:70773472-70773494 GGGTCAGAGGTGTGGGAAAAGGG + Intronic
1055524609 9:77118106-77118128 CAGTAGGTGGTGGGGGAAATGGG + Intergenic
1056063632 9:82910560-82910582 CAGAGAGGAGTGTGGGAAAAGGG - Intergenic
1056188572 9:84162318-84162340 CAAGAGAAGGTGTGGGAAAAAGG + Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1058727336 9:107816884-107816906 CATTGGCAGGGGTGGGAAAAGGG - Intergenic
1058743045 9:107963581-107963603 CAGTGGTTTGTGTGGGAATAAGG - Intergenic
1059062222 9:111045342-111045364 AAGGGGATGGTGTGGGAAAAAGG - Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060558910 9:124526754-124526776 GAGTGGCTGGGGTGGGAAAAGGG - Intronic
1060702114 9:125764160-125764182 CAGGGGGAGGGGCAGGAAAAAGG - Intronic
1060940605 9:127541011-127541033 CATGGGGAGGTGGGGGAAAGAGG + Intronic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061569916 9:131470852-131470874 CTGGGGGTGGTGTGGGTAAAAGG - Exonic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1187245995 X:17553285-17553307 CAGTGGGAGGTGTGGAGAGCTGG + Intronic
1187249049 X:17580560-17580582 CAGTGGGAGGCGTGGGGAACTGG + Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1189279616 X:39812016-39812038 TAGGGGGAGGTGGGGGAAAGTGG - Intergenic
1189967262 X:46387596-46387618 CAGTGGGTGGGGTGGGAACCTGG - Intergenic
1190035327 X:47018216-47018238 AAGAAGGAGGTGTGGGAAGAAGG - Intronic
1190950293 X:55136964-55136986 CTGTGGAGGGTGTGGGAAAGAGG + Intronic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1192606492 X:72524517-72524539 CAGTGGGAGGTGCAGAGAAAGGG + Intronic
1192689142 X:73342539-73342561 GAGTGGGTTGTTTGGGAAAAAGG - Intergenic
1193154419 X:78157894-78157916 CACTGGGGAGTGTGGGAAAGCGG - Intergenic
1193554300 X:82933548-82933570 CATTGGCAGGTGTGGGATGAAGG + Intergenic
1193742804 X:85238568-85238590 TAGTGGGAGGTTGGGGGAAATGG + Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194365669 X:93010964-93010986 CAGTAGCAGCAGTGGGAAAATGG + Intergenic
1196807877 X:119605278-119605300 CAGTTGGAGTTGTGGGGGAAGGG - Intronic
1196939225 X:120759429-120759451 AAATGTGAGGTGGGGGAAAAGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198684719 X:139215709-139215731 CTGTCGGTGGTGTGGGGAAAGGG - Intronic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199103679 X:143837393-143837415 CAGTGGGAGCTGTGGACAAGCGG + Intergenic
1199831602 X:151554194-151554216 GATTGGGAGGTGTGAAAAAAAGG + Intergenic
1200140865 X:153902370-153902392 CAGTGGGAGGTGTGCACACAGGG + Intronic
1200987377 Y:9317310-9317332 GAGAGAGAGATGTGGGAAAATGG + Intergenic
1201059160 Y:10028705-10028727 GAGAGAGAGATGTGGGAAAATGG + Intergenic
1201596738 Y:15678894-15678916 CAGTATGAGATGTTGGAAAAGGG + Intergenic
1202129671 Y:21598274-21598296 CAGTCTGAGGTGTGAGAATACGG - Intergenic