ID: 976945384

View in Genome Browser
Species Human (GRCh38)
Location 4:90759554-90759576
Sequence ATGTTGTTATTGTTGCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976945384 Original CRISPR ATGTTGTTATTGTTGCACCA TGG Intronic
902925901 1:19695510-19695532 ATGGTGTTATTTTTGCACACTGG + Intronic
903839279 1:26226643-26226665 AAGTTCTGATGGTTGCACCAGGG + Intergenic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
904306095 1:29591308-29591330 ATGTTGTAAATGTCGCTCCAGGG + Intergenic
904450336 1:30606863-30606885 GTGTTGTAAATGTTGCTCCAGGG - Intergenic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
910814349 1:91274585-91274607 ATGATGTTATTGCTTCACTATGG + Intronic
910905945 1:92178657-92178679 TTGTTGTTATTGTTGAGACAGGG + Intronic
913582596 1:120241431-120241453 ATGTTGCTATTGATTCACCTAGG - Intergenic
913625577 1:120656929-120656951 ATGTTGCTATTGATTCACCTAGG + Intergenic
914564527 1:148852924-148852946 ATGTTGCTATTGATTCACCTAGG - Intronic
914608299 1:149277318-149277340 ATGTTGCTATTGATTCACCTAGG + Intergenic
916968128 1:169975889-169975911 ATGTTGATAATGGTGCAACAGGG - Intronic
918638247 1:186805874-186805896 ATGTTGTTATTCTTTAACCATGG + Intergenic
1065275432 10:24081110-24081132 ATGCTGTGATTTTTACACCATGG + Intronic
1067765625 10:49083803-49083825 ATGGTCTTGTTTTTGCACCATGG + Intronic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1069020275 10:63479227-63479249 TTGTTGGTATTGTTGCATGAAGG - Intergenic
1078528300 11:12117403-12117425 ATGTTGGTACTGCTGCAGCAAGG - Intronic
1078872686 11:15363587-15363609 ATGTTTTTATTGTTCCAAAATGG - Intergenic
1079714326 11:23725625-23725647 TTGTTGTTGTTTTTGCAACAGGG - Intergenic
1080756847 11:35208704-35208726 TTGTTGTTGTTGTTGTTCCAGGG - Intronic
1081474119 11:43408679-43408701 TTATTCTTATTGTAGCACCATGG - Intronic
1083689991 11:64401870-64401892 ATGTTGTTGTTGCTTCTCCATGG + Intergenic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1086506970 11:87515315-87515337 ATTTTGTTTTTGTTGGACCATGG + Intergenic
1087249220 11:95877442-95877464 TTTTTGTTATTGTTGAATCATGG - Intronic
1090635516 11:128688372-128688394 AAGTTTGTATTGTTGCACAAAGG + Intronic
1092586861 12:9909299-9909321 ATGTTGTTATTGTCCCACCAGGG + Intronic
1092819592 12:12340985-12341007 ATGTGGTTATTGCTGCAAAATGG - Intronic
1097461912 12:59872659-59872681 ATGTTGTTTTTGTTTCAACTTGG - Intergenic
1098511127 12:71315255-71315277 ATTTTGTTTTCATTGCACCAGGG - Intronic
1098578256 12:72069463-72069485 ATATTGTCATTTTTACACCAAGG - Intronic
1099127801 12:78787691-78787713 ATGTAGTTATTATTGCCCCATGG + Intergenic
1100268121 12:92997961-92997983 ATGTATTTTTTGTTTCACCAAGG - Intergenic
1106063221 13:26316351-26316373 CTGTTGTTGTTGTTGCGACAGGG - Intronic
1106738893 13:32617871-32617893 ATTTTGTTATAGCAGCACCATGG - Intronic
1108914102 13:55587400-55587422 ATTTTGTTATTGTATCACTAGGG + Intergenic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1112421673 13:99256800-99256822 CTGTTGTTGGTGTTGCATCATGG - Intronic
1114329203 14:21619047-21619069 CTGATGCTACTGTTGCACCATGG - Intergenic
1114957347 14:27840066-27840088 ATGTTATTATTGTTACATTAGGG - Intergenic
1115474892 14:33803403-33803425 TTTTTGTTATTATTCCACCACGG - Intronic
1117107185 14:52409945-52409967 ATGTTGATACTGTTGGTCCATGG - Intergenic
1120098421 14:80416067-80416089 TTGTTGTTATTGTTGTAATAAGG + Intergenic
1123709866 15:22979848-22979870 AGATTGTTAATGTTGCACTAAGG - Intronic
1124820557 15:33041841-33041863 ATGTTCATATTGTTGTACAATGG - Intronic
1125210755 15:37212526-37212548 TTGTTGTTGTTGTTGCTGCATGG + Intergenic
1125306256 15:38319278-38319300 TTGTTGTTGTTGTTGCAAAATGG + Intronic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1130983313 15:88827928-88827950 ATGCTCTTTCTGTTGCACCAGGG + Intronic
1137771868 16:51022926-51022948 CTGTTGTTGTTGTTTCACCTTGG + Intergenic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1138744723 16:59349692-59349714 ATTTTGTTATTGTATCATCAGGG - Intergenic
1139068950 16:63356418-63356440 ATGTAGATATTGATGGACCAGGG + Intergenic
1140352144 16:74272416-74272438 TTGTTGTTATTGTTGAGACAGGG - Intergenic
1140423196 16:74837703-74837725 ATGTTGTTATTTTTGAGACAGGG - Intergenic
1140595365 16:76402984-76403006 ATGTTGTTATCATTGCTACATGG - Intronic
1141336069 16:83156553-83156575 TTGTTGTGGTTGTTGCACAAAGG + Intronic
1145092430 17:19997012-19997034 ATGTTTCTAATGTTTCACCATGG + Intergenic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1150017242 17:61570492-61570514 TTGTTGTTGTTGTTGCTGCAAGG + Intergenic
1150365824 17:64583255-64583277 ATGCTGTCATTGTAGCTCCAGGG - Intronic
1156628636 18:38940791-38940813 ATATTGTTATTTTTTCAACAAGG - Intergenic
1157155173 18:45258352-45258374 ATGTTTTCACTGTTGCAACAGGG - Intronic
1157465304 18:47938884-47938906 ATGTTGTCTTTGAGGCACCAGGG + Intergenic
1162314310 19:9928494-9928516 AGGTTGTTCTTGTTGCTCCTGGG - Intronic
1164704283 19:30308522-30308544 ATCTTGGTTTTGTTGCTCCAGGG + Intronic
926559056 2:14395109-14395131 TTGTGGTTATGGTTGCAGCAGGG - Intergenic
926641040 2:15237349-15237371 ATGTTGTTTTTGAGACACCAAGG + Intronic
928651588 2:33409812-33409834 ATGGTTTTAATTTTGCACCAAGG - Intergenic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
929187834 2:39113526-39113548 ATTTATTTATTTTTGCACCATGG - Intronic
933390024 2:81656544-81656566 GTGTTGTTATTGTCACACCGAGG + Intergenic
933586666 2:84186733-84186755 ATTTTGTTATTGTTATATCAAGG - Intergenic
934479935 2:94627788-94627810 ATGTTATTATTGTTACATTAGGG + Intergenic
935047982 2:99498832-99498854 GCGTTGTTATTGTCCCACCAGGG - Intergenic
935091578 2:99899977-99899999 AAGTGGTTATTGGTGCAGCATGG - Intronic
936021776 2:109000666-109000688 ATGTTGTTATTATCTCTCCAAGG - Intergenic
938763137 2:134443023-134443045 CTGTTGTTATTTGTGCACCATGG + Intronic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939537399 2:143448730-143448752 ATATTGTCATTGTTGGTCCATGG - Intronic
940063673 2:149601475-149601497 TTGTTGTTATTGTTTCATCTTGG + Intergenic
941174043 2:162175304-162175326 ATCTTGTTTTTGTTCCAGCATGG - Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
943819355 2:192300301-192300323 TTGTTGTTATTGTTGCTTAATGG + Intergenic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946951177 2:224877042-224877064 ATGTTCTTATTGCTGCCACAAGG + Intronic
1170870219 20:20199254-20199276 TTGTTGTTGTTGTTGAACAAAGG + Intronic
1173919651 20:46734116-46734138 ATGAAGTCTTTGTTGCACCATGG + Exonic
1174758260 20:53181299-53181321 ATGTTGTTCTTTTTTCACAAAGG + Intronic
1177014749 21:15772483-15772505 ATGTTTTTAGTGTTTTACCAAGG + Intronic
1177246921 21:18538240-18538262 ATTTTTTTGTTGTTGCAACAGGG + Intergenic
1179157302 21:38861817-38861839 ATGTTGTTATTTTGTCATCAAGG + Intergenic
1184788130 22:46681707-46681729 ATGATTTTATTCTTGAACCAGGG + Intergenic
950846685 3:16022203-16022225 GTGTTGTTATTGTCCCACCTGGG + Intergenic
953394402 3:42555825-42555847 ATGTGATTTTTGTTCCACCAAGG - Intronic
954443184 3:50532915-50532937 ATGATGCCTTTGTTGCACCAGGG + Intergenic
954591373 3:51786426-51786448 GTCATGTGATTGTTGCACCAGGG + Intergenic
955556417 3:60142500-60142522 TTGTTGTTATTGTTTTACAAAGG + Intronic
959550506 3:107650439-107650461 ATGTTTTTTTTTTAGCACCAGGG - Intronic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961027577 3:123572732-123572754 TTGTTGTTATTGTTTTACCTTGG - Intronic
964454900 3:156852634-156852656 ATGTCGTAATTATTGCTCCAAGG + Intronic
964501366 3:157351733-157351755 ATGTTGATGTTGTTGGTCCATGG + Intronic
964956759 3:162368446-162368468 AAGTAGTTTCTGTTGCACCATGG + Intergenic
965341868 3:167501381-167501403 ATGTTGTTATTGTTATACCTTGG - Intronic
967669195 3:192212005-192212027 ATGTTGTTCAAGTTGCACAATGG - Intronic
969067097 4:4494634-4494656 ATATTGTTATTTTTGCATCAGGG - Intronic
969940127 4:10723664-10723686 ATGTTGTTATTACCGCACAAGGG - Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
974932947 4:68380763-68380785 ATTTTGATATTTTTCCACCATGG + Intergenic
975074082 4:70182912-70182934 ATGCTATTATTGGTGCACTAGGG - Intergenic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
977820542 4:101467132-101467154 ATGTTGTTATTCTTTCAAAATGG + Intronic
978014011 4:103721485-103721507 TTGTTGTTGTTGTTGCGACATGG + Intergenic
978858189 4:113417412-113417434 TTGTTGTTGTTGTTGTACCTAGG + Intergenic
979305658 4:119140018-119140040 CTGTTGTTAATGTGGTACCAGGG + Intronic
979916833 4:126445721-126445743 ATGTTTCTGTTGTTGCATCATGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980616507 4:135233243-135233265 ATGTTGTTATTATTATACCTTGG + Intergenic
981726661 4:147854852-147854874 ATGTTGTTATTGTTGTTTCTTGG + Intronic
982472462 4:155809518-155809540 ATATTGTTATAGTTGAATCATGG + Intergenic
987300882 5:16597444-16597466 ATGTGCTTTTTGTGGCACCAAGG - Intronic
987373361 5:17213164-17213186 ATGTTCCTAATGTAGCACCAAGG + Intronic
990507673 5:56460593-56460615 ATCTTGTTCTTTCTGCACCAAGG - Intronic
991733447 5:69610605-69610627 TTATTGTCATTGTTGGACCATGG + Intergenic
991809882 5:70465751-70465773 TTATTGTCATTGTTGGACCATGG + Intergenic
991861506 5:71017245-71017267 TTATTGTCATTGTTGGACCATGG - Intronic
993747102 5:91614118-91614140 ATGTTGTTATAATTGCCCCTAGG + Intergenic
994148924 5:96425745-96425767 ATGTTGTTACATTTGCAACATGG - Intronic
994351762 5:98753830-98753852 ATGCTGTTGCTGTTGGACCAGGG + Intergenic
996963411 5:129278977-129278999 ATGTTTTTGTTGTTGTACTAAGG + Intergenic
999003624 5:147951667-147951689 ATGCTGTTATTGTGACAACAAGG - Intergenic
999516295 5:152304936-152304958 ATTTTGTTGTTGTTGAACCCAGG + Intergenic
1002684514 5:180997723-180997745 GAGTTGTGAGTGTTGCACCATGG - Intronic
1003246890 6:4389556-4389578 CTTTTGTTATTGTTCCATCAGGG - Intergenic
1004680296 6:17887340-17887362 AGGTTGTTACTGTTGCATCACGG + Intronic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1010151758 6:72740964-72740986 ATGGTGTTACTTTGGCACCAAGG - Intronic
1011164587 6:84431838-84431860 ATGTTCTTATTGTTGTTCAAAGG - Intergenic
1014941734 6:127448482-127448504 ATGTTCTTATTGTCACCCCATGG - Intronic
1016578098 6:145594075-145594097 ATGTTGTTATTACTGATCCATGG + Intronic
1023723800 7:43121249-43121271 TTGTTGTTATTGTTGCTGCCAGG + Intronic
1023798381 7:43812247-43812269 GCGTTGTTATTGTCCCACCAGGG - Intergenic
1024962180 7:54989105-54989127 TTGTTGTTGTTGTTGCCCCAAGG + Intergenic
1025602162 7:63011264-63011286 ATTTATTTATTGTTGCACGAGGG + Intergenic
1026545036 7:71314911-71314933 ATGTTGTTTTTGTTGCAGACAGG - Intronic
1027858989 7:83551289-83551311 ATTTTGTTATTTTTCCAACATGG - Intronic
1027979056 7:85193831-85193853 TTGTTGTTATTGTTGAAAGATGG - Intergenic
1030672702 7:112354474-112354496 ATCCTGTTATTGTGGCAACATGG - Intergenic
1031894846 7:127337067-127337089 TTGTTGTTATTGTTGAGACAGGG + Intergenic
1033260777 7:139842408-139842430 TTGTTGTTATTATGGCACTAGGG - Intronic
1036104956 8:5829070-5829092 AGGTTGTTATTGTCCCACCGAGG + Intergenic
1039709793 8:40044064-40044086 ATGTGGTTATTCATGGACCATGG - Intergenic
1040682957 8:49835920-49835942 ATCTTGTTATTGAAACACCAGGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG + Intergenic
1042167854 8:65963617-65963639 TTGTTATTATTCTTGCACAAAGG + Intergenic
1044865899 8:96570980-96571002 ATGTGGTAATGGTTGCACAACGG + Intronic
1048148617 8:131870531-131870553 AGGTTTTTATTGTTAAACCATGG + Intergenic
1048241641 8:132748340-132748362 ATTTTGTTAATGTTACACCAGGG + Intronic
1048357262 8:133663805-133663827 ATGTTGTTCTGGTTGAATCATGG + Intergenic
1048358117 8:133670263-133670285 TAGTTGTCATAGTTGCACCATGG - Intergenic
1052189661 9:25644922-25644944 ATGTTCTAATTTTTTCACCATGG - Intergenic
1052365502 9:27607872-27607894 GTGTTGTTATTTTTGAATCATGG - Intergenic
1052512324 9:29437774-29437796 ATGTTTTTCTTCTTGCATCAGGG + Intergenic
1053677906 9:40456012-40456034 ATGTTATTATTGTTACATTAGGG - Intergenic
1053927821 9:43083843-43083865 ATGTTATTATTGTTACATTAGGG - Intergenic
1054285823 9:63168943-63168965 ATGTTATTATTGTTACATTAGGG + Intergenic
1054290979 9:63291538-63291560 ATGTTATTATTGTTACATTAGGG - Intergenic
1054389000 9:64596085-64596107 ATGTTATTATTGTTACATTAGGG - Intergenic
1054506718 9:65920286-65920308 ATGTTATTATTGTTACATTAGGG + Intergenic
1054838501 9:69707518-69707540 ATGTGATTATTTTTGCTCCAAGG + Intergenic
1055077937 9:72236542-72236564 TTGTTGTTTTTGCTGCAACAGGG - Intronic
1055570885 9:77615935-77615957 TTGTTGTTGTTGTTGCATTATGG + Intronic
1057750147 9:97786159-97786181 ATGTTGATATTATTGAAGCAAGG + Intergenic
1058729649 9:107837422-107837444 ATGTTTTCATTGTTTCTCCATGG - Intergenic
1059136774 9:111814683-111814705 ATTTTGTTATTGTTGTTCCTTGG + Intergenic
1059870615 9:118570026-118570048 AGATTGTTAATGTTGCCCCATGG - Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1190490809 X:50981078-50981100 ATGTTGTTATTTGTAAACCACGG + Intergenic
1190499900 X:51064122-51064144 TTGTTGTTTTTGTTGCATCCTGG - Intergenic
1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG + Intergenic
1193966462 X:87992971-87992993 TTGTTGTTGTTGTTGTTCCATGG + Intergenic
1194086523 X:89534934-89534956 TTGTTGTTGTTGTTGTACCCCGG + Intergenic
1194406355 X:93500677-93500699 TTGTTGTTATTGTTGTATCTTGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1197456441 X:126681898-126681920 TTTGAGTTATTGTTGCACCATGG + Intergenic
1197618137 X:128717308-128717330 ATGTTCTTATTTTTACACCCAGG - Intergenic
1199683892 X:150247712-150247734 ATGTTGTTAGGCTTGCACAATGG + Intergenic
1202079848 Y:21073103-21073125 ATTTTTTTATTGTTCCATCACGG + Intergenic
1202254650 Y:22908566-22908588 GTATTGTTATTCTTTCACCAGGG + Intergenic
1202407641 Y:24542315-24542337 GTATTGTTATTCTTTCACCAGGG + Intergenic
1202463140 Y:25127766-25127788 GTATTGTTATTCTTTCACCAGGG - Intergenic