ID: 976949399

View in Genome Browser
Species Human (GRCh38)
Location 4:90810772-90810794
Sequence GGCCAAGTGGCACACCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976949399 Original CRISPR GGCCAAGTGGCACACCCCTT TGG (reversed) Intronic
900670327 1:3849400-3849422 GGCACAGTGGCACACACCTGTGG - Intronic
901073049 1:6533033-6533055 GGCAGAGTGGCACACGCCTGTGG + Intronic
902310927 1:15581086-15581108 GGCGCAGTGGCTCACACCTTGGG + Intronic
903408712 1:23121578-23121600 GGCGTAGTGGCACACACCTGTGG + Intronic
904834118 1:33323968-33323990 GGCCAGGAGGCTCAGCCCTTTGG + Exonic
904836992 1:33344741-33344763 GGCATAGTGGCACACGCCTGTGG - Intronic
905450545 1:38053382-38053404 GCCCAAGTGGGAGACCTCTTAGG + Intergenic
906835548 1:49079817-49079839 TGCCAAGTAGCACCCACCTTGGG + Intronic
907482174 1:54752885-54752907 GCCAAAGTGGCACACTACTTGGG + Intergenic
907649779 1:56284106-56284128 GGCGTAGTGGCACACACCTGTGG + Intergenic
911656196 1:100446835-100446857 GGCAAGGTGGCACACACCTGTGG - Intronic
912352581 1:109028322-109028344 GGCCCAGTGGCACATGCCTGTGG - Intronic
912794347 1:112682361-112682383 GGCATAGTGGCACACGCCTATGG - Intronic
914504724 1:148279006-148279028 GGCACAGTGGCTCACACCTTTGG - Intergenic
914507915 1:148305388-148305410 GGCACAGTGGCTCACGCCTTTGG + Intergenic
914932984 1:151950866-151950888 GGCCAAGGGGGACACCCCGTAGG + Intergenic
915478774 1:156170779-156170801 GGCACAGTGGCACACACCTGTGG + Intronic
917957546 1:180115947-180115969 GGCACAGTGGCACACACCTGTGG + Intergenic
919876834 1:201875448-201875470 GGCATAGTGGCACACCCCCGTGG + Intronic
922318654 1:224464933-224464955 GGCCTAGTGGTACACACCTGTGG - Intronic
922679679 1:227582459-227582481 GGGCAAGTGGCATGCCCCTGTGG - Intronic
923586458 1:235277104-235277126 GGCTCAGTGGCACACGCCTATGG + Intronic
924054669 1:240113422-240113444 GGCATAGTGGCACACGCCTATGG + Intronic
924431176 1:243998134-243998156 GGCCTGGTGGCACACGCCTGTGG - Intergenic
924559783 1:245148327-245148349 GGCACAGTGGCACACACCTGTGG - Intergenic
924745073 1:246824281-246824303 GGGCAGGTGGCTCACGCCTTTGG - Intergenic
924762901 1:247006083-247006105 GGCATAGTGGCACACGCCTGTGG + Intronic
1064141843 10:12797335-12797357 GGCATAGTGGCACACTCCTATGG - Intronic
1064432828 10:15285909-15285931 TGCCCAGTGGCACACACCCTGGG + Intronic
1066498388 10:35965006-35965028 GGCATAGTGGCACACACCTGTGG - Intergenic
1068033861 10:51736030-51736052 GGCATAGTGGCACACACCTGTGG - Intronic
1071615536 10:87072131-87072153 GGCACAGTTGCACACCCCTGTGG + Intronic
1071995464 10:91143855-91143877 GGCCAAGTGGCACACAACTGAGG + Intergenic
1073336765 10:102715321-102715343 GGCACAGTGGCTCACCACTTTGG - Intronic
1073662390 10:105490870-105490892 GGCATGGTGGCACACCCCTGTGG - Intergenic
1074101144 10:110355754-110355776 GCACAAGTTGCTCACCCCTTTGG + Intergenic
1075699165 10:124457608-124457630 GGCACAGTGGCTCACACCTTGGG - Intergenic
1076743026 10:132497449-132497471 GGCCAAGTGGCAGACCCACAGGG + Intergenic
1077616710 11:3680683-3680705 GGCCTGGTGGCACACACCTGTGG - Intronic
1078163448 11:8862472-8862494 GGCACAGTGGCACACACCTGTGG - Intronic
1079221239 11:18562904-18562926 GGTGTAGTGGCACACCCCTGTGG + Intronic
1079357138 11:19739039-19739061 GGCATAGTGGCACACGCCTGTGG + Intronic
1080604061 11:33849605-33849627 GGCCTGGTGGCACACACCTGTGG - Intergenic
1082200224 11:49357722-49357744 GGCCTGGTGGCACACACCTGTGG - Intergenic
1083262289 11:61529772-61529794 GGCGTAGTGGCACGCCCCTGTGG - Intronic
1084360981 11:68668319-68668341 GGCAAAGTGGGTCAGCCCTTTGG + Intergenic
1084391657 11:68881203-68881225 GGCCTGGTGGCACACACCTGTGG + Intergenic
1086655444 11:89348475-89348497 GGCCTGGTGGCACACACCTGTGG + Intronic
1088254002 11:107886014-107886036 GGCGTAGTGGCACACGCCTGTGG - Intronic
1088263676 11:107969801-107969823 GGCATAGTGGCACACACCTCTGG + Intergenic
1089556344 11:119317536-119317558 GCCCAAGTGGGAGGCCCCTTGGG - Intronic
1091775775 12:3183821-3183843 GGTGAAGTGGCACACACCTGAGG - Intronic
1091910790 12:4229177-4229199 GGCAAAGTGGCATACACCTGTGG - Intergenic
1093649858 12:21630455-21630477 GGCATAGTGGCACACACCTGTGG + Intergenic
1097015989 12:55987567-55987589 GTCCCAGTGGCCCACCACTTTGG + Intronic
1097380086 12:58884529-58884551 GGCCAAATGACAAACCCTTTTGG + Intronic
1103374881 12:120447891-120447913 GGCCAAGTGGCACGCGCCTGTGG - Intronic
1103480188 12:121245566-121245588 GGCCAAGTTCCAGACCCCTCTGG - Intronic
1103544277 12:121688647-121688669 GGCATAGTGGCACACGCCTGTGG - Intergenic
1103666843 12:122574596-122574618 GGCGTAGTGGCACACGCCTATGG - Intronic
1103834511 12:123808170-123808192 GGCATAGTGGCACACGCCTGTGG - Intronic
1107250355 13:38352235-38352257 GGCAAGGTGGCACACACCTGTGG - Intronic
1108380877 13:49853098-49853120 GGCCTGGTGGCACACACCTGTGG - Intergenic
1109994691 13:70108014-70108036 GGCGAGGTGGGACAACCCTTAGG + Exonic
1110613818 13:77519504-77519526 GGCAAGGTGGCACACACCTATGG - Intergenic
1110846700 13:80197750-80197772 GGCATAGTGGCACACGCCTGTGG + Intergenic
1112482071 13:99785346-99785368 GGCACAGTGGCACACACCTGTGG - Intronic
1114049557 14:18912300-18912322 GGGCAAGTGGGGCACCCCCTAGG - Intergenic
1114113005 14:19489631-19489653 GGGCAAGTGGGGCACCCCCTAGG + Intergenic
1117741960 14:58827945-58827967 GGCCAAGTGGAACAGCCCCAGGG - Intergenic
1118181335 14:63496202-63496224 GGCCAAGTGGCTCACTCTTGAGG - Intronic
1118632599 14:67719612-67719634 GGCCTGGTGGCACACACCTGTGG - Intronic
1119159711 14:72442778-72442800 GGCCAGGAGGCACACGGCTTGGG - Intronic
1122683848 14:103488713-103488735 GGCATAGTGGCACACTCCTGTGG + Intronic
1122997213 14:105271808-105271830 GGCCAAGCTGCACACCGCTGAGG + Intronic
1122997229 14:105271880-105271902 GGCCAAGCTGCACACCGCTGAGG + Intronic
1122997246 14:105271952-105271974 GGCCAAGCTGCACACCGCTGAGG + Intronic
1122997263 14:105272024-105272046 GGCCAAGCTGCACACCGCTGAGG + Intronic
1122997280 14:105272096-105272118 GGCCAAGCTGCACACCGCTGAGG + Intronic
1122997298 14:105272168-105272190 GGCCAAGCTGCACACCGCTGAGG + Intronic
1123993959 15:25705294-25705316 GGCCTGGTGGCACACGCCTGTGG + Intronic
1125531272 15:40415074-40415096 GGCCAAGAGGCAGCTCCCTTTGG - Intronic
1125921636 15:43528773-43528795 GGCTCAGTGGCACATCCCTGGGG - Exonic
1127786406 15:62359220-62359242 GGCGCAGTGGCTCACGCCTTGGG - Intergenic
1127874803 15:63102957-63102979 GGCGTAGTGGCACACACCTGTGG + Intergenic
1128201108 15:65808889-65808911 GGCATAGTGGCACACACCTGTGG + Intronic
1129873370 15:78956091-78956113 GGCAAGGTGGCACACACCTGTGG + Intergenic
1131812740 15:96189681-96189703 GGCAAGGTGGCACACACCTGTGG - Intergenic
1132893563 16:2216416-2216438 GGCGTAGTGGCACACACCTCTGG - Intergenic
1135228921 16:20686672-20686694 GGCGAGGTGGCACACACCTGTGG + Intronic
1137346574 16:47667293-47667315 GGCCTGGTGGCACATGCCTTTGG + Intronic
1138557168 16:57778138-57778160 GGCACAGTGGCACACGCCTGTGG + Intronic
1139773911 16:69301470-69301492 GGGCAAATGGAACAACCCTTTGG - Exonic
1139810531 16:69612732-69612754 GGCATAGTGGCACACACCTGTGG + Intronic
1142895125 17:2970893-2970915 GGTGAAGTGGCACACACCTGTGG + Intronic
1144569389 17:16386582-16386604 GGCAAAGTGGCGCACGCCTGTGG + Intergenic
1146364871 17:32215044-32215066 GGCAAAGTGGCACATGCCTGTGG - Intronic
1146738901 17:35263681-35263703 GGCTTGGTGGCACACGCCTTTGG + Intronic
1146785565 17:35717827-35717849 GGCAAAATGGAACACACCTTTGG + Intronic
1147546268 17:41404349-41404371 GCACACGTGACACACCCCTTGGG - Intergenic
1147681433 17:42249798-42249820 GGCATAGTGGCACACACCTGTGG - Intronic
1148674670 17:49438490-49438512 GGCCAGGGGGCACGCCCCCTGGG + Intronic
1149756014 17:59186532-59186554 GGGCAGGTGGCACACACCTCTGG - Intronic
1150725596 17:67649012-67649034 GGCCCAGTGGCACATGCCTGTGG + Intronic
1151451841 17:74202889-74202911 GGCTAAGTGTCTCACCCCTAGGG - Intergenic
1152035099 17:77867515-77867537 GGCCAAGTGCCAGACATCTTGGG + Intergenic
1152577182 17:81147614-81147636 GGCATAGTGGCACACACCTGTGG + Intronic
1152896682 17:82915314-82915336 GGAAAAGTGGCTCAACCCTTGGG + Intronic
1154215983 18:12416452-12416474 GGCATGGTGGCACACCCCTGTGG - Intronic
1155087943 18:22475827-22475849 GGCATAGTGGCACACCCCTGTGG + Intergenic
1157823304 18:50789745-50789767 GGCCCAGTGGCACATGCCTATGG - Intergenic
1158366132 18:56738416-56738438 GGCTTAGTGGCACACACCTGTGG + Intronic
1158537415 18:58320673-58320695 GGCATAGTGGCACACACCTGTGG + Intronic
1158933179 18:62340833-62340855 GATCACGTGGCACACCCCATGGG - Intronic
1159048736 18:63396726-63396748 GGCGCAGTGGCTCACGCCTTTGG + Intronic
1159271565 18:66159669-66159691 GGTCAAGTGATTCACCCCTTCGG - Intergenic
1159398939 18:67904518-67904540 GGCCTAGTGGTACACACCTGTGG - Intergenic
1161034670 19:2077921-2077943 GGCATGGTGGCACACGCCTTTGG - Intronic
1161125123 19:2551427-2551449 GGCCATGCGGCACTCACCTTGGG + Intronic
1161913101 19:7209184-7209206 GGCATAGTGGCACACACCTGTGG + Intronic
1161937694 19:7382254-7382276 GGCACAGTGGCACACACCTGTGG + Intronic
1162206039 19:9056828-9056850 GGCATAGTGGCACACACCTGTGG - Intergenic
1164874557 19:31674515-31674537 GCCCCAGTGGCTCTCCCCTTGGG - Intergenic
1165159996 19:33810418-33810440 GGCGCAGTGGCTCACGCCTTGGG + Intronic
1165562327 19:36690450-36690472 GGCGTAGTGGCACGCCCCTGTGG + Intronic
1166208077 19:41286031-41286053 GGCCTGGTGGCACACGCCTGTGG + Intronic
1167207824 19:48114338-48114360 GGCACAGTGGCTCACGCCTTGGG - Intergenic
1168507683 19:56950106-56950128 GGCATGGTGGCACACCCCTGTGG + Intergenic
926229643 2:10992823-10992845 GGACAGGTGGCCCACCCCCTGGG + Intergenic
927166106 2:20323306-20323328 GGCGTAGTGGCACACGCCTGCGG + Intronic
927837907 2:26415790-26415812 GGCCTGGTGGCACACGCCTGGGG + Intronic
928153041 2:28849550-28849572 GGCACAGTGGCTCACGCCTTTGG - Intronic
928512481 2:32014345-32014367 GGCACAGTGGCACACACCTATGG + Intronic
929482067 2:42318842-42318864 GGCAAGGTGGCACACACCTATGG - Intronic
930115646 2:47716133-47716155 GGCCAAGTAGCACAAGCCATTGG - Intronic
930364988 2:50428273-50428295 GGCATAGTGGCACACACCTGTGG + Intronic
930736506 2:54785455-54785477 GGCACAGTGGCTCACACCTTTGG - Intronic
931982072 2:67704523-67704545 GGCCCAGAGGCAGAACCCTTAGG + Intergenic
933739332 2:85520832-85520854 GGCATAGTGGCACACGCCTGGGG + Intergenic
934764092 2:96870536-96870558 GGCCAAACGGCAGACCCCTCTGG - Intronic
935732204 2:106073547-106073569 GGGCAAATGGCCCACCCCTCAGG - Intronic
938426909 2:131200635-131200657 GGGCAAGTGGGGCACCCCCTAGG - Intronic
939131682 2:138242920-138242942 GGCCAAGTGGAAAGCCCATTTGG - Intergenic
942548785 2:177092649-177092671 GGCATAGTGGCACACACCTGTGG - Intergenic
943919597 2:193687338-193687360 GGCCTGGTGGCACACGCCTGTGG + Intergenic
947428199 2:230002950-230002972 GGCACAGTGGCTCACACCTTTGG + Intronic
1170871586 20:20211243-20211265 GGCCACGTGGGGCAGCCCTTTGG - Intronic
1172290966 20:33776524-33776546 GGCCTGGTGGCACACACCTGTGG - Intronic
1173813695 20:45971751-45971773 GGCCCAGTGGTTCAGCCCTTCGG + Intronic
1174044270 20:47722398-47722420 GGCATAGTGGCACACACCTGTGG - Intronic
1174909726 20:54594250-54594272 GGCATAGTGGCACACACCTGTGG + Intronic
1178281052 21:31283333-31283355 GGCCATGTAACACAGCCCTTGGG - Intronic
1179250816 21:39669878-39669900 GGTCAGGTGGCACACTCCTTGGG - Exonic
1179570096 21:42273532-42273554 GGCCGCGTGGCAGAGCCCTTGGG - Intronic
1180200677 21:46222272-46222294 TGCCATGTGGCACACACTTTGGG - Intronic
1180468036 22:15634675-15634697 GGGCAAGTGGGGCACCCCCTAGG - Intergenic
1181157403 22:20932246-20932268 GGCATAGTGGCACACACCTGCGG - Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182230836 22:28836417-28836439 GGCCTCGTGGCACACACCTGTGG + Intergenic
1182332150 22:29558710-29558732 ATCCAAGTGGCACACTCCATAGG - Intronic
1182485608 22:30636831-30636853 GGTCCAGGGGCACAGCCCTTAGG - Exonic
1182648690 22:31832340-31832362 TGCAAAATGGCACACCACTTTGG - Intronic
949094212 3:66545-66567 GGCCACCTGGCACACAACTTCGG + Intergenic
951235735 3:20234696-20234718 GGCATAGTGGCACACACCTGTGG - Intergenic
956042771 3:65163023-65163045 GGCCAAGTGGCATCCTCATTTGG - Intergenic
958940995 3:100314623-100314645 GGCGTAGTGGCACACCCCCGTGG + Intronic
959090549 3:101898080-101898102 GGCAAGGTGGCACACACCTGTGG + Intergenic
959242783 3:103819704-103819726 GGCAAAGTGGCACACCTCTATGG + Intergenic
962574047 3:136739378-136739400 GGCCTGGTGGCACACACCTGTGG + Intronic
962775777 3:138658308-138658330 GGCATAGTGGCACACACCTGTGG + Intronic
963366103 3:144336584-144336606 GGCATAGTGGCACACACCTGTGG + Intergenic
965771834 3:172189672-172189694 GGCATGGTGGCACACGCCTTTGG + Intronic
966029825 3:175332438-175332460 GGCATGGTGGCACATCCCTTTGG - Intronic
969193449 4:5542510-5542532 GGCCAAGAGGCCCATCCCTCTGG + Intergenic
969297871 4:6280252-6280274 GGCCCACTGGCACATCACTTGGG - Intronic
969371726 4:6735692-6735714 GGCCTGGTGGCACACACCTTTGG + Intergenic
969613361 4:8238863-8238885 GGTCAAGGGGCACAGCCCTCTGG + Intronic
970342623 4:15122276-15122298 GGCTAATTGGCCCACCTCTTAGG + Intergenic
971274921 4:25186789-25186811 GGCACAGTGGCACACACCTGTGG - Intronic
971906875 4:32737330-32737352 GGCATAGTGGCACACACCTGTGG - Intergenic
976949399 4:90810772-90810794 GGCCAAGTGGCACACCCCTTTGG - Intronic
977695826 4:99964478-99964500 GGCAAAGTGGCTCCCGCCTTAGG + Intergenic
980904520 4:138934360-138934382 GGCAAGGTGGCACACGCCTGTGG + Intergenic
982321343 4:154080559-154080581 GGCATGGTGGCACACCCCTGTGG - Intergenic
983209118 4:164940795-164940817 GGCATAGTGGCACACACCTGTGG + Intergenic
988593772 5:32572165-32572187 GGCGCAGTGGCTCACGCCTTTGG + Intronic
992042832 5:72853300-72853322 GGCATAGTGGCACACACCTGTGG + Intronic
994289868 5:98015710-98015732 GGCCCAGTGGCTCACACCTGTGG - Intergenic
997537554 5:134634287-134634309 GGCCTGGTGGCACACGCCTGTGG - Intronic
998963519 5:147512537-147512559 GGCATGGTGGCACACCCCTGTGG - Intergenic
999448490 5:151660327-151660349 GGCCTGGTGGCACACACCTGAGG + Intergenic
999955866 5:156700801-156700823 GGTGTAGTGGCACACCCCTGTGG + Intronic
1001709013 5:173762937-173762959 GGCATGGTGGCACACCCCTGTGG + Intergenic
1002015533 5:176318967-176318989 GGCTTAGTGGCACACACCTGTGG + Intronic
1003097335 6:3152890-3152912 GGCGAAGTGGCACACATCTGTGG + Exonic
1006842997 6:37042621-37042643 GGCCTGGTGGCACACACCTGTGG + Intergenic
1010744639 6:79546952-79546974 GGCCCAGTGGCTCACGCCTGTGG - Intergenic
1011579697 6:88846618-88846640 GGCGTAGTGGCACACGCCTGTGG + Intronic
1012293357 6:97487572-97487594 CGCAAAATGGCACAGCCCTTTGG - Intergenic
1012768598 6:103400264-103400286 GGCATAGTGGCACACACCTGTGG - Intergenic
1016416582 6:143840532-143840554 GGCATAGTGGCACACACCTGTGG + Intronic
1016797747 6:148135898-148135920 GGCAAAGTGGCACACACCTATGG + Intergenic
1016918755 6:149270027-149270049 TGCAAAATGGCACAGCCCTTTGG - Intronic
1019554281 7:1620914-1620936 CGCCAAGTGGCACGTCCCTTTGG - Intergenic
1019566392 7:1681621-1681643 GGCACAGTGGCACACACTTTGGG - Intergenic
1020251828 7:6475285-6475307 GGCAAGGTGGCACACACCTGTGG + Intronic
1022006245 7:26268109-26268131 GGCGTAGTGGCACACACCTGTGG + Intergenic
1024310137 7:47961628-47961650 GGCGCAGTGGCACACACCTGTGG + Intronic
1026686188 7:72512141-72512163 GGCATGGTGGCACACCCCTGTGG + Intergenic
1028171890 7:87607689-87607711 GGCAAGGTGGCGCACACCTTTGG - Intronic
1031620228 7:123926544-123926566 GGCCCCGTGACACAGCCCTTAGG + Intronic
1032406668 7:131660929-131660951 GGCATAGTGGCACACACCTATGG - Intergenic
1033393537 7:140951416-140951438 GGCATGGTGGCACACACCTTTGG + Intergenic
1035402353 7:158575502-158575524 GGCCTGGTGGCACACACCTGTGG - Intronic
1037330323 8:17737625-17737647 GGGCAAGTGGCACACACTTGTGG - Intronic
1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG + Intronic
1038151513 8:24945049-24945071 GGCCAATTGACAAACCCATTGGG + Intergenic
1042371997 8:68002451-68002473 GGCACAGTGGCTCACGCCTTTGG - Intronic
1043980871 8:86637654-86637676 GTACAAGTCTCACACCCCTTTGG + Intronic
1045124463 8:99073908-99073930 GGCCTGGTGGCACACACCTGTGG - Intronic
1045787421 8:105938467-105938489 GGCCAGGTGGCTCACACCTGTGG - Intergenic
1048565613 8:135593615-135593637 GGCAAAGTGGCACACACATGTGG - Intronic
1050310019 9:4343200-4343222 GGCACGGTGGCACACCCCTGTGG + Intronic
1053232006 9:36418166-36418188 GGCCTAGTGGTACACACCTGTGG - Intronic
1056181763 9:84090649-84090671 GGCACAGTGGCACACACCTGTGG + Intergenic
1057358060 9:94348120-94348142 GCCCAAGTGACACACCGATTTGG + Intergenic
1057406315 9:94774026-94774048 GGCACAGTGGCTCACACCTTTGG - Intronic
1057649689 9:96909497-96909519 GCCCAAGTGACACACCGATTTGG - Intronic
1059211917 9:112521350-112521372 GGCATAGTGGCACACACCTGTGG - Intronic
1062519615 9:136952203-136952225 GGCAGAGGGGCACACCCCCTTGG + Intronic
1185890447 X:3817161-3817183 GGCATAGTGGCACACACCTGTGG - Intergenic
1186793174 X:13018624-13018646 GGCCCAGTGGCTCACGCCTGTGG - Intergenic
1188022180 X:25171192-25171214 GGATAAGTGTGACACCCCTTGGG - Intergenic
1189994680 X:46627172-46627194 GGTGAAGTGGCACACACCTGTGG + Intronic
1190545511 X:51522416-51522438 GGCATAGTGGCACATGCCTTTGG - Intergenic
1190642580 X:52495131-52495153 GACCAAGTGGCACAACCCACAGG - Intergenic
1190645093 X:52517736-52517758 GACCAAGTGGCACAACCCACAGG + Intronic
1190681524 X:52830606-52830628 GACCAAGTGGCCCAACCCATGGG + Intergenic
1191646616 X:63488441-63488463 GACCTAGTGGGACACCTCTTGGG + Intergenic
1192176855 X:68891835-68891857 GGCCTAGAGGCCCAGCCCTTAGG + Intergenic
1192370232 X:70506897-70506919 GGCCTGGTGGCACACGCCTGGGG - Intergenic
1193129321 X:77903163-77903185 GGCCTGGTGGCACACACCTGTGG - Intronic
1194069968 X:89310461-89310483 GGCACAGTGGCACATCCCTGTGG - Intergenic
1196685315 X:118505550-118505572 AGCCATGTGGCTCACCCCTTTGG - Intronic
1199769989 X:150969133-150969155 GGCCCAAGGGCACTCCCCTTTGG - Intergenic
1200724208 Y:6646096-6646118 GGCACAGTGGCACATCCCTGTGG - Intergenic