ID: 976958513

View in Genome Browser
Species Human (GRCh38)
Location 4:90935677-90935699
Sequence TTCCCAACCCAATTTAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976958513_976958517 27 Left 976958513 4:90935677-90935699 CCAGGACTAAATTGGGTTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 147
Right 976958517 4:90935727-90935749 CATCTGAAGAAATTTGAACAAGG No data
976958513_976958515 2 Left 976958513 4:90935677-90935699 CCAGGACTAAATTGGGTTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 147
Right 976958515 4:90935702-90935724 CCAGCAGTAACATGTATTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 127
976958513_976958516 3 Left 976958513 4:90935677-90935699 CCAGGACTAAATTGGGTTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 147
Right 976958516 4:90935703-90935725 CAGCAGTAACATGTATTTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976958513 Original CRISPR TTCCCAACCCAATTTAGTCC TGG (reversed) Intronic
900992665 1:6105027-6105049 TTCCAGACCCAAGGTAGTCCTGG - Exonic
902417592 1:16250531-16250553 TTCCCAACCGAAGTCACTCCAGG - Exonic
903691180 1:25174739-25174761 TCCACAGCCCAATTTACTCCAGG - Intergenic
904655716 1:32045356-32045378 TTCACTACCCATTCTAGTCCAGG - Intronic
906910036 1:49938359-49938381 TTACCAACCAAAAATAGTCCAGG + Intronic
907610214 1:55861595-55861617 TTCCCAAGTCAATTTAGTTGAGG + Intergenic
914996794 1:152550420-152550442 TTACCAACCCAAAAAAGTCCAGG - Intronic
915003492 1:152614952-152614974 TTACCAACCCAAAAAAGTCCAGG + Intergenic
915011815 1:152694383-152694405 TTACCAACCCAAAAAAGTCCAGG + Intergenic
915955099 1:160214419-160214441 TCCCCACCCCAATTCAATCCCGG + Exonic
918823978 1:189298248-189298270 TTACCAACCAAATACAGTCCAGG - Intergenic
920871666 1:209800001-209800023 TTCCCAACCCAATTTCAGCAAGG + Intronic
922908095 1:229191370-229191392 TTCTCATCCCAGTTTGGTCCTGG + Intergenic
924012303 1:239678683-239678705 TCCCCTCCCCAAATTAGTCCAGG + Intronic
1065157865 10:22889142-22889164 TTCCCAACCAAAAAAAGTCCAGG + Intergenic
1065257939 10:23893119-23893141 TTACCAACCAAATAGAGTCCAGG - Intronic
1066168417 10:32814792-32814814 TACACAACTGAATTTAGTCCTGG + Intronic
1066573074 10:36794068-36794090 TTTCCTACCCAATTTAGAACTGG - Intergenic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067752918 10:48983760-48983782 GTCCCCACCTAATTTAGCCCAGG + Intergenic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1074851384 10:117442180-117442202 TTCCCAAGGGAATTTATTCCTGG - Intergenic
1075589242 10:123679574-123679596 ATCCCAACCCATTTTACTGCTGG + Intronic
1078837431 11:15044418-15044440 TTCCAAATCCTATTTAGTCAGGG + Intronic
1079076177 11:17386696-17386718 CTCCCAACCCAATTCAGGACTGG - Exonic
1080580518 11:33639120-33639142 ATTCCAAAACAATTTAGTCCTGG - Intronic
1082124165 11:48412682-48412704 TTACCAACCAAAAATAGTCCAGG - Intergenic
1082575733 11:54801120-54801142 TTACCAACCAAATAAAGTCCAGG + Intergenic
1083347975 11:62006829-62006851 TGCCCAGGCCAATGTAGTCCAGG + Intergenic
1083513424 11:63233262-63233284 TTACCAACCAAAATAAGTCCAGG - Intronic
1086149313 11:83591004-83591026 TTACCAACCCAAAAGAGTCCAGG + Intronic
1087410223 11:97782084-97782106 TTACCAACCAAAAATAGTCCTGG - Intergenic
1089362368 11:117899455-117899477 TTCCCAGCCCAATTTTGTCTAGG + Intergenic
1090475685 11:127018082-127018104 TTCCTAAAGCAATTTAGTCAGGG + Intergenic
1091643881 12:2258618-2258640 TTCCCAACCAGATTTAATCCAGG + Intronic
1091998158 12:5011365-5011387 TTCCCTTCCCAATTCAGTTCAGG + Intergenic
1092641576 12:10517239-10517261 TTACCAACCAAAAATAGTCCAGG - Intronic
1095483106 12:42655998-42656020 TTACCAACCCAAAAAAGTCCAGG - Intergenic
1098270205 12:68762517-68762539 ACCCCAACCCACTTTACTCCAGG - Intronic
1098659887 12:73078895-73078917 TTCCCAACACAATTTATTAAAGG - Intergenic
1110841983 13:80153771-80153793 TTACCAACCAAAAATAGTCCAGG + Intergenic
1111498984 13:89091262-89091284 TTACCAACCAAAATGAGTCCAGG + Intergenic
1111565328 13:90006783-90006805 TTCCCAACCGAATTTCCTCATGG + Intergenic
1112494515 13:99894524-99894546 TTCCCAACTCAGTCTTGTCCCGG - Exonic
1114930568 14:27462411-27462433 TTACCAACCAAAAATAGTCCAGG + Intergenic
1114945576 14:27676440-27676462 TTCCCAACCAAAAAGAGTCCAGG + Intergenic
1116872045 14:50077350-50077372 TTACCAACCCAAAAAAGTCCAGG + Intergenic
1117344161 14:54816679-54816701 ATCCCAACCCTATGTAGGCCTGG + Intergenic
1120608657 14:86611106-86611128 TTACCAACCAAATAAAGTCCAGG - Intergenic
1129426613 15:75468054-75468076 TCACCAACCCAAGCTAGTCCAGG + Exonic
1132504638 16:301412-301434 TTCCCCACCCCATGGAGTCCTGG - Intronic
1134599864 16:15524935-15524957 CTCCCAACCCAATGGAGTCTAGG - Intronic
1134600946 16:15533170-15533192 TTCCAAACTCAATTTCTTCCTGG - Intronic
1137347727 16:47680397-47680419 TTACCAACCAAAAATAGTCCAGG - Intronic
1145397440 17:22506707-22506729 TTCCCAGGCCTCTTTAGTCCAGG - Intergenic
1146008799 17:29178727-29178749 TTCCCCACCCTTTTTAGTTCAGG - Intronic
1151002748 17:70397708-70397730 TTCCCAACCTAAGTTTTTCCAGG + Intergenic
1151908420 17:77065023-77065045 TTCCCAACCCATTTTAGCCATGG + Intergenic
1152417843 17:80174646-80174668 TTCCCACCGTAGTTTAGTCCTGG + Intronic
1153355450 18:4129691-4129713 TACCCACGCCAATTTAGTACTGG + Intronic
1156062911 18:33102755-33102777 TTCCCAAACTAATTTAATCTTGG + Intronic
1159126351 18:64229012-64229034 TTACCAACCCAAAAAAGTCCAGG - Intergenic
925109808 2:1323920-1323942 TCCCCAACCCAGGTTAGTCAGGG + Intronic
926198288 2:10776608-10776630 TTCCCAGCTCGATTCAGTCCTGG + Intronic
927207260 2:20618435-20618457 TCCCCAAGCCAAATTACTCCAGG - Exonic
928793643 2:34990274-34990296 TGCCCCACCCATTTTATTCCTGG - Intergenic
933050523 2:77596195-77596217 TTACCAACCAAATAGAGTCCAGG + Intergenic
934141072 2:89048250-89048272 TTTCAAACCCAATTTATTCAAGG + Intergenic
934228162 2:90152292-90152314 TTTCAAACCCAATTTATTCAAGG - Intergenic
935548647 2:104428032-104428054 TTCCCAAAACAAATTATTCCAGG + Intergenic
939594537 2:144107617-144107639 TTACCAACCCAAAAAAGTCCAGG + Intronic
941272638 2:163449863-163449885 TTCACAACCGAATTTGGTGCTGG - Intergenic
943303709 2:186233813-186233835 TTCCCAACCAAAAAAAGTCCAGG + Intergenic
943792146 2:191945169-191945191 TTCCAAGCCAAATTTAATCCAGG - Intergenic
945030461 2:205658486-205658508 TTCCTAACACCATGTAGTCCTGG + Intergenic
946205015 2:218098817-218098839 TTGCCAACCCAAAAAAGTCCAGG - Intergenic
1170847894 20:19977297-19977319 GAACCAACCCAAGTTAGTCCCGG + Intronic
1172041366 20:32048603-32048625 TTCAAAAACCAATTTAGACCAGG + Intergenic
1172353310 20:34260681-34260703 TTCCCAAACCAAATGAGTCAAGG - Intronic
1182412500 22:30199106-30199128 TCCCCAACCTAATTTTGTTCTGG + Intergenic
949437859 3:4048834-4048856 TTACCAACCTAATTTATTTCTGG + Intronic
949457689 3:4256629-4256651 TTACCAACCAAATAGAGTCCAGG + Intronic
949458756 3:4267353-4267375 TTACCAACCAAATAGAGTCCAGG - Intronic
951695094 3:25438063-25438085 TTGCCAGCCCAATTTAGCCATGG - Intronic
951746150 3:25980022-25980044 TTCCCAACCAAATTTTGCCTTGG + Intergenic
952602967 3:35107290-35107312 TTACCAACCAAAAATAGTCCAGG + Intergenic
957942288 3:87020581-87020603 TTACCAACCAAATAAAGTCCAGG + Intergenic
958407791 3:93770316-93770338 TTACCAACCAAAAATAGTCCAGG + Intergenic
958409957 3:93804015-93804037 TTACCAACCAAAAATAGTCCAGG - Intergenic
959043968 3:101451229-101451251 TTACCAACCCAAAAAAGTCCAGG + Intronic
959369860 3:105509925-105509947 ATCCCACCCCAATTTAGTAAGGG - Intronic
959618307 3:108372841-108372863 TTACCAACCAAAAATAGTCCAGG + Intronic
964539725 3:157766551-157766573 ATTACAACCCAATTGAGTCCTGG + Intergenic
966063156 3:175784331-175784353 TTACCAACCAAAAATAGTCCAGG - Intronic
966293578 3:178389768-178389790 TTCACAAGCAAATTTAGCCCAGG - Intergenic
968272337 3:197413411-197413433 TTACCAACCAAAATAAGTCCGGG + Intergenic
971179170 4:24311901-24311923 TTCCCAACCCTATTTTATCTGGG - Intergenic
971433302 4:26591851-26591873 TTACCAACCAAAAATAGTCCAGG + Intronic
971492778 4:27231507-27231529 TTACCAACCAAAAATAGTCCAGG - Intergenic
971678439 4:29666436-29666458 TTTCCAACCCAATTCAATTCTGG + Intergenic
972416080 4:38842111-38842133 TCCCCAACCCAATTTGGGCAAGG + Intronic
974759522 4:66256899-66256921 TTCCCAACCCAAAAGAGTCCAGG - Intergenic
975088783 4:70376007-70376029 TTACCAACCCAAAAAAGTCCAGG + Intronic
976911129 4:90307480-90307502 TTCCCAAACCAAACTTGTCCTGG + Intronic
976958513 4:90935677-90935699 TTCCCAACCCAATTTAGTCCTGG - Intronic
978055227 4:104255430-104255452 CTCCCAACCAAATAAAGTCCAGG + Intergenic
982239945 4:153289798-153289820 TTCCCAAACCAATCTAGCCTGGG - Intronic
983812689 4:172082778-172082800 TCCTCAACCCAACCTAGTCCAGG - Intronic
989718189 5:44491395-44491417 TTTGCAACCCATATTAGTCCTGG - Intergenic
989804143 5:45583153-45583175 TTACCAACCAAATAAAGTCCAGG - Intronic
994602285 5:101922170-101922192 TTCCCAACCAAAAAGAGTCCAGG + Intergenic
995746615 5:115411081-115411103 TTCCCAACCAAAAAGAGTCCAGG + Intergenic
998711095 5:144825973-144825995 TTACCAACCAAATAAAGTCCAGG - Intergenic
1000173771 5:158729677-158729699 TTTCCACCCCAATTTATTCTTGG - Intronic
1000576923 5:162986542-162986564 TTACCAACCCATTTTTGTCAAGG - Intergenic
1001640911 5:173243759-173243781 TTCCCAACCCGAATTTGTCCTGG + Intergenic
1005846418 6:29783256-29783278 TTACCAACCAAAAATAGTCCAGG + Intergenic
1008504896 6:52220118-52220140 TTCCCAACCCCAGTATGTCCAGG + Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1014475130 6:121862663-121862685 CTACCAACCAAATATAGTCCAGG - Intergenic
1019990305 7:4685628-4685650 TACCTAACCAAATGTAGTCCAGG - Intronic
1021095156 7:16527220-16527242 TTCACATCCCAATTTTGTGCTGG - Intronic
1021710600 7:23412352-23412374 TTCCCAGATCAATTAAGTCCAGG + Intronic
1023580841 7:41681098-41681120 TTCCCTACCCTATTTTCTCCTGG + Intergenic
1025520481 7:61723578-61723600 TTCCCAACCAAAAACAGTCCAGG + Intergenic
1025544801 7:62152233-62152255 TTCCCAACCAAAAACAGTCCAGG + Intergenic
1031285207 7:119858303-119858325 TTACCAACCCAAAAAAGTCCAGG + Intergenic
1032983038 7:137306847-137306869 TTTCCCACCACATTTAGTCCTGG - Intronic
1033631518 7:143162842-143162864 TTACCAACCAAAAATAGTCCAGG - Intergenic
1034236635 7:149576431-149576453 TTGCCAACCCAAAAAAGTCCAGG - Intergenic
1037460113 8:19100374-19100396 TTCTCAACCCAATGTACCCCAGG - Intergenic
1037777978 8:21848217-21848239 TTCCCAACCCAGTGTCTTCCAGG + Intergenic
1038885939 8:31663182-31663204 TTTCCAATCCAATTTATTCTGGG - Intronic
1041440136 8:57886044-57886066 TTCCCACCCCAATCGAGTCTTGG - Intergenic
1041518421 8:58728160-58728182 TTACCAACCAAAATAAGTCCAGG + Intergenic
1042122534 8:65504010-65504032 TTACCAACAAAATTAAGTCCAGG - Intergenic
1044063626 8:87670895-87670917 TTCCCAACACAATTGAGTGTAGG + Intergenic
1048178453 8:132173543-132173565 TTACTAACCCAATTAAGTCTCGG + Intronic
1052364146 9:27592777-27592799 CTACCAACCAAATTTAGCCCTGG + Intergenic
1053038499 9:34848228-34848250 TTACCAACCCAAAAGAGTCCAGG - Intergenic
1053052115 9:34970764-34970786 TCCTAAAACCAATTTAGTCCAGG - Intronic
1053718290 9:40919291-40919313 TTACCAACCAAAATGAGTCCAGG + Intergenic
1058569898 9:106329707-106329729 TTCCCAACCCTAATTAATACTGG - Intergenic
1060312441 9:122474585-122474607 TTCCCAGCCCTATTTTGTCTGGG - Intergenic
1203379223 Un_KI270435v1:14752-14774 TTCCCAACCAAAAAGAGTCCAGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1190929965 X:54939756-54939778 TTACCAACCAAAAATAGTCCAGG + Intronic
1191683256 X:63863005-63863027 TTACCAACCCAAAAGAGTCCAGG - Intergenic
1192155128 X:68739751-68739773 TTACCAACCCAAAAGAGTCCAGG + Intergenic
1193831283 X:86292053-86292075 TTACCAACCAAAAATAGTCCAGG - Intronic
1196147024 X:112329522-112329544 TTACCAACCAAAATGAGTCCAGG + Intergenic
1196156333 X:112434361-112434383 TTACCAACCAAAATGAGTCCAGG - Intergenic
1197073758 X:122331550-122331572 TTACCAACCCAAAACAGTCCAGG + Intergenic
1199531818 X:148856533-148856555 TTCCCAAGACAATCAAGTCCAGG - Intronic
1199865018 X:151838527-151838549 TTCTCAAAGCAATTTAGTGCAGG + Intergenic
1201919497 Y:19219302-19219324 TTACCAACCAAAATGAGTCCAGG - Intergenic