ID: 976959788

View in Genome Browser
Species Human (GRCh38)
Location 4:90956230-90956252
Sequence CTGTATAATAATGCTTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976959788_976959792 28 Left 976959788 4:90956230-90956252 CCTACAGAAGCATTATTATACAG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 976959792 4:90956281-90956303 AAGACCTACTAACTATTTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
976959788_976959793 29 Left 976959788 4:90956230-90956252 CCTACAGAAGCATTATTATACAG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 976959793 4:90956282-90956304 AGACCTACTAACTATTTTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 139
976959788_976959791 -2 Left 976959788 4:90956230-90956252 CCTACAGAAGCATTATTATACAG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 976959791 4:90956251-90956273 AGTGGTTTCAGGTCAGATTTTGG 0: 1
1: 0
2: 1
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976959788 Original CRISPR CTGTATAATAATGCTTCTGT AGG (reversed) Intronic
901354322 1:8630474-8630496 CTGTATTCTAATACTTCTTTAGG + Intronic
908209163 1:61882058-61882080 CTGTATAAGAGTGCTGCTCTGGG + Intronic
916189597 1:162166245-162166267 CTGTATAAGGATGATTCTGTAGG + Intronic
917627279 1:176859265-176859287 CTGTATCCTAATACTTCTGAGGG - Intronic
918022316 1:180706917-180706939 CCATTTAAGAATGCTTCTGTAGG - Intronic
919343371 1:196343197-196343219 CTTTATAAAAATACTTTTGTGGG - Intronic
919565381 1:199178926-199178948 GGGCATAATAATGCTTCTGTTGG - Intergenic
921636165 1:217496471-217496493 TTGCATAATTGTGCTTCTGTTGG + Intronic
924194938 1:241596738-241596760 CTTTATAATAATCATTTTGTGGG + Intronic
1063127606 10:3149542-3149564 CTGTATTCTAATGCATCAGTAGG - Intronic
1069243562 10:66172677-66172699 CTGTATATGAATTCTTCTGAAGG - Intronic
1079263503 11:18907155-18907177 CTGTAGAACAATCCTTTTGTAGG + Intergenic
1086344026 11:85877167-85877189 GTGTTTAATAATGCTTATGCAGG + Intronic
1089553084 11:119296624-119296646 CTCTATAATGAAACTTCTGTGGG + Intronic
1094931226 12:35605900-35605922 GTGTATAATATTTCTTCTGATGG + Intergenic
1094945109 12:35831082-35831104 GTGTATAATATTTCTTCTGATGG + Intergenic
1094951397 12:35933329-35933351 GTGTATAATATTTCTTCTGATGG + Intergenic
1094985703 12:36487063-36487085 GTGTATAATATTTCTTCTGATGG + Intergenic
1095378995 12:41566657-41566679 CTGTATGCTAATGCCTCTTTTGG + Intronic
1097510384 12:60531456-60531478 CTGCATAATAAGGCTTCTCCAGG - Intergenic
1097998764 12:65918954-65918976 ATGTAAAAAAATGTTTCTGTAGG + Intronic
1098227693 12:68341683-68341705 CTGTACCATAATGTTTCAGTCGG + Intergenic
1099621077 12:85003509-85003531 CTGTATAAAAATGCTACTGAGGG - Intergenic
1100721308 12:97361976-97361998 CTGGATAAAAATGATTCTGGAGG + Intergenic
1100921709 12:99495679-99495701 GTGTAAAATAATGCTTCCATGGG + Intronic
1100926386 12:99553142-99553164 ATGTAAAATAAAGCCTCTGTAGG + Intronic
1101389491 12:104287528-104287550 CTATGTAAGAATGCTTCTCTAGG + Intronic
1104699315 12:130889700-130889722 CTGTATACCAGTGCTTATGTGGG + Intergenic
1107587571 13:41868227-41868249 CTTGATAGTACTGCTTCTGTCGG - Intronic
1108344814 13:49535157-49535179 CTGTGTAAATATACTTCTGTGGG - Intronic
1108662152 13:52597137-52597159 CTGCATAAACATGTTTCTGTCGG - Intergenic
1109041201 13:57339334-57339356 ATGGATATTAATGTTTCTGTCGG + Intergenic
1109591863 13:64494883-64494905 CCGCATAATGATGCTTCTGTCGG + Intergenic
1110036753 13:70697048-70697070 CTGCAAAATAAAGTTTCTGTGGG - Intergenic
1110985642 13:81964216-81964238 GTGTATTATAATACTTCTTTAGG + Intergenic
1111514313 13:89307890-89307912 CTGTAAAATAATTCTCCTCTAGG - Intergenic
1113057443 13:106284347-106284369 CTATATTTTAATGCTTCTGAGGG - Intergenic
1116614867 14:47122274-47122296 TTGTTCAATAATGCTTCTTTAGG + Intronic
1118240130 14:64047829-64047851 CCATATAATAATGCCTATGTTGG - Intronic
1119457144 14:74765487-74765509 TAGTAGAATAATGATTCTGTTGG + Intronic
1120913906 14:89693123-89693145 TTGTACAATAATTCCTCTGTAGG - Intergenic
1125151150 15:36533838-36533860 GTGTATCATAATACTTCTGTTGG - Intergenic
1126515490 15:49530881-49530903 CTGTACACTTGTGCTTCTGTAGG - Intronic
1128431060 15:67594003-67594025 CTGTATGGTAGTGCTTCTGGAGG + Intronic
1129619542 15:77131703-77131725 CTCTATAAAAATGTTTCTCTAGG + Intronic
1130327473 15:82892458-82892480 CTGTATAATAATTCTGCCGACGG - Intronic
1133660629 16:7913384-7913406 CTGTAAGATAGTGCTTCTGCAGG - Intergenic
1136475193 16:30508507-30508529 CTGTATAAGAATAATTCGGTTGG - Intronic
1137853217 16:51767262-51767284 CTGTATAATACTCCACCTGTAGG + Intergenic
1137958447 16:52856813-52856835 CTGTATAACAGTGCAGCTGTAGG - Intergenic
1139869252 16:70091112-70091134 CAGTATAAAAATTCTTCTGCCGG - Intergenic
1140386130 16:74541027-74541049 CAGTATAAAAATTCTTCTGCCGG + Intronic
1145237182 17:21216356-21216378 CTGTATAAAAGTGATACTGTTGG + Intergenic
1149034882 17:52122718-52122740 CTGTTTAAGAATGCTTAAGTAGG - Intronic
1150446449 17:65230373-65230395 CTGTGTAATAATTCCACTGTGGG - Intergenic
1150507736 17:65716648-65716670 ATTTATAATAATGTTTCTGTTGG + Intronic
1151831395 17:76554137-76554159 CTGTATAATAATTCCACGGTAGG + Intergenic
1153022633 18:644888-644910 CTGTATAATCCTTCTTCTGTAGG + Exonic
1159989384 18:74885134-74885156 CTGTATAATAAGACTTAGGTAGG - Intronic
1159994505 18:74950663-74950685 CTGTAAATGAAAGCTTCTGTAGG + Intronic
1160961693 19:1724978-1725000 CTGTAGAAAAATACATCTGTGGG + Intergenic
931687524 2:64807139-64807161 CTGTAGAATAATACATTTGTGGG + Intergenic
932162657 2:69476092-69476114 ATGTAAAATATTGCTTCTCTAGG - Intronic
932450440 2:71807077-71807099 ATGTATAATGATGCTTGTGAAGG + Intergenic
932765604 2:74467509-74467531 AGGTATAGTAATGCTGCTGTAGG + Intergenic
941699671 2:168591017-168591039 CTATATAATATTGCATCTATTGG + Intronic
942809304 2:179978222-179978244 TTGAATAATAATACTTATGTTGG + Exonic
943449150 2:188026402-188026424 CTGGATAATAGTCCTTCAGTTGG + Intergenic
944354569 2:198771036-198771058 CTGGATAATGATGCGTCTGAAGG + Intergenic
945684641 2:212954132-212954154 CTGTTTAAAAATACTTTTGTTGG - Intergenic
946280627 2:218663330-218663352 CTGTATAAAAATGACCCTGTAGG + Exonic
948321705 2:237075046-237075068 CTTTTTACTAATGCTTGTGTTGG - Intergenic
1173764916 20:45598436-45598458 CTGAATAATAATCCACCTGTTGG + Intergenic
1173934277 20:46847511-46847533 CGGTAAAATTTTGCTTCTGTGGG + Intergenic
1175219444 20:57408647-57408669 CTGTATAATAAAGTGTCTGCCGG + Exonic
1176926684 21:14758607-14758629 CTGTTTCCTAATGCGTCTGTAGG + Intergenic
1177242775 21:18481345-18481367 CTGAATAATAATAATGCTGTGGG - Intronic
1184605132 22:45568569-45568591 CTGTAGGAGAATGCTCCTGTAGG + Intronic
1184605160 22:45568718-45568740 CTGTAGGAGAATGCTCCTGTAGG + Intronic
950956982 3:17064376-17064398 GTGTAAAATAATTATTCTGTGGG - Intronic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
956031055 3:65038477-65038499 CTGAATTATATTTCTTCTGTTGG + Intergenic
956474493 3:69605752-69605774 TTCTATAATATTGATTCTGTTGG - Intergenic
957829822 3:85503271-85503293 TTGCATAAGCATGCTTCTGTTGG + Intronic
959582481 3:107995993-107996015 CTGTATCATGATGCGTCTCTTGG - Intergenic
960729794 3:120714220-120714242 CTCTTTAATAATGATTCTGCAGG - Intronic
965974077 3:174599763-174599785 ATGTATGATAATTCTTCTCTAGG + Intronic
966979606 3:185119601-185119623 CTAAATAATAAAGCTTATGTTGG + Intronic
967293240 3:187942278-187942300 CTCTTTAATATTGCTTATGTGGG - Intergenic
972342127 4:38161285-38161307 CTGTATGCAAATCCTTCTGTGGG - Intergenic
974712709 4:65621640-65621662 CTGTATATTAATGTTTCTCCTGG - Intronic
975134658 4:70862974-70862996 CTGTATAATGATGCATATGTAGG + Intergenic
975943591 4:79677526-79677548 CTGTATAATACTGATTGTGGGGG + Intergenic
976651214 4:87436945-87436967 CTGTTTAAAAATGTTTTTGTTGG + Intronic
976959788 4:90956230-90956252 CTGTATAATAATGCTTCTGTAGG - Intronic
978153665 4:105465782-105465804 CTGTATAATAATGTGACTGGGGG + Intronic
980060496 4:128123728-128123750 GTGTATAATATTTGTTCTGTGGG + Intronic
981281481 4:142964888-142964910 TTGTATTATAATCATTCTGTAGG - Intergenic
981409431 4:144411420-144411442 CTGTCTACCAATGCTTCTCTAGG + Intergenic
981701902 4:147616874-147616896 CTTTAGAATGATCCTTCTGTAGG + Intergenic
981878919 4:149584607-149584629 CTGTTTAATAATGCTTCTAAGGG + Intergenic
982300713 4:153876658-153876680 ATGTATAACATTGCTTCTGCTGG - Intergenic
982985251 4:162198774-162198796 ATGGATAATAATGTTTCTCTGGG + Intergenic
983765619 4:171478892-171478914 CTGTAGGATTATGGTTCTGTAGG + Intergenic
984129286 4:175853059-175853081 CTGTATAATCAGGTTTTTGTGGG - Intronic
985124059 4:186673991-186674013 CTGTATCTTAATGCTTCTGAAGG - Intronic
987666146 5:20943141-20943163 CTGTAAAATAATGCTTTATTTGG - Intergenic
988756539 5:34259027-34259049 CTGTAAAATAATGCTTTATTTGG + Intergenic
993898531 5:93569198-93569220 CTGTGTACTAATGATGCTGTGGG - Intergenic
994479789 5:100319963-100319985 CTGTATTAAAATTCTTCTTTGGG - Intergenic
994884164 5:105537731-105537753 CTGTATAGTTTTGCTTCAGTAGG - Intergenic
995229400 5:109741722-109741744 TTGAATAATAATGCTGCTGGGGG - Intronic
995361324 5:111301280-111301302 CTGTATATAAATCATTCTGTAGG - Intronic
998026593 5:138821460-138821482 CTGAATAGTAATGTTACTGTCGG + Intronic
999343857 5:150797525-150797547 CTGTATTACAATGCTACTCTTGG - Intergenic
999807799 5:155100001-155100023 CTGCATAATATTTCTTTTGTGGG + Intergenic
1001766408 5:174251030-174251052 GTGTATAATGATGCATCTGTTGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003803369 6:9697217-9697239 CTGAAGAATAATTTTTCTGTTGG + Intronic
1004601332 6:17153226-17153248 TTCTATAATAAAGCTTCTGAAGG - Intergenic
1005694282 6:28336527-28336549 TTTTATAATAAAGTTTCTGTTGG + Intronic
1008927480 6:56902375-56902397 AGGCATAATAATGATTCTGTGGG + Intronic
1010257184 6:73771732-73771754 CTGTATCGTAATGGTTATGTTGG + Intronic
1010435209 6:75821369-75821391 ATTTATAATAATGATTCTATAGG - Intronic
1012206181 6:96463131-96463153 CTTTATAAGATTGCTTCTCTTGG - Intergenic
1013196156 6:107846978-107847000 CTGAATAGGAATGATTCTGTGGG - Intergenic
1014019312 6:116569507-116569529 ATGCTTAATAATGCTTATGTAGG + Intergenic
1017269079 6:152485207-152485229 CAGAATAATAATGCATGTGTAGG - Intronic
1017437042 6:154425482-154425504 CTGAAAAATGATGCTTGTGTTGG + Intronic
1019763885 7:2835254-2835276 TTGTGTAATAATGCCTCTGGTGG - Intronic
1020708450 7:11574734-11574756 ATGTATGATAATGTTTTTGTTGG - Intronic
1023307376 7:38844986-38845008 CTATCTAATAAGTCTTCTGTAGG - Intronic
1023337975 7:39189734-39189756 CTGAATAATAATTCTTCTGCAGG - Intronic
1023539295 7:41248414-41248436 TTGTAAATTAATGTTTCTGTTGG - Intergenic
1028256746 7:88608433-88608455 CTTTATAATAGTGTTTTTGTGGG - Intergenic
1028316691 7:89410846-89410868 CTCTGAAATAATGTTTCTGTGGG + Intergenic
1028384532 7:90239883-90239905 ATGTACATTAATGATTCTGTTGG + Intergenic
1031111535 7:117616325-117616347 ATGTATAGAAATGTTTCTGTTGG + Intronic
1031916272 7:127565753-127565775 CTGTATAAAAAGGCTTCTAAGGG + Intergenic
1032876352 7:136042388-136042410 AGGTATAATAATGATACTGTGGG + Intergenic
1039533810 8:38289206-38289228 CTGTAAAACAGAGCTTCTGTTGG - Intronic
1046047209 8:108978242-108978264 ATGGCTAATATTGCTTCTGTGGG + Intergenic
1046848715 8:118948857-118948879 CTGTAGAATAATGCCTTTGGGGG - Intronic
1050336756 9:4597032-4597054 CTGTCTAATAATGTTATTGTTGG - Intronic
1050539318 9:6656631-6656653 CTTTATAATTCTGCTTCTCTTGG - Intergenic
1051788865 9:20776751-20776773 CTGTATAGTAATGCTATTATTGG - Intronic
1052012633 9:23428888-23428910 CTGTATGATTCTACTTCTGTGGG + Intergenic
1052875697 9:33560658-33560680 CTTATTAATAATGCTGCTGTAGG + Intronic
1053500312 9:38583686-38583708 CTTATTAATAATGCTGCTGTAGG - Intergenic
1055430764 9:76241138-76241160 CTTTATAAAAATGACTCTGTTGG + Intronic
1055831554 9:80385218-80385240 CTGTAGAGTGATGCCTCTGTGGG - Intergenic
1056339787 9:85615836-85615858 ATGTATAATAATGTTTATCTCGG + Intronic
1056804353 9:89717307-89717329 GTGTATAATTATGCATGTGTGGG - Intergenic
1058373335 9:104295054-104295076 CTTTATATTAATGCTTCAGGTGG + Intergenic
1061172827 9:128970997-128971019 CATTATTATAATGCTTCTGCCGG - Intronic
1186954218 X:14663153-14663175 TTGCATAATAATGCTAATGTAGG + Intronic
1188072153 X:25730050-25730072 CTATATTATGATTCTTCTGTTGG + Intergenic
1191033181 X:55997255-55997277 CTGGCTAATGATGCTTCTCTAGG - Intergenic
1193691203 X:84645658-84645680 CTTTATAAAAATGCTGCTGTTGG + Intergenic
1197198084 X:123723469-123723491 TTGTATAATAATGTTTCTATTGG + Intronic
1197548790 X:127862029-127862051 CTTTATAAGAATGCTTGGGTTGG - Intergenic
1197917431 X:131551520-131551542 TTTTATAATAATGCTTGTTTTGG + Intergenic
1197952786 X:131916135-131916157 CTTTATAATATTGCTTCTGTGGG - Intergenic