ID: 976962973

View in Genome Browser
Species Human (GRCh38)
Location 4:91002365-91002387
Sequence CTGGTATTCCTGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 3, 2: 8, 3: 45, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976962973_976962979 21 Left 976962973 4:91002365-91002387 CCCTTCTTCCTCAGGAATACCAG 0: 1
1: 3
2: 8
3: 45
4: 304
Right 976962979 4:91002409-91002431 TAACGTAGTCCCAAACTTCTTGG 0: 1
1: 61
2: 230
3: 779
4: 7262
976962973_976962980 24 Left 976962973 4:91002365-91002387 CCCTTCTTCCTCAGGAATACCAG 0: 1
1: 3
2: 8
3: 45
4: 304
Right 976962980 4:91002412-91002434 CGTAGTCCCAAACTTCTTGGAGG 0: 1
1: 56
2: 392
3: 6896
4: 3318
976962973_976962977 -7 Left 976962973 4:91002365-91002387 CCCTTCTTCCTCAGGAATACCAG 0: 1
1: 3
2: 8
3: 45
4: 304
Right 976962977 4:91002381-91002403 ATACCAGTTATTCTTAGGTTTGG 0: 3
1: 68
2: 437
3: 542
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976962973 Original CRISPR CTGGTATTCCTGAGGAAGAA GGG (reversed) Intronic
904595602 1:31643132-31643154 CTAGTATTTCTGAGGAACACAGG - Intronic
906517003 1:46445539-46445561 ATGGTATTCATGAGAAGGAAGGG - Intergenic
907451834 1:54550429-54550451 CTTGTATTCCAGAGGAACTAAGG - Intronic
907632790 1:56100583-56100605 CGTGTATTCCTGATGGAGAAAGG - Intergenic
908152438 1:61316244-61316266 AGGGTATGGCTGAGGAAGAAGGG + Intronic
908930494 1:69312071-69312093 CTGGTATTTCTGAGGAATCCAGG - Intergenic
909356579 1:74716601-74716623 CTGATATTTCTCAGGGAGAATGG - Intronic
909413627 1:75380861-75380883 CTGCCAAACCTGAGGAAGAAGGG + Intronic
909892791 1:81028797-81028819 CTTATATTTCTGAGGAAGGAAGG + Intergenic
911149090 1:94580025-94580047 ATGGAATGCCTGAGGAGGAAGGG - Intergenic
911162824 1:94698667-94698689 AGGGTATTGGTGAGGAAGAACGG - Intergenic
911168280 1:94744628-94744650 CTGGTTCTCCTGAGCCAGAATGG - Intergenic
911699369 1:100933373-100933395 ATGGGAATCATGAGGAAGAAAGG - Intronic
911897653 1:103458019-103458041 CTGGCATTCCTGGGAAACAATGG - Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913595116 1:120368035-120368057 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914092155 1:144510951-144510973 CTTGGATTCCTGAGGAAAATAGG + Intergenic
914306379 1:146422914-146422936 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914595669 1:149149888-149149910 CTTGGATTCCTGAGGAAAATAGG + Intergenic
915014276 1:152718828-152718850 CTGGCATTCCTGTTTAAGAAGGG + Intergenic
915358704 1:155272815-155272837 CTGGATTTTCTGAGTAAGAAAGG - Intronic
915402015 1:155629241-155629263 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
916010080 1:160697419-160697441 CTGCCAAACCTGAGGAAGAAGGG + Intronic
917237019 1:172904820-172904842 CTGATATCCCTGAGGAAGGAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917513694 1:175689315-175689337 CTGGTATCCCTGTGGAAAGACGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918721705 1:187860603-187860625 TAGGCCTTCCTGAGGAAGAAAGG - Intergenic
919316830 1:195981351-195981373 CTGGTATGCCTGATGACAAAAGG + Intergenic
919505121 1:198388674-198388696 GTCGTTTGCCTGAGGAAGAAAGG - Intergenic
919947711 1:202333047-202333069 CTGGCATTCTTGAGGAAGGCTGG + Exonic
920629479 1:207637674-207637696 CTGCCAAACCTGAGGAAGAAGGG - Intronic
921546146 1:216477270-216477292 CTGTGGTACCTGAGGAAGAATGG - Intergenic
923685130 1:236148362-236148384 CTGGGAATTCCGAGGAAGAAGGG - Intronic
923982845 1:239345154-239345176 CTGTTATTCATGAGTAAGAATGG - Intergenic
1063690866 10:8285653-8285675 TTGGTATTCATCAGGATGAAAGG + Intergenic
1064639286 10:17398955-17398977 GTAGTTTTCCTGAGGGAGAAAGG + Intronic
1066547162 10:36512101-36512123 CTAATATTCTAGAGGAAGAAGGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068144107 10:53044348-53044370 CTGGGGTTCCTGAGGAAGATGGG - Intergenic
1068244922 10:54352446-54352468 CTTGGATTCTTGAGGAAGCATGG - Intronic
1070127848 10:73636188-73636210 ATGGTATAGCTGAGGAAGAAGGG - Intronic
1070244535 10:74718666-74718688 CTGGTATACCTGAAGGAGAGGGG - Intergenic
1072269759 10:93765009-93765031 ATTTTATTCATGAGGAAGAAAGG - Intronic
1072436597 10:95419682-95419704 CTTTTAGTCCTGAAGAAGAAAGG + Intronic
1072623629 10:97097007-97097029 CTAGTATCCCTGAGAAAAAATGG - Intronic
1072947382 10:99822033-99822055 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1073760553 10:106624064-106624086 TAGGTATTTCTGAGGAAGGAGGG + Intronic
1074467049 10:113692522-113692544 CTGGTCTGCCTGAGAAACAAAGG + Intronic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1075269620 10:121037328-121037350 CATGTATTCCTGAGGATGAGGGG - Intergenic
1076496490 10:130900880-130900902 TGGGTCTTCCTGAGGCAGAAGGG - Intergenic
1080424789 11:32145662-32145684 ATTCAATTCCTGAGGAAGAAGGG - Intergenic
1081146945 11:39573098-39573120 CTGGAATTCTTGACCAAGAATGG + Intergenic
1082954823 11:58858768-58858790 TAGGTATTCCTGAGGAATCAGGG - Intronic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083440307 11:62671876-62671898 CTGGTAGTCCCGAGGAAGGGTGG + Intronic
1083889714 11:65589737-65589759 CTGGCCTTCCTGTGGAAGAAGGG - Exonic
1084507240 11:69575918-69575940 CAGGTATTCCAGAGGTAGAAAGG + Intergenic
1085849928 11:80108287-80108309 TTAGTATTCTTGAGGAAGATAGG + Intergenic
1086222331 11:84463333-84463355 CTGATATTCCTGAGGAGGATGGG - Intronic
1087724447 11:101701931-101701953 CTGCCAAACCTGAGGAAGAAGGG + Intronic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1089012426 11:115141982-115142004 CAGGCATTGCTGAGGCAGAACGG + Intergenic
1090731910 11:129579758-129579780 ATGGAATTCCTCAGGAAGAAAGG - Intergenic
1090772921 11:129937602-129937624 ATGACATTTCTGAGGAAGAAAGG - Exonic
1093219151 12:16398536-16398558 CTGATATATCTAAGGAAGAATGG - Intronic
1093396023 12:18683587-18683609 CAGGTCTTCCTGAAGCAGAAGGG - Intronic
1094275372 12:28668984-28669006 CTGGTAGTTCTGAGGAATACAGG + Intergenic
1094329106 12:29273212-29273234 CTGGTAGTTCTGAGGAATCAGGG - Intronic
1094715048 12:33005502-33005524 CTGGGAATCCTTAGCAAGAAGGG - Intergenic
1095178584 12:39121658-39121680 TTGGTGTTCCCAAGGAAGAAGGG - Intergenic
1096447992 12:51712266-51712288 ATGGTAGTCCTGAACAAGAAGGG + Intronic
1097330731 12:58330034-58330056 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1097967075 12:65592729-65592751 CTAGTGTTCCTTAAGAAGAAAGG - Intergenic
1099832650 12:87865046-87865068 TTGTTGTTTCTGAGGAAGAAAGG - Intergenic
1099839800 12:87951345-87951367 CAGGAATTTCTGACGAAGAAAGG + Intergenic
1101634361 12:106525709-106525731 CTTGTAGTCCTGAATAAGAATGG - Intronic
1101653900 12:106702934-106702956 CAGGTGTTCATGAGGAAGACTGG - Intronic
1102208566 12:111107375-111107397 CAGGAAATCCTGAAGAAGAATGG - Intronic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1103494866 12:121353891-121353913 CTGGCATTCCTGAGGGCGAGGGG - Intronic
1103516756 12:121513295-121513317 CTGGTATTCCTGAGTGAGGTGGG + Exonic
1103847004 12:123908630-123908652 CTGGTTCTCCAGAGGAACAAGGG + Intronic
1105350027 13:19606656-19606678 CTTGTAGTCCTGGGGAGGAATGG - Intergenic
1107215427 13:37912022-37912044 CTTGTATCCTTGAGGAATAAAGG + Intergenic
1107528870 13:41262601-41262623 ATGGTCTTACTGAGTAAGAAAGG + Intronic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1110238463 13:73241115-73241137 CTGGTCTTCCTTATGATGAATGG + Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1111471585 13:88690387-88690409 CTGGCATTCATGAGGGAAAAAGG + Intergenic
1111741194 13:92207548-92207570 CTGATCCTCCAGAGGAAGAAAGG + Intronic
1112476875 13:99739454-99739476 CAGGGATTCCAGAGGCAGAAAGG - Intronic
1115501901 14:34057602-34057624 TTGATATTCCTAAGCAAGAAGGG + Intronic
1116144489 14:41046685-41046707 ATAGTATCCCTGAGTAAGAAGGG - Intergenic
1116202851 14:41821556-41821578 CTGGTATCCCTGATGAACACAGG - Intronic
1116631207 14:47336303-47336325 CTAGTAATTCTGAGGAAGAATGG + Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117679295 14:58186887-58186909 CAGGTATAACTGAGGAAGCATGG + Intronic
1118257744 14:64220067-64220089 ATGTTATTCCTTAGGAGGAATGG - Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1120159645 14:81131577-81131599 CTGGTATATTTGAGGAAGCAAGG - Intronic
1120450786 14:84664844-84664866 CTGGTGTTCCTGAGCAGGTAGGG - Intergenic
1123911255 15:24969780-24969802 CTAGTATTCCTGTAGAAGAAGGG + Intronic
1124562433 15:30787580-30787602 CTGGTTTCCCTGAAGAGGAAGGG + Intergenic
1124941942 15:34226373-34226395 CTGGTGAGCCTGATGAAGAAAGG - Intronic
1127090137 15:55458568-55458590 TTGGTGCTCCTGAGGAAGAAGGG + Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1127573828 15:60271287-60271309 TTAGTGTTCCTGAGAAAGAAGGG - Intergenic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128383102 15:67127641-67127663 CTGGAGTTCCTGAAGATGAAGGG + Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1131456337 15:92585297-92585319 CTCGTATTCTTGAGGGAGAAGGG - Intergenic
1131531737 15:93199592-93199614 CTGGTGTTTCTCAGTAAGAAAGG + Intergenic
1131614797 15:94004956-94004978 ATAGCATTCCTGAGGAAGACAGG + Intergenic
1132412726 15:101596646-101596668 TTGGTGTTCCAGAGGAAGAAGGG - Intergenic
1132599405 16:767257-767279 CTGGAATCCCTAAGGAAAAAGGG + Intronic
1136930576 16:34414624-34414646 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1136973998 16:34997184-34997206 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1137536698 16:49332702-49332724 CAGAGATTCCTGAGGAAGGAGGG + Intergenic
1137552815 16:49452296-49452318 CTGGGCTTCCTGAGGATGCAGGG + Intergenic
1139447313 16:67005881-67005903 CTGTTCTTCCTTAGGAACAAGGG + Intronic
1139538072 16:67591687-67591709 CAGTTTTTCCTGAGGATGAAAGG - Intronic
1141525881 16:84611371-84611393 CTGGTATTGCAGAAGAAGAGGGG + Intronic
1143840973 17:9731471-9731493 CTGAGCTTCCAGAGGAAGAATGG - Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144542912 17:16162425-16162447 CTGATATTCCTGAATATGAAGGG - Intronic
1145090018 17:19978275-19978297 CGGGTTCTCCTGAGGAAGCAGGG - Intronic
1147720820 17:42538325-42538347 CAGGTACACCTGAGGAAGAAGGG - Exonic
1147987873 17:44316558-44316580 CGGGTCGTCCTGGGGAAGAAGGG + Intronic
1148111685 17:45148152-45148174 CTCGTATTCCTGAAACAGAATGG + Intergenic
1148877966 17:50703637-50703659 CTGGTATTCCAGAGAAAGCAAGG + Intronic
1150837575 17:68578484-68578506 CTGGTCATGCTGAGGAGGAAAGG - Intronic
1151329920 17:73400627-73400649 CTGGTATTCCTGAAAGACAAGGG + Intronic
1153668785 18:7391031-7391053 GTGGTTTCCCTGAGAAAGAATGG + Intergenic
1155312034 18:24533369-24533391 TTTGTATTCCTGAGACAGAATGG - Intergenic
1156704987 18:39870290-39870312 AAAGTATTCCTGGGGAAGAAAGG - Intergenic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1158377377 18:56886009-56886031 TTGGTGTTCCTGAGAAAGAAGGG + Intronic
1159332448 18:67015385-67015407 GTGGGATCCCTGAGGAAGAAAGG - Intergenic
1160014359 18:75129090-75129112 CTGGAACTGCTGAGAAAGAAAGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160316367 18:77851489-77851511 CTCCTATTCATGTGGAAGAAAGG - Intergenic
1160374092 18:78397900-78397922 CAGGGATTCCTGAAGAAGAGAGG + Intergenic
1160397940 18:78585504-78585526 CTGGTTTTCATGATAAAGAAAGG + Intergenic
1162785413 19:13031790-13031812 CTGGGATGCCAGAGGAAGAGTGG + Intronic
1164154154 19:22579252-22579274 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1164370568 19:27640192-27640214 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1164541890 19:29127674-29127696 CTAGATTTCCTGAGGCAGAAAGG + Intergenic
1164662088 19:29983741-29983763 CTGGTATTACTCAAAAAGAAGGG + Intronic
1164805501 19:31113181-31113203 CTGGAAATTCTTAGGAAGAAAGG + Intergenic
1165082925 19:33320566-33320588 TTGGTATTACTGAGGAGGAATGG + Intergenic
1165397531 19:35574043-35574065 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1166609049 19:44172538-44172560 CTAGAACTCCTTAGGAAGAATGG + Intronic
1167305775 19:48708503-48708525 CTGGTTTTCCTGAGGCAGGAGGG + Intergenic
1167865513 19:52323513-52323535 CTGGTACTCCTGACGAATATAGG + Exonic
1168106781 19:54170371-54170393 CTTGTATTTGTGAGGAAAAAGGG + Intronic
1168122669 19:54261146-54261168 TTGGCATCCCTGAGTAAGAAAGG - Intronic
1168633090 19:57972462-57972484 ATGAAATTCCTGAGGAATAAAGG - Exonic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
925636995 2:5950115-5950137 CTGATTTTCCTGCAGAAGAAGGG - Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
927498889 2:23568843-23568865 CTGGCATGCCTCAGGCAGAAAGG + Intronic
928407639 2:31026837-31026859 CTGGGAAGACTGAGGAAGAAAGG - Intronic
929170821 2:38931610-38931632 CTGGTTTTCCAGAGAAAGACAGG - Intronic
929551386 2:42895323-42895345 CTGGTGTCCCTGAGTCAGAAGGG - Intergenic
930481586 2:51954131-51954153 CAGGAATTCCTGAGGAATAGTGG + Intergenic
930618195 2:53615942-53615964 CTGGTATTCCTGAGTTAAACTGG - Intronic
930939378 2:56996315-56996337 TTGGTATTCCTGAAAAGGAAGGG - Intergenic
932018156 2:68054169-68054191 CTGGGACTTCTGAGAAAGAAAGG - Intronic
935345921 2:102108371-102108393 CTGGTTTTCCTGTACAAGAATGG - Intronic
935431155 2:102977353-102977375 CTGGTTTCACTGAGAAAGAATGG - Intergenic
937390007 2:121477227-121477249 CTGGTAGTCCACATGAAGAAAGG + Intronic
937896697 2:126981540-126981562 CTGGTAGTCCCCGGGAAGAAAGG + Intergenic
938154469 2:128920883-128920905 GTGGTGTTTCTGAGGAGGAATGG + Intergenic
938270318 2:129964533-129964555 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
941621287 2:167782259-167782281 CTGGGAATCCTGAAGAGGAACGG + Intergenic
942244442 2:173994086-173994108 CTGGTATCCCTGAGGAACTGGGG + Intergenic
945952123 2:216049257-216049279 TTGGTGTTCCTGAGGAGGTAAGG - Exonic
946538724 2:220660343-220660365 CTGTGATTCCAGAGGAGGAATGG + Intergenic
947916555 2:233835956-233835978 ATGGTTTTCCTGAAGAGGAAAGG + Intronic
1168910857 20:1445567-1445589 CTGGTATTTAGGAGGAAGAACGG + Intronic
1170408297 20:16062762-16062784 CTGGTATTTGAGAGGAAGGAAGG - Intergenic
1170649952 20:18230073-18230095 CTGGTAATGCTGAGTCAGAAAGG - Intergenic
1171372064 20:24668591-24668613 CGGGTATTCCTGGGGAGGAGGGG - Intergenic
1171509878 20:25673449-25673471 ATGCTATTCCTAAGGAAGGATGG + Intergenic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1173203381 20:40970422-40970444 CAGGTATTCACGAGGAAGCAAGG + Intergenic
1173306759 20:41857911-41857933 TTGGTATGTCTGAGGAAAAAAGG + Intergenic
1173480304 20:43393410-43393432 CTGGTAGTTCTGGGAAAGAAGGG - Intergenic
1173705289 20:45105769-45105791 CTGCTATTGGTAAGGAAGAAGGG + Intergenic
1173819194 20:46009852-46009874 CAGGTATTCCTGTGGATGAAGGG - Exonic
1175833436 20:61979341-61979363 ATGGGACTCCTGAGAAAGAAGGG + Intronic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1177046813 21:16181227-16181249 CCTGTATTCCTGAGGAAATAAGG + Intergenic
1177248561 21:18563201-18563223 CTGCCAAACCTGAGGAAGAAAGG - Intergenic
1177511328 21:22091612-22091634 CTGGTAGTTCTGAGGAATATGGG - Intergenic
1178939447 21:36892694-36892716 GTTGTATTCCTAAGGAAGACGGG - Intronic
1180639802 22:17289053-17289075 CTGCTATCTCAGAGGAAGAAGGG - Intergenic
1180838431 22:18945255-18945277 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1183002383 22:34872141-34872163 CTGGGCTTTCTGGGGAAGAAAGG - Intergenic
1183825973 22:40387898-40387920 CTGGTACTCCTGTGCAGGAAGGG + Intronic
1184678379 22:46055552-46055574 CTGGTATTCCTGACAATGATGGG + Intronic
949733313 3:7140706-7140728 CTGGATATCCTGAGGAAGTACGG + Intronic
950030603 3:9850250-9850272 CTGCCAAACCTGAGGAAGAAGGG - Intronic
950035756 3:9884245-9884267 CTGACATTCCTGAGGAAGGTGGG + Intergenic
951514977 3:23548913-23548935 CTGGTATGCCAGGGCAAGAATGG + Intronic
953680798 3:45036549-45036571 CGGGATGTCCTGAGGAAGAAGGG - Intergenic
953822192 3:46216369-46216391 TTGGTGTGCCTGAGGAAGAAAGG + Intronic
954007019 3:47599509-47599531 CTATTATCCCTGTGGAAGAAAGG + Intronic
955793698 3:62613383-62613405 CAGGTGTTTATGAGGAAGAAGGG + Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
957272883 3:78054391-78054413 CTAGTATGCCTGATGAATAAGGG - Intergenic
957503453 3:81088714-81088736 CTGTTATTTCTGGGGAAGAGGGG - Intergenic
959047274 3:101488454-101488476 CTGGCATTCCTGAGAAAGAATGG + Intronic
959070571 3:101698421-101698443 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
959526036 3:107378426-107378448 CTGGGGTTCCTCAGGAAGAATGG - Exonic
960027644 3:113026845-113026867 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
961297388 3:125897168-125897190 CTGCCAAACCTGAGGAAGAAAGG + Intergenic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962826868 3:139106710-139106732 ATGGTGCTCCAGAGGAAGAATGG + Intronic
963317637 3:143777096-143777118 CTGGTATTTCTGAGAGAGAATGG - Intronic
964063423 3:152553445-152553467 CTGGCATTCCTGAGGAATGGTGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
966368733 3:179222365-179222387 CTGGAATTTATGAGCAAGAAGGG + Intronic
966840509 3:184083628-184083650 CTGGGGCTCCTGAGGCAGAAGGG + Intergenic
967026075 3:185565123-185565145 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
967120252 3:186376340-186376362 ATGGTGATCCTGGGGAAGAAGGG + Intergenic
967245705 3:187484265-187484287 CTGGCAGTCCAGAGGAAGGAAGG - Intergenic
967894032 3:194382777-194382799 CAGGAATTCCTCAGGAAGAAAGG + Intergenic
968885762 4:3331023-3331045 TTTCTATTCCTGTGGAAGAAGGG + Intronic
969784269 4:9441653-9441675 ATGGTTTTCCTGAGGGGGAAAGG + Intergenic
971106150 4:23525998-23526020 TTGGCATTCCTGAAAAAGAAGGG + Intergenic
971535247 4:27739509-27739531 CTAGTCTTGCAGAGGAAGAAAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972278874 4:37584539-37584561 GTGGTTTTCCTGGGGAAGGAGGG + Intronic
972687978 4:41369442-41369464 GTTGTATTCCTCAGGAAAAAGGG + Intronic
974126671 4:57705631-57705653 CTGTCATTCCTGAGAGAGAAGGG - Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
975211442 4:71704997-71705019 CTGGTATTCCTGGTGAACAGAGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
978126593 4:105143905-105143927 CTGCTATTTCTGGGAAAGAAAGG - Intergenic
978192200 4:105926862-105926884 ATGGTATTCCTAAGTATGAAAGG - Intronic
978326540 4:107563711-107563733 CTGGTATTAATGAATAAGAATGG - Intergenic
978972229 4:114822500-114822522 CTGGAATTCCTGAGGAAGGTTGG + Intergenic
979159880 4:117446934-117446956 TTGGTGTTCCTGAGAAAGAAGGG - Intergenic
979775478 4:124583632-124583654 CTGGTAGTCCTGAGGAATCTGGG + Intergenic
980515353 4:133850852-133850874 CTGGAATTCCAGAGCAAGGAGGG + Intergenic
980864890 4:138542764-138542786 CTGGTAGTTCTGAGGAATCAAGG + Intergenic
983215687 4:165000314-165000336 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
983240340 4:165224734-165224756 CAGGTATACCTGAAGAAAAAGGG - Intronic
984717126 4:182936304-182936326 CTGGAACTCCTGAGGAAGTATGG - Intergenic
986699840 5:10395681-10395703 CAGGAAGTCCAGAGGAAGAATGG + Intronic
987526394 5:19055832-19055854 TTGTTATTCCTCAGTAAGAATGG + Intergenic
988380197 5:30489220-30489242 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
988970290 5:36460057-36460079 TTGGTGTGGCTGAGGAAGAAAGG + Intergenic
989231939 5:39096737-39096759 CTGGTTTTCCCTAGGAAGGAGGG + Intergenic
989493992 5:42090188-42090210 CTGGAGTGACTGAGGAAGAATGG - Intergenic
990987650 5:61655680-61655702 CTGGTATCCCCAAGGATGAAGGG + Intronic
991225829 5:64270424-64270446 CTGAAATTCCTGGGGAAGGAAGG - Intronic
993779585 5:92050070-92050092 TTGGCATTCCTGAGAGAGAAGGG - Intergenic
995068915 5:107895248-107895270 CTTGTATGCTTGAGGAAGACTGG + Intronic
995366338 5:111365605-111365627 CTGGGATTTTGGAGGAAGAAGGG + Intronic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
999602019 5:153277421-153277443 CTGGTAATCCTGTGGAACAGTGG - Intergenic
999951920 5:156660281-156660303 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1000339878 5:160268864-160268886 CTTGATTTCCTGAGGGAGAAAGG - Intronic
1001217574 5:169870062-169870084 TTGGTCTTCCTGAGGATGCATGG + Intronic
1001980283 5:176033555-176033577 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980296 5:176033622-176033644 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980309 5:176033689-176033711 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980322 5:176033756-176033778 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980335 5:176033823-176033845 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980348 5:176033890-176033912 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1002806214 6:576874-576896 CTGGGTTACCTGGGGAAGAAAGG + Exonic
1003469433 6:6415661-6415683 CTAGGATTTCTGAGAAAGAAGGG - Intergenic
1003638738 6:7858680-7858702 CTGGCTGTCCTGAGGAATAAAGG + Intronic
1004599513 6:17134070-17134092 CTGGTATTCCTGAGAGAAAAAGG + Intergenic
1006441277 6:34055239-34055261 CTGGTGTTCCTGAGAGAGAAGGG - Intronic
1007115174 6:39338301-39338323 TTGATATTGCTGTGGAAGAAAGG + Intronic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1008449254 6:51631321-51631343 CTTGTCTTTCTGAAGAAGAAGGG - Intronic
1008461859 6:51784743-51784765 GTGGTAGTCGTGAGGCAGAAAGG - Intronic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1009392106 6:63156666-63156688 TTGGTGTTCCTGAAAAAGAAGGG + Intergenic
1009967812 6:70595237-70595259 CTTGAATTACTTAGGAAGAAAGG + Intergenic
1010591671 6:77719509-77719531 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1012808129 6:103921907-103921929 CTTGTACTCCTGAGAAAGATTGG + Intergenic
1014833764 6:126133649-126133671 CTTGTATTTCTCAGGAAGATTGG + Intergenic
1014942220 6:127456116-127456138 CTGGAACTTCTTAGGAAGAATGG + Intronic
1015456098 6:133428529-133428551 CTGGAATTCCAGAGGTAGACTGG + Intronic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016351616 6:143175417-143175439 TTGGTGTTCCTGAAGAAGAAGGG - Intronic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1019281207 7:201160-201182 CAGTTATTCCTGAAGACGAATGG - Intronic
1019976347 7:4585001-4585023 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1019977283 7:4593505-4593527 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1020419059 7:7979808-7979830 CTGCTATTGCTGAGCTAGAATGG + Intronic
1020708190 7:11572010-11572032 ATGATATTCCAGAGAAAGAAGGG - Intronic
1020723752 7:11782445-11782467 CTAGAATTACTGAGAAAGAATGG - Intronic
1020886650 7:13826452-13826474 CTGGTAGACCTGAGGATCAATGG - Intergenic
1021170955 7:17397475-17397497 ATGGCATTTCTGAGGAAAAAAGG + Intergenic
1023155464 7:37247197-37247219 TTGGTATGTCTGAGGAACAAAGG + Intronic
1023691485 7:42793379-42793401 CTAGTCTTCCTGTGGAACAAAGG + Intergenic
1024058174 7:45679493-45679515 CTGGGGTTCCTGAGTAAGAAGGG - Intronic
1024367163 7:48534619-48534641 TTGGTTTTCCTGAGGAAGAAGGG - Intronic
1028823493 7:95241635-95241657 CTGTGACTCCTGAGGAGGAATGG - Intronic
1030949488 7:115771708-115771730 CTGATATTCCTAATGAAGGAAGG - Intergenic
1031297147 7:120015057-120015079 CTGTTCTTTCTGAGGAAGTAGGG - Intergenic
1033432312 7:141300369-141300391 ATGGTAGTCCTCAGGAAGAAAGG + Intronic
1033522908 7:142180651-142180673 TTGGCATTCCTGAGAGAGAAGGG - Intronic
1034747238 7:153533783-153533805 CTGGAATGGCTGAGGAAGATGGG + Intergenic
1036291895 8:7500450-7500472 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1037627299 8:20619222-20619244 CTGGGAATCCTGGGGGAGAATGG + Intergenic
1038172467 8:25148906-25148928 CAGCTATTACTGTGGAAGAAGGG - Intergenic
1041197303 8:55412832-55412854 CTGCCATTCCTGATGAACAATGG + Intronic
1041618993 8:59943245-59943267 CTTGTATTCCTGGGGCAGGATGG - Intergenic
1042725233 8:71868161-71868183 CAGGCATTCATGAGGAAGACTGG + Intronic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1047575611 8:126150838-126150860 TTGGCATTCCTGAGAAAGGAGGG + Intergenic
1048303084 8:133265680-133265702 TTTGTTTTCCAGAGGAAGAAAGG - Intronic
1048409428 8:134156639-134156661 CAGGCAATCTTGAGGAAGAAAGG + Intergenic
1048613235 8:136047075-136047097 CAGGTCTTCCTGAGCAAGAGGGG + Intergenic
1048890818 8:138944730-138944752 ATGGCATTCATGATGAAGAATGG + Intergenic
1049032157 8:140046076-140046098 CAGGTGTTCCTCAGGGAGAAGGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1051793714 9:20838997-20839019 CAGGTATTCTGAAGGAAGAATGG + Intronic
1052277356 9:26692220-26692242 TTGGCTTTCCTGGGGAAGAAAGG + Intergenic
1052613210 9:30802493-30802515 ATGGAATTCATGAGGAAGACAGG - Intergenic
1053064980 9:35061827-35061849 CTGGTTTTCCTGAGACTGAAAGG - Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1055422504 9:76159219-76159241 CGGCTATTCCTTAGGTAGAAGGG + Intronic
1055769387 9:79701107-79701129 GTGGCATTCCTGTGGCAGAATGG + Intronic
1055905662 9:81291389-81291411 TTGGTGTACCTGAGGAAGAAGGG - Intergenic
1060500817 9:124152809-124152831 CTTCTATTACTAAGGAAGAAAGG + Intergenic
1061493993 9:130961345-130961367 CAGGGAGTCCTGAGGCAGAAGGG + Intergenic
1186618047 X:11210299-11210321 CTGTTATTCCTGCTGAATAAAGG + Intronic
1186728969 X:12387810-12387832 ATTGTATGCCTGAGAAAGAATGG - Intronic
1186749490 X:12606934-12606956 TGGGTATGCCTGGGGAAGAATGG - Intronic
1189603287 X:42649634-42649656 TCGGTGTTCCTGAGGAAGAAGGG + Intergenic
1190506261 X:51129220-51129242 CTGGTATCCCTGAAAAAGATGGG - Intergenic
1190529654 X:51361851-51361873 CTGGTAGTTCTGAGGAATATGGG + Intergenic
1190636674 X:52441602-52441624 CTGGCATTCATGAGGAAGACTGG + Intergenic
1191914474 X:66186837-66186859 TTGGTATTCCTAAGGAAGAAGGG - Intronic
1193056313 X:77155079-77155101 CTGGTATACCTGAAGTAGATGGG + Intergenic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1193662918 X:84279004-84279026 CTGGTAGTTCAGAGGAAGGAGGG - Intergenic
1194511559 X:94802252-94802274 CTGGTATTACTGATTAAGGAGGG - Intergenic
1196054515 X:111340444-111340466 CTGGTAGTTCTGAGGAATCAGGG + Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1200489946 Y:3812585-3812607 TTGGTGTTCCTAAGGGAGAAGGG + Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic