ID: 976964433

View in Genome Browser
Species Human (GRCh38)
Location 4:91018714-91018736
Sequence GAGGGGGTTCAGCATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976964433_976964439 20 Left 976964433 4:91018714-91018736 CCTTTCTCATGCTGAACCCCCTC 0: 1
1: 0
2: 1
3: 18
4: 260
Right 976964439 4:91018757-91018779 AATCTTTATTTTCACCTACCTGG 0: 1
1: 0
2: 1
3: 16
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976964433 Original CRISPR GAGGGGGTTCAGCATGAGAA AGG (reversed) Intronic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900030372 1:366909-366931 CACGGGGTTCTGCAGGAGAACGG + Intergenic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900051024 1:595973-595995 CACGGGGTTCTGCAGGAGAACGG + Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900179276 1:1304222-1304244 GAGGGGCTCCACCATGGGAAGGG + Intronic
901055728 1:6447945-6447967 GGGGGGGTTCAGCCTGGGATTGG + Intronic
901056382 1:6450380-6450402 GAGGGGGGGCAGGATGAGACTGG - Intronic
901310719 1:8267534-8267556 GAGGGTGCTCAGCAGGAGAGTGG + Intergenic
902463112 1:16594591-16594613 GAGATGGTTCAGCAGGACAAGGG - Exonic
903350659 1:22714526-22714548 GTGGGGGTTGAGACTGAGAATGG + Intronic
903489621 1:23718544-23718566 GAAGGGCTTCACCAGGAGAATGG + Intergenic
903606998 1:24582119-24582141 CAGGAGGTTGCGCATGAGAAGGG - Intronic
903621700 1:24702793-24702815 GAGGGGGCTGAGCAGGAGACTGG - Intergenic
904422939 1:30405723-30405745 CAGGGTGTTCAGCATCAGAGAGG + Intergenic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
906731587 1:48086257-48086279 TAGGGGGATGGGCATGAGAAGGG - Intergenic
907023406 1:51090741-51090763 GAGGGAGTTGAGCAAGAGCAAGG + Intergenic
910844002 1:91587996-91588018 GAGAGGGGTGAGCATGGGAAAGG - Intergenic
912519023 1:110232811-110232833 CAGGGAGTTCAGCAAAAGAAAGG - Exonic
912640605 1:111341971-111341993 GAGGGAGTCGAGCATGAGCATGG + Intergenic
912731264 1:112108194-112108216 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
913091131 1:115477337-115477359 GAGGGAGTTTTGCATGAGACAGG - Intergenic
914445950 1:147750897-147750919 GAGAGGGGTCAGCATGAGCTAGG - Intergenic
914940228 1:152016054-152016076 GAGACGGTTCAGCAGGACAAGGG + Intergenic
915880324 1:159664022-159664044 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
916180405 1:162078531-162078553 GAGGGGGTGGAGCATCTGAACGG - Intronic
918087476 1:181257928-181257950 CAGAGTGTTCAGCATGATAAGGG - Intergenic
918232163 1:182546008-182546030 GAGGGAGTTGAGCAAGAGCAAGG - Intronic
921311702 1:213851075-213851097 GAGGGGGTTGATGATGGGAATGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922106528 1:222517701-222517723 GAGGGGGGGCAGCATGAGCCAGG + Intergenic
922850852 1:228732690-228732712 GATGATATTCAGCATGAGAAGGG + Intergenic
923030616 1:230246598-230246620 GAGGGGGTTGAGGATGACACAGG - Intronic
923051927 1:230395572-230395594 GAGGGGGTTGGGAATGAGAGGGG - Intronic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1063537080 10:6893886-6893908 GAGGGTAGTCAGCAAGAGAATGG - Intergenic
1063956121 10:11269100-11269122 GAGGGGGTTTTGCATGGAAAAGG - Intronic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1067062566 10:43085356-43085378 GAGAGAGTTCAGCAGCAGAAAGG - Intronic
1069461812 10:68602453-68602475 GATGGGGATTAGCAGGAGAAAGG + Intronic
1071246818 10:83773932-83773954 CTGAGGTTTCAGCATGAGAAGGG - Intergenic
1071927361 10:90425760-90425782 GAGGGGCTGAAGCAGGAGAATGG - Intergenic
1072055002 10:91746327-91746349 GAGGGAGTTGAGCAAGAGCAAGG + Intergenic
1074945717 10:118278716-118278738 GATGGGATTGATCATGAGAAAGG + Intergenic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1080832294 11:35906835-35906857 GAGGGGACTTAGCATGAGAATGG - Intergenic
1082109359 11:48257135-48257157 GAGGGGGTTAATCATGAGTGAGG + Intergenic
1082764710 11:57157903-57157925 GAGGGGGCTCAGGAAGAAAAGGG - Intergenic
1082944570 11:58744126-58744148 GAGGGAGTTGAGCAAGAGCAAGG + Intergenic
1085310589 11:75514292-75514314 GAGGGGGAGAAGCAGGAGAAGGG + Intronic
1089624092 11:119740403-119740425 GAGGGAGATCAGAAAGAGAAAGG - Intergenic
1090249425 11:125241041-125241063 GAGGTGGTCCAGCATGGGGATGG - Intronic
1091237241 11:134030591-134030613 GAGGGGGTTCCACAGAAGAAGGG + Intergenic
1092451646 12:8607792-8607814 GGGGGTCTTCAGCATGGGAATGG - Intronic
1094168763 12:27469171-27469193 GAGGGTGTTAAGCATTACAAAGG - Intronic
1096517718 12:52166339-52166361 GAGGTAGTTCTGTATGAGAAGGG + Intergenic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1100266139 12:92978352-92978374 CAGAGGGTTTGGCATGAGAATGG + Intergenic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1101346786 12:103893196-103893218 GAAGGGGTCCATCATGGGAATGG + Intergenic
1101463413 12:104921179-104921201 GAGGGAGTTGAGCAAGAGCAAGG + Intronic
1102593388 12:113974190-113974212 GAGGGGGTTGAGGATGAGCAGGG - Intergenic
1104186037 12:126432584-126432606 GAGGGGGATCAGCTTGAGCCTGG - Intergenic
1106591945 13:31105577-31105599 GAGGGGGTTGAGAATGAGAATGG - Intergenic
1106859835 13:33893918-33893940 GAGGGAGTTCAGCAAGAGCAAGG + Intronic
1107242262 13:38250583-38250605 TAGGGGTGTCAGCATGTGAAAGG - Intergenic
1107368157 13:39708984-39709006 GATGGGGCTCCGCATTAGAAAGG + Intronic
1110657081 13:78012706-78012728 GGGGGGGTGAAGGATGAGAAAGG + Intergenic
1111275383 13:85939359-85939381 GAGGGGGTTCTGTATTGGAAAGG - Intergenic
1111671648 13:91338891-91338913 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
1112392992 13:99002242-99002264 GAGTGGGATCAGAATCAGAAAGG - Intronic
1114069423 14:19095961-19095983 GAGGGGGGACCGCATCAGAAAGG - Intergenic
1115279611 14:31646800-31646822 GAGGGAGCTGAGCAAGAGAAAGG - Intronic
1115360987 14:32502031-32502053 GAGGAGCTTCAGTATGAGGAAGG - Intronic
1118072947 14:62265569-62265591 GAGGGGGGTCAGAATGAAAAGGG + Intergenic
1119221386 14:72910669-72910691 GAGGGGGCTCAGCTGGAGAAAGG - Intergenic
1119788547 14:77329851-77329873 GAGGGAGGTCAGCATGAGGGAGG - Intronic
1120924659 14:89785577-89785599 GAGTGGGTTCATCATCAAAAAGG + Intergenic
1122777387 14:104126928-104126950 GACAGGCCTCAGCATGAGAAGGG - Intergenic
1122825528 14:104368751-104368773 GAGGGGGTCCTGCATGTGGAGGG + Intergenic
1123124009 14:105931823-105931845 GAGGGGGGTATGCATGATAAGGG - Intronic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1126096984 15:45096959-45096981 GAGGGGTTTGAGGATGGGAAAGG - Intronic
1126485450 15:49175370-49175392 TAGGGGGTTTAGCAAGAGAGTGG + Intronic
1128285079 15:66429928-66429950 GAGGAGGTACAGAATAAGAACGG - Intronic
1128767429 15:70259734-70259756 GAGGATGTGCAGCTTGAGAATGG + Intergenic
1128927178 15:71668386-71668408 GAGGGGGTCTGGGATGAGAAGGG + Intronic
1129678713 15:77646074-77646096 AAGGGGCTTCAGCATGAGCCTGG + Intronic
1132539974 16:504166-504188 GAGGGGGTACAGGAGGAGATGGG - Intronic
1132540055 16:504417-504439 GAGGGGGTACAGGAGGAGATGGG - Intronic
1132540091 16:504532-504554 GAGGGGGTACAGGAGGAGATGGG - Intronic
1132661496 16:1063379-1063401 GAGGGGGATCAGCAGGGGAAGGG + Intergenic
1133226749 16:4344505-4344527 GAGGGGGTTCTGTGAGAGAAGGG + Intronic
1133226801 16:4344682-4344704 GAGGGGGTTCCGTGAGAGAAGGG + Intronic
1134549401 16:15132178-15132200 GAGGGGGATAAGGATGGGAAGGG + Intronic
1135510223 16:23076409-23076431 GTAGGGTCTCAGCATGAGAAAGG + Intronic
1136123813 16:28161379-28161401 GAGGAGGTTGAGGCTGAGAAAGG - Intronic
1138421498 16:56902253-56902275 GATGGGTTTCAGCCTGAAAATGG + Intronic
1139053822 16:63157387-63157409 GAAGGGGATCATCAAGAGAATGG + Intergenic
1139421473 16:66851841-66851863 GAGGAGGGTCAGCATCAGCAGGG + Intronic
1141898972 16:86977627-86977649 GGGGGGGTTCAGCCTGAGATGGG + Intergenic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1143227588 17:5319928-5319950 GAGGGAGTTGAGCAAGAGCAAGG + Intronic
1143965579 17:10754518-10754540 GAGGAGGGACAGCTTGAGAAAGG - Intergenic
1144421269 17:15101363-15101385 GAGGGGATTCAGCAGGAGACCGG - Intergenic
1146136659 17:30327854-30327876 AAGCTGGTTCTGCATGAGAATGG - Intronic
1146765843 17:35520815-35520837 GAGGGGGTTGTGCATGTGCATGG - Intronic
1147520147 17:41163409-41163431 GAAGGGGCTCTGTATGAGAATGG + Intergenic
1147700887 17:42394143-42394165 CATGGGGTTCAGCAACAGAAAGG + Intergenic
1147987124 17:44313066-44313088 GAGGGGGCTCAGCAAGACCAGGG - Intronic
1148792247 17:50180013-50180035 AAGGGGGTACTGAATGAGAAGGG - Intergenic
1149285729 17:55162111-55162133 GAGGAGGTTCAGTGTGTGAATGG + Exonic
1151335573 17:73437814-73437836 GAGGCGGTTCTGCAGGAGGAAGG + Exonic
1151765200 17:76130147-76130169 GTGGGGGTGCAGCGTGAGGAAGG + Intergenic
1152760591 17:82105296-82105318 GAGGGGGTTCAGCAGAACAAGGG - Intronic
1152949387 17:83219648-83219670 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1156499742 18:37550133-37550155 GAGGGGGCTCAGCAGGGAAAGGG + Intronic
1157110559 18:44816416-44816438 GAAGGGGTGCAGGAGGAGAAGGG + Intronic
1157741254 18:50095497-50095519 GCTGGGGTTCAGAATGAGAGTGG + Intronic
1160481214 18:79241290-79241312 GAGGAGGGGCAGCAAGAGAATGG - Intronic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1164203939 19:23042208-23042230 AAGGGGGGTCAGCTTGAGATTGG + Intergenic
1164686868 19:30172442-30172464 GAGGGGCTGGAGCAGGAGAAGGG + Intergenic
1165107105 19:33476996-33477018 GAAGGGTTTAAGCAGGAGAATGG - Intronic
1165115671 19:33527075-33527097 GTCGGGGCTCAGAATGAGAAGGG - Intergenic
1166623058 19:44322101-44322123 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
1167035928 19:46994949-46994971 GAGGCAGGTGAGCATGAGAAGGG - Intronic
1167150098 19:47703406-47703428 CAGGGGGTTCAACATGAACAAGG + Intergenic
1167750234 19:51374944-51374966 GTGGGGTTTCAGAATGAGAATGG - Intergenic
1202678773 1_KI270711v1_random:32024-32046 GAGATGGTTCAGCAGGACAAGGG - Intergenic
925384702 2:3454105-3454127 GAGGTGCTTCAGCCCGAGAAGGG - Intronic
925418588 2:3691710-3691732 GAGGGAGTTGAGCAAGAGCAAGG - Intronic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
926311393 2:11678519-11678541 GAGAGGGTTCAGCATGCTTAGGG + Intronic
926929979 2:18027525-18027547 GAGGGGGTGGGGCATGGGAAGGG - Intronic
927015307 2:18953191-18953213 GATGGAGTTCAGAAAGAGAAGGG + Intergenic
927655836 2:24945590-24945612 GAGTGCTTTCAGCATGATAAAGG + Exonic
927902593 2:26831547-26831569 CAGGAAGTTCAGCATGAGACAGG + Intergenic
928424381 2:31166045-31166067 GAGGAGGAGCAGCATGGGAAAGG - Intergenic
929066401 2:37979428-37979450 GTTGGGGTTCAGCATGAGGGAGG + Intronic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930972271 2:57410031-57410053 GAGGAGGTACAGAAAGAGAAAGG + Intergenic
931796886 2:65719792-65719814 CAGGGGGTTCACTTTGAGAATGG + Intergenic
932581272 2:72994100-72994122 CAGGGGGTGCAGCAGGAAAAAGG + Intronic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935138469 2:100329965-100329987 GAGGGAGTTCTGCATTTGAAAGG + Intergenic
935498736 2:103812202-103812224 GAGGGGGTGCAGCAGCAGACGGG + Intergenic
935711858 2:105906091-105906113 GAGAAGGAGCAGCATGAGAAAGG - Intergenic
936959593 2:118059076-118059098 GCAGGGGTTGAGCATGAGCAGGG - Intergenic
937005173 2:118505391-118505413 CAGGAGGTTCATCATGTGAAAGG - Intergenic
937121985 2:119446849-119446871 GAGGGGGATCAGCAGGAGAGTGG + Exonic
937401461 2:121587448-121587470 GAGGGGTTTTAAAATGAGAAGGG - Intronic
938341167 2:130537558-130537580 GGGGGGGTTCAGGAGGAGGATGG + Intergenic
939338834 2:140867267-140867289 GAGGGGGTGGTACATGAGAAAGG - Intronic
940871362 2:158863188-158863210 GAAGGGGTTCAGCATGGGGATGG - Intergenic
942388910 2:175471623-175471645 GATTCGGTTCAACATGAGAAAGG - Intergenic
943458666 2:188141490-188141512 GAGGGGTTTTAGAAAGAGAAAGG + Intergenic
944499163 2:200340572-200340594 GAGGGGGTGCAGCAGGAGGTGGG + Intronic
946313895 2:218897306-218897328 GAGGGGGGTCAGAATGAGGGAGG + Intronic
947714864 2:232334339-232334361 GAGGGGGTGAGGCATGAGAGTGG - Intronic
948056973 2:235015912-235015934 GAGCTGGGTCAGTATGAGAAAGG + Intronic
948437836 2:237966265-237966287 GATGAGGTTCAGCATGGAAACGG - Intergenic
1168761862 20:354803-354825 GAAGGGGTGCAGGATGAGGAGGG - Exonic
1169114736 20:3056811-3056833 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
1170815323 20:19709005-19709027 GAGGGGGAGCAGTATGAGAGTGG + Intronic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1173189128 20:40862853-40862875 GAGGGGGTCCAGCATCTGATGGG + Intergenic
1174144218 20:48439796-48439818 GAGGGGGTAAAGCATGAGCTGGG - Intergenic
1174452348 20:50628190-50628212 GAGTGGGTGCTGCCTGAGAAAGG - Intronic
1174476622 20:50800365-50800387 GAGGGGGAGCAGCAGGAGATGGG + Intronic
1175169727 20:57071752-57071774 AAGGGGGTTTATGATGAGAAAGG - Intergenic
1176242643 20:64082261-64082283 GAGGGGTTTCAGGAAGGGAAGGG - Intronic
1177144897 21:17396944-17396966 AAGGAGATTCAACATGAGAAAGG + Intergenic
1178267912 21:31161397-31161419 GAGGCGGCTCAGAAAGAGAAAGG + Intronic
1178909678 21:36664398-36664420 GAGGGGGTGCAGAAGGAAAAGGG + Intergenic
1179517305 21:41917594-41917616 GGGGGGCTCCAGCATGAGGAGGG + Intronic
1180487893 22:15818524-15818546 GAGGGGGGACCGCATCAGAAAGG - Intergenic
1181258049 22:21577071-21577093 GAGAGGGTGAAGCAGGAGAATGG - Intronic
1181311327 22:21946440-21946462 GAGGGGGTTCAACCTGATCACGG + Intronic
1181618300 22:24070403-24070425 GAGGGGGTTCAGCAGCAAAGGGG - Intronic
1181731424 22:24849736-24849758 GAGAGGGATCAGCCTGGGAATGG + Intronic
1182541756 22:31046861-31046883 GAGGGGGTGGGGCAGGAGAAAGG + Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1183343332 22:37294082-37294104 GAGGGGTTTGAGCAGGGGAAGGG + Intronic
1183478388 22:38049528-38049550 GAAGGGGTGCAGCATGGGCAGGG + Intergenic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1185272560 22:49935762-49935784 TGGGGGGTTCAGGATGAGCAGGG + Intergenic
950578233 3:13845989-13846011 ATGGGGGTTCAGGATGAGACTGG - Intronic
952231589 3:31436561-31436583 GAGGGGGTTCATTTTGGGAAGGG - Intergenic
952238679 3:31507270-31507292 GAGGGGGTTCAGAGTCTGAAAGG + Intergenic
953286196 3:41612257-41612279 GAGGGAGTTCAGCTTGGGGAAGG - Intronic
955055077 3:55447455-55447477 GAGGAGGTTCAGAATGATAGAGG + Intergenic
957229506 3:77493725-77493747 GAGGGGATGAAGCATGGGAACGG - Intronic
960169786 3:114446245-114446267 GTGGGGTTTCAGACTGAGAATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
964514585 3:157494135-157494157 GGGGGAGTTCAGCATGTTAATGG + Intronic
967363082 3:188654247-188654269 GAGGAGGTTCAGAAGGAAAATGG + Intronic
968287880 3:197518837-197518859 GAGGGGGGTCGGCCTGAGGAGGG - Intronic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
974805382 4:66873061-66873083 GAGGGGATGGAGCATGACAAAGG + Intergenic
976964433 4:91018714-91018736 GAGGGGGTTCAGCATGAGAAAGG - Intronic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
982816962 4:159897621-159897643 CAGGTAGTTCATCATGAGAATGG + Intergenic
985468445 5:20564-20586 GAGTGTCTCCAGCATGAGAAGGG + Intergenic
986288363 5:6378039-6378061 GAGGGGGTTACACATGAGAGGGG + Intronic
986454920 5:7908337-7908359 GAGGGAGTTGAGCAAGAGCAAGG - Intergenic
987092651 5:14521849-14521871 CAGCAGGGTCAGCATGAGAAAGG + Intronic
989170919 5:38469730-38469752 GTGGGGGTTCAGAATGAAATGGG + Intergenic
991238509 5:64427645-64427667 GAGGGAGTTGAGCAAGAGCAAGG + Intergenic
992164947 5:74040191-74040213 GAGGGGCTTGATCATGAGCAAGG + Intergenic
993479473 5:88406343-88406365 GTGGGAGTTCTGCATGAAAAAGG + Intergenic
996574218 5:124963852-124963874 GATGGGGTTCTTCATGAGACAGG - Intergenic
997823837 5:137089048-137089070 AAGGGGGCTGAGCAGGAGAATGG + Intronic
998094762 5:139390951-139390973 GAGGGGGGTCTGCATGAGGTGGG - Exonic
998360526 5:141582277-141582299 GATGGGGTTTGGAATGAGAATGG + Intronic
999586511 5:153095301-153095323 GAGGGGGTTAAGCAAGGGAATGG - Intergenic
1001587698 5:172844648-172844670 GAGGGGGCTTAGCATGGGATGGG - Intronic
1002357578 5:178643037-178643059 GAGGGGATTGATCCTGAGAAGGG + Intergenic
1002743617 5:181453463-181453485 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1003294144 6:4809029-4809051 GAGGGCGTACAGAATGGGAATGG - Intronic
1004684324 6:17927977-17927999 GACAGGCTTCAGCAAGAGAAAGG + Intronic
1005296114 6:24428979-24429001 GATGTGATTCAGCATGAGAGAGG + Exonic
1005609105 6:27506450-27506472 GCAGGGGTGCAGGATGAGAAGGG + Intergenic
1006937845 6:37730746-37730768 CGGGGTGTTCAGCATGAGCATGG + Intergenic
1008265782 6:49424549-49424571 GAGGAGTTTAAGGATGAGAATGG + Intergenic
1008296491 6:49784659-49784681 GAGGGGGTTCAGTCTGTGTATGG - Intergenic
1009874972 6:69494470-69494492 GAGGGAGTTAAGCAAGAGTAAGG + Intergenic
1010255648 6:73754291-73754313 AAGAGGGCTCAGCATGGGAAAGG + Intronic
1012061494 6:94489841-94489863 GAGAACATTCAGCATGAGAAAGG - Intergenic
1012144793 6:95667874-95667896 GAGGGAGTTCATGAAGAGAAGGG + Intergenic
1017304799 6:152904784-152904806 GATGGAGTTTTGCATGAGAATGG + Intergenic
1017687152 6:156924978-156925000 CAGTGGGCTCAGAATGAGAAAGG - Intronic
1018967538 6:168500339-168500361 AAGAGGGTTGAGCAAGAGAAGGG + Intronic
1019131270 6:169878364-169878386 GAGGGGGTTGAGCAAAAGCAAGG - Intergenic
1019248476 6:170726692-170726714 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1020392541 7:7674152-7674174 GAGGAGGTCCAGCATGGAAAAGG - Intronic
1024682335 7:51705810-51705832 GAGTGGGGTCAGCAAGAAAATGG + Intergenic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1029125715 7:98293966-98293988 CAGGGGGTCCAGCCTGAGAAAGG - Intronic
1029535304 7:101154424-101154446 GAGGGAGGGCAGCAGGAGAAAGG + Exonic
1031569357 7:123340124-123340146 GAGGGAGTTAAGCAAGAGCAGGG - Intergenic
1032663556 7:134012547-134012569 GAGGGGGTTCAGATAGAGAGGGG + Intronic
1033350672 7:140559400-140559422 GAGATGTTTCAGGATGAGAACGG + Intronic
1034834441 7:154338750-154338772 GAGGGCATTCAGTGTGAGAATGG - Intronic
1035499571 8:80644-80666 CACGGGGTTCTGCAGGAGAACGG + Intergenic
1035670985 8:1417056-1417078 CGGCGGGTTCAGCAGGAGAAAGG + Intergenic
1035781596 8:2232379-2232401 TAGGGGGGTCAGCATGCGGAGGG + Intergenic
1037368074 8:18144161-18144183 AAGGGAGTATAGCATGAGAAAGG - Intergenic
1038216600 8:25567389-25567411 GAGAGGGGTCAGGATGAGAGGGG + Intergenic
1039127669 8:34221414-34221436 CAGTAGGTTCATCATGAGAAAGG - Intergenic
1039986307 8:42451213-42451235 GAGGGGGATGAGGAGGAGAAAGG + Intronic
1039993983 8:42515307-42515329 GAGTAGGTTTAGCATGAGCAAGG + Intronic
1041427498 8:57738946-57738968 CAGGGGGTTTGGCATGAGAATGG - Intergenic
1041648259 8:60275862-60275884 GAGGGGGTTGAGAAGCAGAACGG + Intronic
1043388078 8:79767808-79767830 GAAGGGGCTCAGCGTGGGAAAGG - Exonic
1046018914 8:108640044-108640066 GAGGGGGTTACGAATGAGACAGG - Intronic
1048957056 8:139545974-139545996 GAGGGGGGTCAGCATGGGGGAGG + Intergenic
1049368986 8:142254564-142254586 GAGGGGGATGAGCCAGAGAAGGG - Intronic
1055146713 9:72944342-72944364 GAGGCGTTTCAGCATGAAAAGGG + Intronic
1056027407 9:82513381-82513403 GAGGGGCGTGAGCATGAGATGGG + Intergenic
1056137932 9:83647540-83647562 AAGTGGGCTCAGCATGAGCAGGG - Intergenic
1058118509 9:101112583-101112605 GTGGGGGTTCTGCATGTGGAGGG - Intronic
1059155223 9:111983484-111983506 AGGGGGGTTGAGCAGGAGAAAGG + Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060180924 9:121533199-121533221 GAGAGGGTGCAGGGTGAGAAAGG + Intergenic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1203609436 Un_KI270748v1:83956-83978 CACGGGGTTCTGCAGGAGAACGG - Intergenic
1185830518 X:3298040-3298062 GAGGTGCTTCAGCGGGAGAAAGG - Intergenic
1186912683 X:14185824-14185846 GTGGGGTATCAGGATGAGAAAGG + Intergenic
1189521867 X:41777624-41777646 GAAGGGGATTATCATGAGAAAGG + Intronic
1191204602 X:57820846-57820868 GAGGGGGTTCTGAATGAGGGGGG + Intergenic
1192890702 X:75387704-75387726 GAGGGAGTTGAGCAAGAGCAAGG + Intronic
1194997409 X:100606272-100606294 AAGGGGGTTCAGAAAGAGAGAGG + Intergenic
1200835295 Y:7726327-7726349 GAGGAGGTGCAGCATAGGAAGGG + Intergenic