ID: 976965670

View in Genome Browser
Species Human (GRCh38)
Location 4:91037188-91037210
Sequence ATTGTGTGTTGGGGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 8, 3: 35, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976965670 Original CRISPR ATTGTGTGTTGGGGGACAGA AGG (reversed) Intronic
900460869 1:2801632-2801654 CGTGGGTGGTGGGGGACAGAGGG + Intronic
901034870 1:6330411-6330433 AGCGTGTGTTGGGGGGAAGATGG + Intronic
901437999 1:9261317-9261339 TTGGTGTGCTGGGGGCCAGATGG - Intronic
902177626 1:14662724-14662746 AGTGTGTGTTGGGGAAGGGAGGG + Intronic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
904208300 1:28869252-28869274 ATTGAGAGTTGGGTGACAGATGG + Intergenic
904254250 1:29244375-29244397 ACTGAGGGTTGGGGGACAGGTGG + Intronic
904368197 1:30031059-30031081 AGTGTGTGGTGGGGGACAGAAGG + Intergenic
904405503 1:30285760-30285782 ACTGTGGGTTTGGGAACAGACGG - Intergenic
904458493 1:30661724-30661746 ACTGTGGGTTTGGGAACAGACGG - Intergenic
905112340 1:35604911-35604933 ATTGAGGGTTGGGGCAGAGATGG + Intronic
906484329 1:46222557-46222579 ATTCTGTGTTGGGGAAGGGAAGG + Intergenic
907396858 1:54196967-54196989 AGGGAGTGTGGGGGGACAGAGGG + Intronic
907562516 1:55403659-55403681 GTTGTGTGCTGGGGAGCAGAGGG + Intergenic
907858051 1:58323086-58323108 ATTGTGGGGTGGGGGGCAGGGGG + Intronic
908177848 1:61573526-61573548 ATGGTGGGTTGGGGGGCAGGGGG - Intergenic
908929325 1:69298281-69298303 ATTGTTTTTTGGGGGGCTGAGGG + Intergenic
909410130 1:75340623-75340645 CCTGTGGATTGGGGGACAGAGGG - Intronic
909687071 1:78361772-78361794 ATTGTGTGTGGGGGGGAAGTGGG + Intronic
909710481 1:78644101-78644123 ATTGTTGGTTGGGAGACTGAAGG + Exonic
909936599 1:81558068-81558090 ATTGTGTGATGGGGTACAATGGG - Intronic
910599966 1:89020478-89020500 TGACTGTGTTGGGGGACAGAAGG + Intronic
912827075 1:112915379-112915401 ATGGTGTGTGAGGGGAAAGAAGG + Intronic
913286298 1:117229856-117229878 ATGGGGTGTTGGGGGACATGGGG - Intergenic
913389648 1:118296205-118296227 ACTGTGTGTTGTGGGAGGGAAGG - Intergenic
913430957 1:118789840-118789862 ATTGTCATTTGGAGGACAGAGGG - Intergenic
914231948 1:145770347-145770369 GGTGTGTGTTGGGGGAAAGGGGG + Intronic
914983682 1:152438762-152438784 AGTGTGTGTTTGGGGAGAGGTGG + Intergenic
915081387 1:153354931-153354953 ATAGGGAGTTGGGGGAGAGAAGG - Intergenic
915320211 1:155052120-155052142 ATTGTGTGTTGGGGGGGTGGGGG + Intronic
916071799 1:161174606-161174628 ATGGTGTGGTGTGGAACAGATGG + Intronic
916543950 1:165784454-165784476 AGTGTGGGTTGGGGGGAAGAGGG + Intronic
916804509 1:168245097-168245119 ATTGGGAGTAGGGGGAAAGAGGG + Exonic
917411255 1:174762069-174762091 ACTGAGTGTTGAGGGACAGATGG + Intronic
917649074 1:177058706-177058728 ATTGATTTTTGGGGAACAGATGG + Intronic
917997441 1:180455367-180455389 ATCGGGGGTTGGGGGACAGGGGG + Intronic
918103830 1:181399533-181399555 CTTGGGTGGTGGGGGAAAGAGGG + Intergenic
918109659 1:181444355-181444377 ATTGTGTGATGTGGGAGAGATGG + Intronic
918338884 1:183550805-183550827 GTTGTGTGTTGGAGGAGAGCTGG - Exonic
918626623 1:186663096-186663118 TTTGTGTGTTGGGGGGGAGGAGG - Intergenic
919933975 1:202239383-202239405 GTGGTGTGTTGGGGGACTGGTGG + Intronic
920601307 1:207327588-207327610 ATTGTGTGTGGAGAGAGAGAAGG - Intronic
921082714 1:211755821-211755843 ATTGTATTTTGGGAGATAGAAGG - Intronic
921129875 1:212210573-212210595 AGTTTGTGTTGGGGAAAAGATGG - Intergenic
924056922 1:240133077-240133099 ATTCTTTGTTAGGGGAAAGAAGG - Intronic
924195379 1:241601797-241601819 GTTGTGTGTTGGGGGAGACATGG + Intronic
1062816765 10:506672-506694 ACTGTGTGTTGGGGGATAGGAGG - Intronic
1063888758 10:10607509-10607531 ATTGTGTTTTGGGGGAAATCAGG - Intergenic
1063907802 10:10798696-10798718 ATGGGGTGCTGGGGAACAGACGG - Intergenic
1064248446 10:13688390-13688412 GTTGTGGGGTGGGGGACAGGGGG + Intronic
1065354517 10:24826997-24827019 AATGTGTCTTGGGGTGCAGAGGG - Intergenic
1066453589 10:35553183-35553205 CATGTGAGTTGGGGGGCAGAGGG + Exonic
1067659359 10:48222822-48222844 GTTGTGTGTTGGGGGTGAGGGGG + Intronic
1067682964 10:48451755-48451777 ATTGTGTGTTGGGGGATTTGGGG - Intronic
1069403975 10:68078327-68078349 CTTGTGTTTGGGGGGATAGAAGG - Intergenic
1069581747 10:69571440-69571462 ATTGTGTGTTGGGGAGAGGAGGG - Intergenic
1069866332 10:71505623-71505645 TGTGTGTGCTGAGGGACAGAGGG + Intronic
1070271853 10:74964165-74964187 ATTGGGGGTTGGGGGAAAGAAGG + Intronic
1071441540 10:85701939-85701961 ATTGGTTGTTGGGGAACAGGTGG - Intronic
1071448113 10:85768239-85768261 ATTGTGTGTTGTGTGAAAAATGG - Intronic
1071573236 10:86709367-86709389 GGTGTGTGTTGGGGGAGAGGGGG + Intronic
1071732375 10:88261308-88261330 CTAGTGTGGTGGGGGGCAGAGGG - Intergenic
1072405985 10:95153364-95153386 GTTGTGGGTTGGGGGAAGGAGGG + Intergenic
1072919473 10:99563772-99563794 ATTTTGGGTGGGGGGACAGCCGG + Intergenic
1073477340 10:103762932-103762954 ATTGGCTCTTGGGGGACAGATGG - Intronic
1075038313 10:119087688-119087710 GGTGTGAGTTGGGGGAGAGATGG - Intergenic
1075943311 10:126409843-126409865 AACGAGGGTTGGGGGACAGAAGG - Intergenic
1076331109 10:129668045-129668067 ATTGTGTCTTGCTGAACAGAAGG + Intronic
1077539678 11:3140647-3140669 AATGTGAGCTGGGGGACAGAGGG - Intronic
1077602752 11:3584912-3584934 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1078488058 11:11742253-11742275 ACTGTTTGTTGGGGTACAGGTGG - Intergenic
1079075503 11:17383126-17383148 ACTGTGTGCTAGGGGAAAGAGGG + Intergenic
1079151608 11:17904787-17904809 ATTGTGTTTTGGGTCAGAGAAGG - Intronic
1079405376 11:20140601-20140623 GCTGTGTGTTGAGGGAGAGAGGG + Intergenic
1080312935 11:30915105-30915127 GGTGTGTGTTGGGGGAAGGATGG + Intronic
1080370995 11:31643118-31643140 GTTGTGTGTTGGGAGAGAGCGGG - Intronic
1081615557 11:44588726-44588748 CATGTGTCTTGGGGGTCAGAGGG + Intronic
1081880671 11:46448197-46448219 ATTGTGTTTTGTGGCCCAGAAGG - Intronic
1081924752 11:46816078-46816100 ATTGTGTGTTGGGGGGATGGGGG - Intronic
1082222320 11:49654665-49654687 TTTGTTTATTGGGGGACAGTTGG + Intergenic
1083082355 11:60107486-60107508 ACTGTGTGTTGAGGGGCAGGGGG + Intergenic
1083544664 11:63539294-63539316 CTTGTGGGATGGGAGACAGAAGG - Intronic
1083619398 11:64041508-64041530 AGGGTGTGTTGGGGGACACCTGG + Intronic
1083935147 11:65866081-65866103 AGCCTGGGTTGGGGGACAGACGG - Exonic
1084258639 11:67959441-67959463 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1084814103 11:71635739-71635761 ATGGTGTGGTGGTTGACAGATGG + Intergenic
1085149134 11:74234076-74234098 ATTGGATGTTGGGAGAGAGACGG + Intronic
1085297865 11:75441143-75441165 ATGGTGAGTTGGGGGGCAGAGGG - Exonic
1085554301 11:77405821-77405843 ATTGTTAGTTGGCAGACAGAAGG - Intronic
1087850899 11:103028142-103028164 ATTGTTTGTTTGGGGAGATATGG - Intergenic
1088587552 11:111372833-111372855 GTTGTGTGTTGGGAGGGAGAAGG + Intronic
1088751654 11:112847175-112847197 TGTGTGTGTTGGGGTACAGGTGG + Intergenic
1089040888 11:115448645-115448667 AATGTGTGTTGGGGGGTAGGAGG + Intronic
1090268748 11:125371094-125371116 ACTGTGGGGTGGGGGACGGAGGG + Intronic
1090485471 11:127108648-127108670 AGTGTGTGTTTGGGGACGGGGGG - Intergenic
1091143314 11:133254729-133254751 ATTGTGTGTCTGGGAACAGCTGG + Intronic
1092429975 12:8400450-8400472 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1095273235 12:40246877-40246899 GGTGTGTGTTGAGGGGCAGAGGG - Intronic
1095495034 12:42775394-42775416 ATTTTGTGTTGGGAGGCAGAGGG - Intergenic
1097019519 12:56009965-56009987 ACTGTGTGTGGGGGGGCAGGGGG - Intronic
1097142173 12:56911094-56911116 ATTATGTATTGTGGGACAGCTGG - Intergenic
1098077286 12:66745898-66745920 ATTGGGTGTTGCTGAACAGAGGG - Intronic
1099742297 12:86655180-86655202 ATTGGGGGCTGGGGGACAGGGGG - Intronic
1100158674 12:91832085-91832107 GTTGTGGGGTGGGGGACTGAGGG + Intergenic
1100186951 12:92148960-92148982 TTTGTGTGTTGCGGGGCAGAGGG + Intergenic
1101599645 12:106197917-106197939 AATGTGGGTGGGGGGAAAGAGGG - Intergenic
1101874462 12:108589428-108589450 TTTGTGGGTGGGGAGACAGAAGG + Intergenic
1102241227 12:111325890-111325912 ATAGTGTGTTGGGGGAGGGGTGG + Intronic
1102241236 12:111325922-111325944 ATAGTGTGTTGGGGGAGGGGTGG + Intronic
1102438840 12:112946293-112946315 ATTTTGGGATGGGGGATAGACGG + Intronic
1102558707 12:113747100-113747122 ATTGTGTGGGGTTGGACAGAGGG - Intergenic
1102653789 12:114462963-114462985 AGTATGTCTTGGGGGAGAGAAGG + Intergenic
1102781211 12:115566471-115566493 ATTGTGTGTTGGGGGTGGGTGGG - Intergenic
1102806130 12:115782512-115782534 AATGTGTGTTGGGTGGCAGGAGG - Intergenic
1103252516 12:119512489-119512511 ATGCTGTGATGGGGGTCAGAAGG + Intronic
1103648940 12:122418077-122418099 ATTGTATGTTAGGTGACACATGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1106353511 13:28956937-28956959 AGGAAGTGTTGGGGGACAGAGGG + Intronic
1106383475 13:29262845-29262867 CTTGGGTCTTGTGGGACAGATGG + Intronic
1106778968 13:33037114-33037136 ATTGTGTCTTGGGGAACATTGGG + Intronic
1107298946 13:38945755-38945777 ATCGTGTTTGGGGGGTCAGAGGG + Intergenic
1107962568 13:45571481-45571503 TTTATGAGTTGGGGGACAGGGGG + Intronic
1108487300 13:50939968-50939990 ATTGTGAGTTGTGGGACAGTTGG + Intronic
1110266903 13:73548589-73548611 ATTGTGTGTTTGAGATCAGATGG + Intergenic
1110663703 13:78090367-78090389 TTTGTGTGTAGGGTGAGAGATGG - Intergenic
1111133148 13:84001514-84001536 TATGTGTGTTGGGGGATGGAGGG + Intergenic
1111166525 13:84464280-84464302 ATTGTGTGGTAGGAGACAGATGG - Intergenic
1111507439 13:89212040-89212062 TGTGTGTGTTGGGGGAGAGGTGG - Intergenic
1113859658 13:113472999-113473021 ATAGAGAGATGGGGGACAGAGGG - Intronic
1115183435 14:30656431-30656453 ATTCTTTGTTGGGGGGCAGGGGG + Intronic
1115377130 14:32689346-32689368 AATAGGTGTTGGTGGACAGATGG + Intronic
1116118477 14:40690645-40690667 ATTGTGTGTTAAGGGATAGAGGG - Intergenic
1116429412 14:44828699-44828721 ATTGGGTATTGTGGGAAAGAAGG - Intergenic
1117513771 14:56479706-56479728 TGTGTGTGTTGGGCAACAGATGG + Intergenic
1120994317 14:90404858-90404880 ATTTTGTGTGTGTGGACAGAAGG - Exonic
1121774807 14:96583659-96583681 AGTGTGTGTTGGGGGAGGGCGGG + Intergenic
1122117530 14:99535342-99535364 CTTGGGTGTTGGGGGCCAGCTGG - Intronic
1122327227 14:100890157-100890179 CTTGAGTGTTGGGGGGAAGAGGG - Intergenic
1122442098 14:101739009-101739031 ATTGTGTGCTGCTGGGCAGAAGG + Intergenic
1124197755 15:27647700-27647722 AAGGTGTGGTGGGAGACAGAGGG - Intergenic
1124448143 15:29758213-29758235 ACTGTGTGTCGGGGGTGAGAGGG + Intronic
1126214735 15:46142300-46142322 GTTGTGGGGTGGGGGACTGAGGG - Intergenic
1126282400 15:46970018-46970040 TGTGTGTGTTGGGGGAGGGAGGG - Intergenic
1126924716 15:53571140-53571162 AATGGGTGGTGGGGGAAAGAGGG + Intronic
1127062458 15:55200896-55200918 TCTGTGTGTTTGGGGACAGAGGG + Intergenic
1127169873 15:56290203-56290225 TGTGTCTGTTGGGGGGCAGAGGG + Intronic
1127390032 15:58497898-58497920 ATTGTGTGTTGGGGGAGAGGAGG - Intronic
1127465132 15:59236729-59236751 TTTGTGTGATGGGGGAGACAAGG - Intronic
1127950622 15:63802005-63802027 ACTGTGTATTGGGGGAGACATGG - Intronic
1128442126 15:67720429-67720451 ATTATGTGTTTTGGGACAGCAGG + Intronic
1129080388 15:73034094-73034116 AGTGTGTGTTGGGTGACTTAAGG + Intergenic
1130510235 15:84583159-84583181 ATTGTGTATTGGGGGAAATGGGG - Intergenic
1131545494 15:93312646-93312668 AGTGGGTGGTGGGGGGCAGATGG + Intergenic
1131573836 15:93566654-93566676 TGTGTGTGTTGGGGGACGGAGGG - Intergenic
1132048482 15:98586751-98586773 ATTGTGTTTTGTGTGGCAGAAGG + Intergenic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132925737 16:2428440-2428462 ACTGTCTGGTGGAGGACAGAGGG - Intergenic
1133018085 16:2954116-2954138 ATTGTGTGCTGGAGCGCAGAGGG - Intergenic
1133211889 16:4267907-4267929 ATGGTGTGTTCTGGGACCGAGGG - Intronic
1133366226 16:5212433-5212455 ATGGTGTGGTGGTTGACAGATGG + Intergenic
1135298002 16:21300247-21300269 AGTGTATGTTGGAGGACAAAAGG - Intronic
1135375653 16:21944744-21944766 AGTGTATGTTGGAGGACAAAAGG - Intergenic
1136094079 16:27941706-27941728 TTTGTCTGTTGAGGGACAGGTGG - Intronic
1136475863 16:30513068-30513090 AGTGTGGGTTGGGGGAGAAATGG + Intronic
1139198202 16:64945891-64945913 CCTGTGTGTAGGGGGAAAGAGGG + Exonic
1139251699 16:65502620-65502642 ATAGTGTGCTGGGGGAGAAAGGG + Intergenic
1139261597 16:65599568-65599590 ACTGTGTGTTGGGGGTGAGATGG + Intergenic
1139628297 16:68209825-68209847 TGTGTGTGTTGGGGGGCAGGGGG - Intronic
1140218931 16:73029519-73029541 AGTGTGTGTTGGACGACGGAAGG + Intronic
1140657404 16:77155011-77155033 ACTGTGTGTTGGGGGATAGAGGG + Intergenic
1140679766 16:77373689-77373711 ATAGGTTTTTGGGGGACAGATGG - Intronic
1141523463 16:84596708-84596730 AGTGTGTGTGTGGAGACAGAGGG - Intronic
1142002070 16:87669843-87669865 GTTGTGTGTTAGGGGACCGGAGG + Intronic
1143968981 17:10778822-10778844 AGTGGGTGTTGGGGGACAGTGGG - Intergenic
1144513904 17:15901719-15901741 ATTGTGTTTTAGGAGCCAGAGGG - Intergenic
1144872792 17:18381130-18381152 ACCGTGTGTTAGGGGACAGGCGG - Intronic
1147211949 17:38877059-38877081 TGTGTGTGTTGGGGTGCAGAGGG - Intronic
1149046104 17:52247045-52247067 TTTGTGTGTGGGGGGGCAGGAGG + Intergenic
1149661767 17:58337896-58337918 CTTGTGGGTTGGGGGGCAGAGGG + Intergenic
1149814808 17:59713247-59713269 GTTGTGGGTTGGGGGAAGGAGGG + Intronic
1149951270 17:60989677-60989699 TGTGTGTGTTGGGGGGCAAAGGG + Intronic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1155746102 18:29357937-29357959 ACTTAGTGTTGGGAGACAGAAGG + Intergenic
1156056385 18:33009608-33009630 AATGTGTGTTGGGGAAGGGATGG - Intronic
1156650219 18:39216902-39216924 ATTGTGTGTTGGGGGGGATGGGG - Intergenic
1156675452 18:39522457-39522479 ATTCTGGCCTGGGGGACAGAGGG - Intergenic
1158987537 18:62834078-62834100 ATTGTCTGTTGTGGGTCAGTGGG + Intronic
1160785061 19:896531-896553 ATTGTGTTTTGGGGGAAAGTGGG - Exonic
1161725687 19:5927254-5927276 ATTGTGTGGTGGGGAAGGGATGG - Intronic
1162355922 19:10184773-10184795 AGTGTCTGTTGGTGGAGAGAAGG + Intronic
1163207329 19:15813187-15813209 ATTGTGTGCAGGCGGAGAGAGGG + Intergenic
1164534789 19:29077004-29077026 AGTGTGTGGTGGGGGAAAGGAGG - Intergenic
1164944838 19:32284727-32284749 ATTGTTTATTGGGGAACAGGTGG - Intergenic
1165423864 19:35735110-35735132 AGTGAGGGTTGGGGGACACAGGG + Intronic
1166675036 19:44735344-44735366 ATTATTTGTTGGTGGGCAGAAGG - Intergenic
1166830128 19:45634302-45634324 ATGGTGAGATGTGGGACAGAGGG - Exonic
1167749967 19:51373413-51373435 AGGGGGTGTTGGGGGACATAAGG + Intergenic
1167977608 19:53242981-53243003 ACAGTATGTTGGGGGACAGTAGG + Intronic
926211402 2:10873513-10873535 GTTGTTGGTTGGGGGAAAGAAGG - Intergenic
927574153 2:24187355-24187377 TGTGTTTGTTGGGGGACAGGAGG - Intronic
928476518 2:31632563-31632585 CTTGAGCGTTGGGGGCCAGAAGG + Intergenic
928871728 2:35988556-35988578 CTTGGGAGTTGGGGGAAAGAAGG + Intergenic
929275352 2:40019365-40019387 TTTGTGTGTTTGGGGCTAGAGGG + Intergenic
930383037 2:50656188-50656210 TTTGTGTGTTTGGGGGCAGGGGG - Intronic
931222489 2:60300440-60300462 TGTGTATTTTGGGGGACAGAAGG - Intergenic
932013106 2:67998233-67998255 TATGTGTGTTGGGGGGCAGTTGG - Intergenic
933406833 2:81871333-81871355 CTTGTGTGTTGAGGAAAAGATGG + Intergenic
935092830 2:99912967-99912989 ACAGTGTGTTGGGGCGCAGATGG - Intronic
935122624 2:100196214-100196236 ATTGTGGGGTGGGGGAAAGAGGG - Intergenic
935655670 2:105420685-105420707 ATTGGGAGGTGGGGGGCAGAGGG + Intronic
935689060 2:105714077-105714099 AATGTGTCTTGGGTCACAGAGGG + Intergenic
935804516 2:106732689-106732711 GCTGTGTGATGGGGGAAAGAAGG + Intergenic
935865692 2:107385336-107385358 ATTGTGTGTTTTGGGAGAGGTGG - Intergenic
936166244 2:110122175-110122197 ATTGTGTGGTTGAGGGCAGAAGG + Intergenic
936370847 2:111901025-111901047 TATGTGTGTTGGGGGGCAGAGGG - Intronic
937097002 2:119242059-119242081 AGTGTGGGTTGGGGGAAAGGGGG - Intronic
937470531 2:122170348-122170370 CCTGTGTGTTGGGGGTCACAAGG + Intergenic
938575022 2:132595638-132595660 ATTCTGTGTTGGGGGAGAGTGGG + Intronic
939021448 2:136962530-136962552 ATTGTGTGTGGGTGGAAAGGAGG + Intronic
939030541 2:137070707-137070729 GTTGTGGGGTGGGGGACAGGGGG - Intronic
939091748 2:137787851-137787873 ATTGGGAGCAGGGGGACAGAGGG - Intergenic
940535962 2:154944561-154944583 GTGGTGTGTTGGGGGAAAGGAGG + Intergenic
942396233 2:175552694-175552716 CTTGGGTGTTGGGGGGCAGGGGG - Intergenic
944069366 2:195652375-195652397 TTTGTATTTTGGGGGAGAGACGG - Intronic
944367999 2:198947205-198947227 ATTGTGAGTTGAAGGAAAGATGG - Intergenic
945384706 2:209183266-209183288 GTTGTGTGTTGGTGGGGAGAAGG - Intergenic
945788281 2:214272440-214272462 GTTGTGGGTTGGGGGGCAGGGGG - Intronic
945958147 2:216105478-216105500 TATGTGTGTTGGGGGACAGAAGG - Intergenic
1169600027 20:7247933-7247955 ATTCTGAGTTGGGGGCCAGTTGG + Intergenic
1169637874 20:7714744-7714766 ACTGTGTGTTGGGGGTGAGGAGG + Intergenic
1170639109 20:18136332-18136354 AAAGTGGGTTGGGGGACTGAGGG - Intergenic
1171937876 20:31293250-31293272 TTTGTGTGCTGGGGGAGGGAGGG + Intergenic
1172113414 20:32560484-32560506 ATTGTTTGTTAGGTGACAGTTGG - Intronic
1172888391 20:38246878-38246900 ATTGTGGGTTGGGAGGCAGGAGG - Intronic
1174096323 20:48092417-48092439 ATTGGGGGTGGGGGGACAGGTGG + Intergenic
1174122444 20:48276380-48276402 ATCGTGGGGTGGAGGACAGAAGG + Intergenic
1174484977 20:50855469-50855491 ATTGTGGCCTGGGGGACAGGGGG - Intronic
1175298656 20:57927346-57927368 ATTGGGTGTTGGGAGGGAGATGG + Intergenic
1175569238 20:60006534-60006556 TCTTTGTGTTGGGGGAGAGAGGG - Intronic
1176245414 20:64094607-64094629 AGTGTGTGGGGGGGGACAGTGGG + Intronic
1177674715 21:24281678-24281700 ATTCTGTTTTGGGGTATAGAGGG - Intergenic
1180704982 22:17803907-17803929 ATTGGGTATGGGGGGACAGGAGG - Intronic
1182032881 22:27173984-27174006 TTTGTGTGTTGTGGGGGAGAGGG - Intergenic
1182667250 22:31968795-31968817 CGTGTGTGTTGGGGGTCACAGGG - Intergenic
1183667700 22:39254906-39254928 ATTGTTTGTGAGGGGCCAGAGGG - Intergenic
1184058425 22:42067443-42067465 GGTGTGTGTTGGGGGAGAGGTGG - Intronic
1185278375 22:49959653-49959675 GTTGAGAGTTGGGGGCCAGAGGG - Intergenic
1185293691 22:50041911-50041933 GTTGGGTATTGGGGCACAGAGGG - Intronic
951229541 3:20161001-20161023 TTTATGTGTTGGGGGAGAGATGG - Exonic
951750878 3:26035095-26035117 GTGGTTTTTTGGGGGACAGAGGG + Intergenic
952803082 3:37315940-37315962 AATGTGTGTTGAGGGAATGAGGG + Intronic
953248001 3:41213993-41214015 CATGTATGGTGGGGGACAGAAGG + Intronic
953390958 3:42533507-42533529 ATTGTAAGTTGGGGGAAATAAGG - Intronic
954380443 3:50216239-50216261 AACGTGTTTTGTGGGACAGAGGG + Intronic
954537357 3:51371168-51371190 TGTGTGTGTTTTGGGACAGAAGG + Intronic
957073597 3:75583956-75583978 ATGGTGTGGTGGTTGACAGATGG - Intergenic
957637515 3:82806050-82806072 ATTGTGTGTGTGAGGACGGAAGG - Intergenic
957991420 3:87631928-87631950 ATTGGGGGTTGGGGGAAAGGGGG + Intergenic
958256022 3:91325709-91325731 ATTGTCTCTTGGTGAACAGAGGG - Intergenic
958481518 3:94651049-94651071 ACAGTCTGTTGGGTGACAGAGGG - Intergenic
959236136 3:103724336-103724358 ATTGGGGGTTGGGGGAGACAGGG + Intergenic
959425799 3:106186536-106186558 ATTGTGTGTAGGGGGTTGGAGGG - Intergenic
959483329 3:106899621-106899643 ATTTTGTGTCAGGGCACAGATGG - Intergenic
960030607 3:113050696-113050718 GTTGTGGGGTGGGGGAAAGAGGG + Intergenic
960171855 3:114471692-114471714 ATTGTGTGTTGGAGGTCAGAGGG + Intronic
961280484 3:125762764-125762786 ATGGTGTGGTGGTTGACAGATGG + Intergenic
961613482 3:128160106-128160128 TTTGTGGGTTAGTGGACAGAAGG + Intronic
961873915 3:130006772-130006794 ATTGTGTGGTGGTTGACAGATGG - Intergenic
962378078 3:134875308-134875330 GCTTTGTGTTGGCGGACAGAGGG + Intronic
963068916 3:141286560-141286582 GTTGTGTGTTGGAGGAAAGAAGG + Intronic
963430548 3:145196884-145196906 GTTGGGGGATGGGGGACAGAGGG - Intergenic
965132663 3:164721974-164721996 ATAGTTTTTTGGGGAACAGATGG + Intergenic
965857982 3:173112117-173112139 AGTGTGTGTAGGGGGAGAGTGGG - Intronic
966920532 3:184608475-184608497 ACTGTGTGGTGGGGGAAAGTGGG + Intronic
967028817 3:185586982-185587004 TCTGTGTGTTTGGGGCCAGAAGG + Intronic
967409690 3:189154763-189154785 GGTGTGTGTTGGGGGAGAGGGGG + Intronic
967463625 3:189776759-189776781 ATTGTTTGCTGAGGGTCAGAGGG + Intronic
967652781 3:192007454-192007476 GTGGTGGGTTGGGGGACAGAGGG - Intergenic
968015308 3:195326518-195326540 TGTGTGTGTTGTGGGGCAGAGGG - Intronic
969153324 4:5188713-5188735 GTTGTGTGTAGGGGGAGAAAGGG - Intronic
969736768 4:8997033-8997055 ATGGTGTGGTGGTTGACAGATGG + Intergenic
969795958 4:9528616-9528638 ATGGTGTGGTGGTTGACAGATGG + Intergenic
970175990 4:13339932-13339954 ATTCTGTGTTGGAGTTCAGATGG - Intergenic
970797106 4:19926070-19926092 CTTGTGTGGTGGGAGGCAGAAGG - Intergenic
971005369 4:22368823-22368845 TTTGTCTGTTGGTGGACATAAGG - Intronic
971737767 4:30478788-30478810 ATTGTATGTTGGGGGAGAGAAGG + Intergenic
972330173 4:38057101-38057123 ATTGGGTGGTGGGGCACAGGAGG - Intronic
976644975 4:87377796-87377818 ACAGTGTGTTGGGGGACTGAGGG + Intronic
976950345 4:90821034-90821056 AGTGTGTGTTGGGGGAAATAAGG + Intronic
976965670 4:91037188-91037210 ATTGTGTGTTGGGGGACAGAAGG - Intronic
977104983 4:92871032-92871054 ATGGGGTGTAGGGGGAGAGAAGG - Intronic
977380312 4:96264431-96264453 GGTGTGTGTAGGGGGACACAGGG + Intergenic
977779524 4:100964383-100964405 ATAGGGTTTTGGGGGACAGGTGG - Intergenic
978103565 4:104873676-104873698 ATTTTCTGTTGGGGGAGAAAAGG + Intergenic
978105993 4:104902369-104902391 ATTGTGTGGTGGGAGAAAGGGGG + Intergenic
979499219 4:121419393-121419415 AATGTGTGTTTGGAGGCAGATGG + Intergenic
982430590 4:155317714-155317736 CATGTGTGTTTGGGGAGAGAGGG - Intergenic
982926532 4:161343863-161343885 TGTGTGTGTTGGGGGACAGAGGG + Intergenic
983353526 4:166625541-166625563 ATTTTCTATTGGGAGACAGAGGG - Intergenic
983647023 4:170002234-170002256 ATGATGTGGTGGGGCACAGAGGG + Intronic
983879635 4:172918530-172918552 TGTGTGTGTTGGGGGAAGGAAGG - Intronic
984600680 4:181722899-181722921 ATTGTGTGTAGGGGTCTAGAAGG + Intergenic
984753569 4:183302729-183302751 TTTGTGTCTTGAGGGACAGTGGG - Intronic
986953445 5:13120305-13120327 ATTGTGTGCAGGGAGGCAGAGGG + Intergenic
987944371 5:24585386-24585408 TTTGTGTGTTGGTGGAGGGAAGG - Intronic
990989933 5:61674812-61674834 GTTGTGTGTGGGATGACAGAGGG + Intronic
992488794 5:77220832-77220854 ATTGTGTGCTGGGGAGCTGAGGG + Intronic
992522273 5:77566647-77566669 CTTGTGTGGTGGGGGGCAGAGGG + Intronic
992627181 5:78646953-78646975 ATTGTGTGTTGTAGGAGAGGGGG - Intronic
992873073 5:81025443-81025465 TGTGTGTGTTGGGGCACAGGTGG + Intronic
994883686 5:105529872-105529894 AGTGTGTGATCGGGGTCAGAGGG + Intergenic
994914815 5:105961856-105961878 AATGTGAGTTGGGGGGGAGATGG - Intergenic
995183036 5:109246694-109246716 AGTGTGTGATGGGGGCCTGATGG + Intergenic
995252797 5:110013766-110013788 ATTGCTTTTTGCGGGACAGAAGG - Intergenic
995723183 5:115158088-115158110 ATAGTTTATTGGGGTACAGATGG - Intronic
996063581 5:119057477-119057499 ATTGTAAGATGGGGGACAGTGGG + Intronic
997392194 5:133526317-133526339 TTTGAGTGTTGAGGGAAAGAAGG + Intronic
999298792 5:150477470-150477492 TGTGTGTGTTGGGGGAGGGAGGG + Intergenic
999299970 5:150485370-150485392 GGTGTGTGTTGGGGGAGGGAGGG + Intergenic
999620576 5:153468467-153468489 ATGGGGTGTTGGGGAACAGAAGG - Intergenic
999944061 5:156576069-156576091 ATTGTGGGGTGGGGGGCAGGGGG - Intronic
1001731569 5:173964395-173964417 CTTGAGTGTTTGGTGACAGAAGG + Intergenic
1002717420 5:181236284-181236306 TTTGTGTGTAGGGGGATTGAGGG + Intergenic
1003129464 6:3383026-3383048 ATTGTGTGTTAGGGTGAAGATGG + Intronic
1004021837 6:11783054-11783076 AGTATGTGTTGGGAGACGGACGG - Intronic
1004147102 6:13078013-13078035 ATTGTGTGATGGGGGACCCCTGG - Intronic
1005020589 6:21414566-21414588 ATTGTATGTTGGGGGAAAAAAGG - Intergenic
1006240851 6:32677535-32677557 GTTGTGGGGTGGGGGAGAGAGGG - Intergenic
1007152618 6:39709287-39709309 ATTGTGTGTTGTCGGAGGGATGG + Intronic
1008125551 6:47664228-47664250 AATGGGTGATGGGGGACAAATGG + Intronic
1008663775 6:53696379-53696401 TTTCTGTCTTGGGTGACAGACGG - Intergenic
1008862802 6:56170567-56170589 TATGTGTGTTGGGGAAAAGAGGG - Intronic
1008999317 6:57695463-57695485 ATTGTCTCTTGGTGAACAGAGGG + Intergenic
1009187806 6:60594868-60594890 ATTGTCTCTTGGTGAACAGAGGG + Intergenic
1011514354 6:88136132-88136154 ATGGTGAGTTGGGGGTAAGAGGG - Intergenic
1012569713 6:100708669-100708691 ATTGTGTTTTGGGGGATGGAGGG - Intronic
1012959014 6:105602833-105602855 ACTGTGGGGTGGAGGACAGAAGG - Intergenic
1013699018 6:112740235-112740257 ATTGTGTCTTGAGGAATAGAGGG + Intergenic
1014061713 6:117079529-117079551 TGTGTATGTTGGGGGACACAGGG + Intergenic
1014459993 6:121684645-121684667 ACTGTGTTTTGGGCCACAGAAGG + Intergenic
1016131916 6:140484542-140484564 ATTATTGGTTGGGGGAAAGAAGG - Intergenic
1016344778 6:143101409-143101431 ATTATTGGTTGGGGGAAAGAGGG + Intronic
1016840894 6:148524381-148524403 AATGTGTGTTGTGGGGCACAGGG + Intronic
1017129008 6:151092067-151092089 AATGTGTCTTGGGGGTGAGAAGG + Intronic
1018870020 6:167775588-167775610 TGTGTGTGTTGAGGGGCAGAGGG - Intergenic
1020998500 7:15296718-15296740 ATTGTGGTTTGGGGTAGAGAGGG - Intronic
1021026017 7:15667605-15667627 TGTGTGTGTTGGGGGACCTAGGG + Intronic
1021162801 7:17297848-17297870 ATTGTATGTAGGGGGAGTGAAGG - Intergenic
1021860726 7:24903680-24903702 ATTGAGTGTTGGCAGACACAGGG - Intronic
1022421935 7:30231410-30231432 ATTGTCTCTTGGGCAACAGATGG + Intergenic
1022838567 7:34140551-34140573 ATTGTGTCTGTGGAGACAGAGGG + Intronic
1023971751 7:44996759-44996781 GGTGTGTGTTGGGGGAAAGTAGG + Intergenic
1024869289 7:53943093-53943115 ATTGTGTGTGTGGGTGCAGATGG - Intergenic
1026029821 7:66781509-66781531 ATTGGGTGGTGGGGGACAAGGGG - Intronic
1026335494 7:69391007-69391029 ATTGTGTGCTGGGATACAGCTGG - Intergenic
1026599830 7:71768688-71768710 AATGTGTGTGGTGGGGCAGAGGG + Intergenic
1027371892 7:77514964-77514986 ATGGTGTGTTGGGGCAAACAGGG + Intergenic
1027751587 7:82154470-82154492 GTTGTGTGGTGGGGGACAAGGGG + Intronic
1027845302 7:83365152-83365174 TGTGTGTGTTGGGAGAGAGAGGG + Exonic
1028270950 7:88788347-88788369 TTGGTGTGTTGAAGGACAGAAGG - Intronic
1029232352 7:99081022-99081044 ATTGTGAGTTGGGGGTCAGGGGG - Intronic
1029887212 7:103885584-103885606 GTTGTGGGTTGGGGGACTTAGGG + Intronic
1030711370 7:112753967-112753989 ATTGTGTGTTAGGGGAGGAAGGG - Intergenic
1031011673 7:116530583-116530605 ATTGGGTCATGGAGGACAGATGG + Intronic
1031465092 7:122099810-122099832 TATGTGTGTTGGGATACAGAAGG - Intronic
1032185987 7:129726968-129726990 ATTGAGTGTTTGAGGACAGAAGG - Intronic
1032791416 7:135245848-135245870 TATGTGTTTTGGGGGAGAGAGGG - Intronic
1035023787 7:155813920-155813942 TGTGTGTGGTGGGGGAGAGAAGG + Intergenic
1035433624 7:158841095-158841117 ACTGGGAGTTGGGGGACAGTTGG - Intergenic
1035722555 8:1802924-1802946 ATTGTGTATTTGGTGAAAGAAGG + Intergenic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1036241842 8:7088225-7088247 ATGGTGTGGTGGTTGACAGATGG + Intergenic
1036259993 8:7231878-7231900 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1036306620 8:7607644-7607666 ATGGTGTGGTGGTTGACAGATGG + Intergenic
1036312036 8:7690447-7690469 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1036357468 8:8055632-8055654 ATGGTGTGGTGGTTGACAGATGG + Intergenic
1036830889 8:12018859-12018881 ATGGTGTGGTGGTTGACAGATGG - Intergenic
1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG + Intronic
1038606940 8:29016424-29016446 ATAGTGTATTGGGGGATAAAGGG + Intronic
1038651884 8:29411569-29411591 CTTGTGTCTTGGAGTACAGATGG + Intergenic
1039742086 8:40392231-40392253 CTTCTGAGTTGGAGGACAGAAGG - Intergenic
1040515485 8:48130915-48130937 ACTGTGTGTTGGGGGTAAGGGGG - Intergenic
1043641580 8:82458143-82458165 GTTGTGGGGTGGGGGACAAAGGG - Intergenic
1044269963 8:90230421-90230443 ATAATTTGTTGGGGGACAGTGGG - Intergenic
1045799978 8:106090840-106090862 ATTGTTCGTGGTGGGACAGAAGG + Intergenic
1046057751 8:109098643-109098665 AGGGTGTGTTGGGGGACAGAGGG - Intronic
1047415514 8:124661757-124661779 ATGGTGAGTTGTGGGAAAGAGGG - Intronic
1047506615 8:125485658-125485680 CTTATCTGTTGGGGGATAGAAGG - Intergenic
1048697232 8:137041403-137041425 ATTAAGAGTTGGGTGACAGAGGG + Intergenic
1049956880 9:701521-701543 ATTCTTTGTTGGGGGAAGGAGGG + Intronic
1050099771 9:2106593-2106615 GTGGTGGGATGGGGGACAGAAGG - Intronic
1052048895 9:23823737-23823759 TTCGTGTTTTGGGGAACAGAAGG - Intronic
1052954262 9:34241120-34241142 ATTGGGTGGTGGGGTAAAGATGG + Intronic
1054754011 9:68938834-68938856 ATTCTGTGTTTGAAGACAGAGGG - Intronic
1055426014 9:76197710-76197732 ATCTTGTGGTTGGGGACAGAAGG - Intronic
1055707976 9:79028583-79028605 TGTGTGTGTTGGGAGGCAGAGGG - Intergenic
1056167831 9:83956222-83956244 AGTGTGTGGTGAGGTACAGAGGG - Exonic
1056762407 9:89424835-89424857 TCTGTGTGTAGGGGGACTGAAGG - Intronic
1056777912 9:89527270-89527292 CTTGTGTGCTGTGGGACTGAGGG + Intergenic
1056840315 9:89993426-89993448 ATTGTGTGTGAGGGTACATAAGG + Intergenic
1057360439 9:94368815-94368837 GTTGTGAGTTGGGGGGCAGGGGG - Intergenic
1057662903 9:97019263-97019285 GTTGTGGGTTGGGGGGCAGGGGG + Intergenic
1057741353 9:97714671-97714693 TTTGTGTATTGGGGGGCAGGAGG + Intergenic
1059584840 9:115594996-115595018 TATGTATGTTGGGGGTCAGAGGG - Intergenic
1059614114 9:115930408-115930430 ATTGTGTGTTGCTGAACTGATGG - Intergenic
1059903088 9:118950955-118950977 TTTCTGAGTTAGGGGACAGAGGG + Intergenic
1059938655 9:119336567-119336589 AGTGTGTGCTGGGGAGCAGAGGG + Intronic
1185808565 X:3082887-3082909 TGTGTGTGTAGGTGGACAGATGG - Intronic
1186297187 X:8162905-8162927 AATGTGTGTTGGGGGGGAGGAGG + Intergenic
1186875821 X:13816929-13816951 AGTGTGTGTTGGGGGGAACAGGG - Exonic
1186909731 X:14150050-14150072 ACTGTATGTAGGTGGACAGAGGG - Intergenic
1188547358 X:31323351-31323373 ATGGTGTGTTTTGTGACAGAGGG - Intronic
1188591361 X:31840104-31840126 GATCTGTATTGGGGGACAGAGGG - Intronic
1188963037 X:36516925-36516947 ATTGTGTATTGTGGGACTGGAGG + Intergenic
1189323986 X:40102207-40102229 ATTGGGTGTTTGGGGAAGGAAGG + Intronic
1189757741 X:44287932-44287954 ACTTTGTCTTGGGAGACAGAGGG + Intronic
1191058580 X:56270334-56270356 TGTGTGTGTTGGGGGTGAGATGG - Intronic
1191930510 X:66366493-66366515 GTTGTGTGTTGGAGATCAGAAGG + Intergenic
1192875991 X:75230223-75230245 TTTGAGTGTTGGGGGTGAGAGGG - Intergenic
1193792123 X:85827552-85827574 ATTGGTTATTGGGGAACAGATGG - Intergenic
1195618412 X:106930643-106930665 ATTGAGGGTTGGGGGAGGGAGGG - Exonic
1196784345 X:119408957-119408979 ATTATGTTTTGGAGGACAGGAGG - Intronic
1197905824 X:131424674-131424696 ATAGTGTAATGGGTGACAGATGG - Intergenic
1198724850 X:139666239-139666261 ATGGGGTGTTGGGGGAGAGGTGG - Intronic
1199047142 X:143188034-143188056 ATAGTGTGTTGCGGGAGAAAAGG + Intergenic
1199652300 X:149958477-149958499 ATTGTTTTTTGGGGAACAGGTGG + Intergenic
1199843571 X:151674736-151674758 ATTGTGTGTGGGGGGCCTGCGGG - Intronic
1201960489 Y:19675774-19675796 ACTGTGTGTTGGGTGACTGTTGG - Intergenic