ID: 976967202

View in Genome Browser
Species Human (GRCh38)
Location 4:91057838-91057860
Sequence CACAGAACTGTTTGAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976967202_976967204 23 Left 976967202 4:91057838-91057860 CCAACTCCTCAAACAGTTCTGTG 0: 1
1: 0
2: 5
3: 13
4: 199
Right 976967204 4:91057884-91057906 AGTGTCATAAAACCTATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976967202 Original CRISPR CACAGAACTGTTTGAGGAGT TGG (reversed) Intronic
900810665 1:4799240-4799262 CACAGAACTCTTTGGAGAGGTGG + Intergenic
902564197 1:17299889-17299911 CACATAACTGTGTGAGGTGATGG + Intergenic
906947435 1:50306893-50306915 CACAGAACTGTTGAGGGAATTGG + Intergenic
908205116 1:61839129-61839151 CATAGACCTGGTGGAGGAGTCGG - Intronic
910518200 1:88087723-88087745 CACAGAACTGATGGAGGATCAGG - Intergenic
911126281 1:94343858-94343880 CCCAGAACTGTGTGGGGAGAGGG + Intergenic
911484933 1:98493554-98493576 CCCAGAACTCCTTGAGGAGATGG - Intergenic
912119351 1:106451239-106451261 CACAGAATTTTGTGAGGATTGGG + Intergenic
912976125 1:114331887-114331909 CACAGAACTGTCTACGGTGTGGG - Intergenic
915686707 1:157641297-157641319 CACAGTACTGAGTGAGGAGCTGG - Intergenic
915960158 1:160259605-160259627 CAAAGAACTGTATGAGGAAAAGG - Intronic
916073215 1:161184004-161184026 CACAGAAGTGTTTCTGGAGGAGG - Intergenic
917137252 1:171799641-171799663 CACAGAACTTTTTTAGGATGGGG - Intronic
917209325 1:172615530-172615552 CACAGAAGTGTTTTAGGAGTTGG - Intergenic
918607250 1:186442649-186442671 CACAGCACAGTTTGATCAGTTGG + Intergenic
919763387 1:201112039-201112061 CACAGAATTGAGTGAGGAGCTGG - Intronic
922633675 1:227141715-227141737 CAGAGGACGGCTTGAGGAGTAGG + Intronic
922907703 1:229187218-229187240 CAAAGAAATGTTTGAGGTGAGGG - Intergenic
1065076328 10:22083300-22083322 TACAGAACTTTTTGATGAGTTGG + Intergenic
1067456990 10:46426058-46426080 CACAGGCCTGTTAGAGGAGGAGG + Intergenic
1067479458 10:46585468-46585490 CGCAGCACTGTGTGAGGGGTGGG + Intronic
1067615280 10:47756330-47756352 CGCAGCACTGTGTGAGGGGTGGG - Intergenic
1067630213 10:47958581-47958603 CACAGGCCTGTTAGAGGAGGAGG - Intergenic
1068900795 10:62268099-62268121 CACAGAACTGGTTGGGGGGAGGG - Intronic
1069062058 10:63904659-63904681 CACCGCACTGCTGGAGGAGTAGG + Intergenic
1071630681 10:87216281-87216303 CGCAGCACTGTGTGAGGGGTGGG - Intergenic
1071772395 10:88743914-88743936 GGCAGAGCTGTTTGGGGAGTTGG + Intronic
1072548357 10:96457681-96457703 CACAGAAATGCTTGGGGGGTAGG + Intronic
1072723985 10:97800356-97800378 GACAGAACTTTCTAAGGAGTGGG + Intergenic
1075477955 10:122752928-122752950 AACTGACCTGTTGGAGGAGTTGG - Intergenic
1075855893 10:125630054-125630076 ATCAGAACTATTTGAGGACTAGG - Intronic
1076125857 10:127973198-127973220 CACAGAACTTTTTCAGTGGTGGG + Intronic
1079332859 11:19547935-19547957 CACAGAAATGTTTGAAGGATGGG + Intronic
1080415946 11:32070177-32070199 CACAGAACTTTGTGAGCTGTTGG - Intronic
1080857567 11:36125687-36125709 TACAGCACTGTTTGGGCAGTTGG - Intronic
1084587112 11:70068745-70068767 TTCAGAACAGTTGGAGGAGTGGG - Intergenic
1085406399 11:76265631-76265653 CACTGAAGTGTTTGATGACTGGG + Intergenic
1086167985 11:83801638-83801660 CAAAGAGCTCTTTGAGGAATTGG - Intronic
1086232369 11:84585529-84585551 AACAGGACTTTTTGAGGAGCTGG - Intronic
1086314618 11:85578149-85578171 CACAGCACTGTTTGTTGATTAGG - Intronic
1087212553 11:95458592-95458614 GAAAGAACAGTTTGAAGAGTGGG - Intergenic
1088129675 11:106472303-106472325 CACAGGACTGTGAGGGGAGTGGG + Intergenic
1091536876 12:1418962-1418984 CACAGAACTTTGGGAGGCGTAGG - Intronic
1095176243 12:39095564-39095586 CACAGAACTTTTGAAGGAGGTGG + Intergenic
1098306197 12:69105244-69105266 CAGAGAAGTGGTTGAGGAGGAGG + Intergenic
1099007286 12:77249223-77249245 CAAAGAACTGATTGAGGAGTTGG + Intergenic
1099656317 12:85496611-85496633 CACAGAAGTGTTTGGGGGGTTGG + Intergenic
1100587277 12:95992001-95992023 CTCAGAACTCTTTGAGGGGAAGG - Intronic
1103304869 12:119956020-119956042 CCCAGAACTCCTTGAGGAGATGG + Intergenic
1103997916 12:124842042-124842064 CACAGGACTGTGGGAGGAGGAGG - Intronic
1104728949 12:131094588-131094610 CACAGTATTGCTTGGGGAGTCGG - Intronic
1105759044 13:23496395-23496417 AACAGAACTATTTTGGGAGTTGG + Intergenic
1106711178 13:32334970-32334992 TACAGAACTGTTTGAAGTTTGGG + Intronic
1107429830 13:40330330-40330352 CCCAGAACTCCTTGAGGAGATGG + Intergenic
1111762791 13:92486490-92486512 CACAGTATTTTTTAAGGAGTTGG - Intronic
1113487596 13:110665689-110665711 CCCTGAACTGTCTGAGGAGCTGG - Intronic
1113867976 13:113540946-113540968 CCCAGCACTGTTTGTTGAGTGGG + Intronic
1114856001 14:26444652-26444674 CATTTAACTGTTTCAGGAGTGGG + Intronic
1114893953 14:26962149-26962171 CACATATTTGTTTGTGGAGTTGG - Intergenic
1115020775 14:28678678-28678700 TACACAACTGTTTCAGGAGCTGG + Intergenic
1115536262 14:34376202-34376224 CACAGATCTCTTTGAGAAGCAGG + Intronic
1119253617 14:73179282-73179304 CACAGGATTGTGTGAGGACTGGG + Intronic
1120240428 14:81943594-81943616 CACAGAACAGCTAGAGGAATTGG + Intergenic
1124015464 15:25870168-25870190 AACAGAATTTTTTGAGAAGTAGG + Intergenic
1124111526 15:26794348-26794370 CACAGAACAGTGTAAGGTGTGGG - Intronic
1124329861 15:28801365-28801387 CTTAGATCTGTTTGAGGAGATGG + Intergenic
1125054586 15:35342257-35342279 CACAGAACTGTGTGAAGTCTTGG - Intronic
1127135349 15:55915978-55916000 CACAGACTTGTTGGAGAAGTCGG + Exonic
1128147914 15:65342924-65342946 CTCAGAACTGTTTGAGGTAGTGG + Intronic
1128894980 15:71364722-71364744 AACACAAGTGTTTGAAGAGTAGG - Intronic
1129684638 15:77678008-77678030 CACAGAGCTTTCTGAGGAGGTGG - Intronic
1131272578 15:90956201-90956223 CAGAGCACTGTGTGTGGAGTTGG + Intronic
1131631815 15:94185245-94185267 CACACAACTCTGTGAGGAGATGG - Intergenic
1136051570 16:27654361-27654383 CAGAGCACTGTTTTAGGAGTTGG + Intronic
1141887608 16:86903371-86903393 CACAGTGCTCTTAGAGGAGTTGG + Intergenic
1143267551 17:5651456-5651478 CCCAGAACTCTTTGGGGAGATGG + Intergenic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1145860486 17:28205946-28205968 CACAGAACTATGTGAGGTGATGG + Intergenic
1145873055 17:28292121-28292143 CTAAGAACTGTTTGATGATTTGG - Intergenic
1145944350 17:28761741-28761763 CACAGACCTGTTTTGGGAGGTGG - Intronic
1148505377 17:48122943-48122965 CCCAGAACTGTGAGAAGAGTTGG - Exonic
1149243791 17:54681852-54681874 ACCAGAAATGTTTGAAGAGTGGG - Intergenic
1149733407 17:58969503-58969525 CACAGAACAGTTATGGGAGTTGG - Intronic
1150296361 17:64010080-64010102 CCCAGAACTCTTTGGGGAGATGG + Intronic
1151129517 17:71881974-71881996 CAAAGAACTATTTGAGGAGTAGG - Intergenic
1155309145 18:24507229-24507251 CACAGAAAGGTTTTATGAGTGGG - Intergenic
1156590484 18:38482547-38482569 CACAAAAATGATTGAGGAGATGG + Intergenic
1157096463 18:44689678-44689700 CAGAGAAAGCTTTGAGGAGTAGG + Intronic
1157317425 18:46603956-46603978 GACAGAACAGTTTCAGGAGCAGG + Intronic
1158476111 18:57780986-57781008 CACAGCTCTGTTTGAGCAGCCGG - Intronic
1158559560 18:58502709-58502731 CACAGAAGTGGTTGGGGTGTGGG - Intronic
1160718915 19:589216-589238 CAGGGCACTGTTTGAGGGGTGGG + Intergenic
1161861467 19:6801463-6801485 CACAGAAGGGTTTGAGGGCTAGG + Intronic
1162650896 19:12088207-12088229 CCCAGAACTTTTTGAGGAGTTGG - Intergenic
1164323878 19:24175379-24175401 CACAGAACTTTTGCAGGAATGGG - Intergenic
1166827499 19:45618581-45618603 CTCAGAAGGGTTGGAGGAGTAGG - Intronic
1166966349 19:46531483-46531505 CAGAGAATGCTTTGAGGAGTGGG - Intronic
1167681791 19:50927780-50927802 CACAGAACTGATACACGAGTGGG - Intergenic
925165290 2:1711812-1711834 CACAGACCTGAGTGAGGATTTGG - Intronic
927501340 2:23585404-23585426 CACAGAACTGACCCAGGAGTAGG - Intronic
928935300 2:36670121-36670143 CCCAGAACTCTTTGATGACTGGG + Intergenic
929409439 2:41680547-41680569 CACAGTACTGTTTGTGGAAGTGG - Intergenic
929874683 2:45786760-45786782 CACTGAACTGTTGGAGGATTAGG - Intronic
930582357 2:53227695-53227717 CAGAGATCTTTTTGGGGAGTTGG - Intergenic
931275517 2:60740525-60740547 CCCAGGACTGTTTTAGGAGCTGG + Intergenic
932725364 2:74175377-74175399 CACAGATCTGGTTGGGGAGATGG - Intronic
934592625 2:95569679-95569701 CCCAGAACTCTTTGAAGAGATGG + Intergenic
937257897 2:120567764-120567786 CACAGACCTGAGTGTGGAGTAGG + Intergenic
937667606 2:124504450-124504472 CACAGAGCTGTCTGAGGGCTCGG + Exonic
937864062 2:126734834-126734856 CACAGCACTGGTTGAGGAGATGG - Intergenic
942036765 2:172017749-172017771 CAGTGAACTGTTTGAGAAATTGG + Intronic
944279661 2:197881120-197881142 CCAAGAACTGTGTTAGGAGTAGG - Intronic
945598206 2:211822651-211822673 CACATAAATGTTTCAGAAGTTGG + Intronic
946433049 2:219635668-219635690 CCCAGAACTGTCTTTGGAGTTGG + Exonic
1169740135 20:8884058-8884080 CACAAAACTGTTTTGGTAGTTGG + Exonic
1170765872 20:19289743-19289765 TCCAGAAATGATTGAGGAGTGGG - Intronic
1171330971 20:24338732-24338754 CACAGCACTGTTTGAGGAATGGG - Intergenic
1173518364 20:43681341-43681363 CACTGATGTGTTTGAAGAGTGGG - Intronic
1175412312 20:58778361-58778383 CTCTGAGCAGTTTGAGGAGTAGG + Intergenic
1175680741 20:60986738-60986760 CCCAGAACAGTGGGAGGAGTTGG + Intergenic
1177464564 21:21458420-21458442 CAGAGAACTGGTGTAGGAGTGGG + Intronic
1177582283 21:23040202-23040224 CGCAGAATTGTTTGTAGAGTTGG - Intergenic
1177757709 21:25367726-25367748 CACAAAACTGTTGGTGGAGTTGG + Intergenic
1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG + Intronic
1181590938 22:23884324-23884346 CACAGAGCTGTTTGACCAGATGG + Exonic
1182179185 22:28327578-28327600 TACTGAACTGTTTGAGGGTTAGG - Intronic
1184860007 22:47168266-47168288 CACAGACCTGTTGAAGTAGTAGG + Intronic
1184860024 22:47168360-47168382 CACAGACCTGTTGAAGTAGTAGG + Intronic
1184876839 22:47281667-47281689 CAAACAACTCTTTGAGGACTGGG - Intergenic
1185017139 22:48351445-48351467 CATGGAACTGTGAGAGGAGTGGG + Intergenic
949112275 3:276360-276382 CTCAGACATTTTTGAGGAGTTGG + Intronic
949825427 3:8159727-8159749 CACAGAAATCTTAGAGGAGCAGG - Intergenic
950358719 3:12434860-12434882 CACAGAACTTTTTTAAGATTTGG + Intergenic
957371648 3:79301333-79301355 CACAGTACTGTGTGCGGAATTGG - Intronic
958096164 3:88947968-88947990 CACACAACAATGTGAGGAGTGGG + Intergenic
958901633 3:99893896-99893918 CACAGAAATATTTGTGGATTTGG - Intronic
960476089 3:118130498-118130520 CTAAGAACTGGTTGAGGAATAGG + Intergenic
961123860 3:124398437-124398459 CACAATCCTGCTTGAGGAGTAGG + Intronic
961157411 3:124691899-124691921 CAGAGAACTCTTTTAGGTGTGGG + Intronic
961194004 3:124986134-124986156 CACAGAAACTTTTGAGGGGTGGG + Intronic
962065171 3:131971987-131972009 GAAAGAACTGTTGGATGAGTGGG + Intronic
962600695 3:136988878-136988900 CACAGATCTGTGTGAGCTGTGGG + Intronic
964620608 3:158717064-158717086 CACAGGCCTGTGTGTGGAGTGGG + Intronic
965715971 3:171603431-171603453 CACAGACCTGATTTAAGAGTTGG + Intronic
965991601 3:174825667-174825689 CACAGGAATGTTTAAGGAATAGG - Intronic
966891375 3:184409799-184409821 CAGAGAAATGTTTGAGGAACAGG - Intronic
967717849 3:192783905-192783927 GACTGAATTGTTTGAGGAGAGGG - Intergenic
967930835 3:194688660-194688682 CAAATAACTGTTTGGGGGGTGGG + Exonic
969551219 4:7868740-7868762 CACAGAACTGGATGAGGATGGGG + Intronic
970415116 4:15849142-15849164 CACAGCACTGTTGGAAGGGTTGG - Exonic
974991428 4:69095227-69095249 CCCAGAACTCCTTGAGGAGCTGG - Intronic
976967202 4:91057838-91057860 CACAGAACTGTTTGAGGAGTTGG - Intronic
980864195 4:138535574-138535596 CACAGAACTGATTGTGCACTTGG - Intergenic
981036244 4:140172165-140172187 CACATAACTTTCTGAGGACTTGG + Intergenic
982636032 4:157897871-157897893 TCCAGGACTGTTTGAGGAGAGGG + Intergenic
983574876 4:169250059-169250081 CCTAAAACTGTTTAAGGAGTGGG - Intronic
985547407 5:516683-516705 CACAGAGCTCTCTCAGGAGTGGG - Intronic
986422253 5:7597301-7597323 CAGAGACCTCTTTGAGAAGTTGG + Intronic
986792300 5:11173845-11173867 GACAGAAATGTTTGGGAAGTAGG - Intronic
986981999 5:13458558-13458580 TCCAGAATTGTTTGAGGTGTTGG - Intergenic
988392802 5:30657723-30657745 CACAGGATAGTTTCAGGAGTTGG + Intergenic
988539479 5:32096269-32096291 CGCAGAACTTTTGGGGGAGTTGG - Intronic
989112768 5:37923313-37923335 CAAAGCACTGTTTTAGGAGTTGG - Intergenic
992344685 5:75864949-75864971 CACTGAAGTGTTGGAGGTGTTGG + Intergenic
992408262 5:76480086-76480108 CACAGAGCTGTTTGTGTAGGTGG + Intronic
996999605 5:129743953-129743975 CACACAACTGTGAGAGGAGATGG + Intergenic
997026402 5:130067460-130067482 TACACAGCTGTTTGAGAAGTTGG - Intronic
997150460 5:131488170-131488192 CTCAGAACCCTTTGAGTAGTGGG - Intronic
997211333 5:132078764-132078786 CCCAGGACTGTCTGAGCAGTGGG - Intergenic
997780829 5:136656498-136656520 CAAAGAACTTTTTGAGAAGGTGG + Intergenic
999452373 5:151687896-151687918 CACAAAACTTTTTGAGGACAAGG - Intergenic
999803720 5:155062314-155062336 CCCAGAACTCTTTCTGGAGTTGG + Intergenic
999830695 5:155316382-155316404 CACGGAAATGTGTGAGGTGTTGG + Intergenic
1001676284 5:173519289-173519311 GAGAAAACTGTTTGACGAGTGGG - Intergenic
1001936093 5:175707109-175707131 CACTGAATTCTTTCAGGAGTAGG + Intergenic
1002114855 5:176951868-176951890 CAGAGAACTTTTTGGGGTGTTGG - Intronic
1004122399 6:12837004-12837026 CCCAGAACTCCTTGAGGAGATGG + Intronic
1006641028 6:35490017-35490039 CACAGAGCTGTTAGAGGGGAGGG + Intronic
1007725398 6:43913018-43913040 CCCAGAAGTGTGTGATGAGTCGG + Intergenic
1008661983 6:53678009-53678031 CACAGAACTGGTTGCTGAGGTGG + Intergenic
1014326618 6:120004375-120004397 CACAGATTTTTTTGAGCAGTGGG + Intergenic
1014482212 6:121952901-121952923 CACAGAGTAGTTTGAGGGGTAGG + Intergenic
1015101365 6:129485678-129485700 CACAGAACATTTTGAGGATCTGG - Intronic
1015381266 6:132572031-132572053 CACAAAACTGTTTAAAGAGTTGG + Intergenic
1020495579 7:8848709-8848731 CACAGAATTGTTTGGAGATTTGG + Intergenic
1021693973 7:23258436-23258458 CAAAGAAATGTTTGGTGAGTTGG - Intronic
1025762593 7:64408396-64408418 CACAGAACTTTTGCAGGAATGGG + Intergenic
1028364826 7:90015828-90015850 CAAAGATCTGTTGGAAGAGTAGG - Intergenic
1035203555 7:157280810-157280832 CACAGAGCTGAGTGCGGAGTCGG - Intergenic
1036163670 8:6411173-6411195 CACAGGCCTGGTTGAAGAGTTGG + Intronic
1036674190 8:10816187-10816209 CACAGAGCTGTATGAGCAGATGG + Intronic
1037148272 8:15601302-15601324 CACAGAACAGTTTGAGGAAATGG - Intronic
1037812185 8:22093511-22093533 AACAGCACTGGCTGAGGAGTTGG + Intronic
1037922689 8:22818601-22818623 CACAGAACTGTTTCAGGGTTTGG + Intronic
1039401851 8:37276664-37276686 CACAGGACTCTTTGAAGTGTGGG + Intergenic
1040958121 8:53001216-53001238 CACGTAACTGTGTGAGGAGGTGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042679256 8:71362521-71362543 CCCAGACCTGTTTCAGTAGTAGG - Intergenic
1047020924 8:120774408-120774430 CACAGAGCTTTTTAAGGAGGAGG + Intronic
1048480769 8:134790521-134790543 CACTGAAGTTTTTGAGGCGTGGG - Intergenic
1049831817 8:144705567-144705589 CACAGTGATGTTTGAGGAGGTGG + Intergenic
1050183202 9:2942647-2942669 TACTAAACTCTTTGAGGAGTGGG - Intergenic
1050359042 9:4811013-4811035 CAAAGAAATGTTTGAGGTGATGG - Intronic
1051393690 9:16594856-16594878 CTCAGATTTGTTTGAGGAGGAGG - Intronic
1054821062 9:69520960-69520982 CACTGAAGAGTTTGAGGAGTAGG - Intronic
1055345185 9:75327934-75327956 CAGAGAATCATTTGAGGAGTAGG - Intergenic
1056395534 9:86177602-86177624 CACAAAACTGTTTTTGGAGGTGG + Intergenic
1057967277 9:99516509-99516531 CAGAGACCTGTCAGAGGAGTGGG - Intergenic
1060213333 9:121723737-121723759 CACAGAGCTGGTTGAGGATTGGG + Intronic
1060262229 9:122086227-122086249 TAAAGGACTGTTTAAGGAGTTGG + Intronic
1189746522 X:44174115-44174137 CAAAGAATTGATTGAGGACTAGG - Intronic
1193058227 X:77177206-77177228 CACAGATCTGTCTGAGCAGGAGG - Intergenic
1193386195 X:80874224-80874246 CAGAGAACTGAATGATGAGTAGG + Intergenic
1197879116 X:131146281-131146303 CACTGAACAGATTAAGGAGTTGG - Intergenic
1199149029 X:144407154-144407176 CCCAGCTCTGTTTGAGGGGTGGG - Intergenic
1199410436 X:147516152-147516174 CACAGTATTGTTGGAGGTGTAGG - Intergenic
1199541119 X:148959030-148959052 CACAGAACTGTCCCAGGAGGAGG + Intronic
1201410864 Y:13698178-13698200 CATAGGACTGTGTGAGGATTTGG + Intergenic