ID: 976969497

View in Genome Browser
Species Human (GRCh38)
Location 4:91088015-91088037
Sequence GATCTCACTTGCTTAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976969494_976969497 18 Left 976969494 4:91087974-91087996 CCTGTAAACAAAGAGTACAATTA 0: 1
1: 0
2: 0
3: 13
4: 254
Right 976969497 4:91088015-91088037 GATCTCACTTGCTTAAGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976969497 Original CRISPR GATCTCACTTGCTTAAGAAA TGG Intronic
910063541 1:83123810-83123832 GGTCTCACTGGCTAAAGCAAAGG + Intergenic
910759594 1:90720625-90720647 GATCATATTTTCTTAAGAAAAGG + Intergenic
911718458 1:101163166-101163188 GACCTCACTTGTTTCTGAAATGG - Intergenic
912253675 1:108037236-108037258 GCTCTGACTTGCTTATAAAAAGG - Intergenic
912283764 1:108346405-108346427 GATGTCACATGCTTGAGGAAGGG + Intergenic
912313206 1:108643528-108643550 GAAGTCAATTTCTTAAGAAATGG - Intronic
914377953 1:147089717-147089739 GATGTCACATGCTTGAGGAAGGG - Intergenic
914736535 1:150422820-150422842 GATTTCACTTGATTAAAAATTGG + Intronic
921407932 1:214801250-214801272 AATCTCAATGGCTTAAGATAGGG + Intergenic
1063073140 10:2687066-2687088 GATCTCACCTGTTTGAGAATTGG + Intergenic
1063181214 10:3602236-3602258 AATCCCACATGCTTAAGGAAAGG + Intergenic
1065595932 10:27311425-27311447 TATCACACTGGCTTCAGAAAAGG - Intergenic
1065680097 10:28221528-28221550 GATTTCACTTGTTTCTGAAATGG - Intronic
1066957896 10:42190174-42190196 GATGTCACCTGATAAAGAAAAGG - Intergenic
1067492838 10:46728359-46728381 AATATAACTTGCTAAAGAAAGGG - Intergenic
1067530232 10:47065798-47065820 TATCTCACTTGCTCAACAAATGG + Intergenic
1067601826 10:47612036-47612058 AATATAACTTGCTAAAGAAAGGG + Intergenic
1068433404 10:56961502-56961524 GATTTCACTTGGAAAAGAAAGGG - Intergenic
1070671810 10:78382759-78382781 CATCTCATTTGTTTAAGAAAAGG - Intergenic
1071653352 10:87419623-87419645 AATATAACTTGCTAAAGAAAGGG + Intergenic
1074462711 10:113652964-113652986 GATCACACCTGCTTATCAAAGGG - Exonic
1074556845 10:114499371-114499393 GATCTAACTTGATTCAGAGATGG + Intronic
1074684113 10:115942771-115942793 GATTGGCCTTGCTTAAGAAAAGG - Intronic
1076489972 10:130852026-130852048 TATCCAACTTGATTAAGAAAAGG - Intergenic
1079527473 11:21407848-21407870 GATCTCAGTTGGCAAAGAAAAGG - Intronic
1080918071 11:36680357-36680379 GATCTCATTTGCATAATAAAAGG + Intergenic
1085160066 11:74332736-74332758 GAAGCAACTTGCTTAAGAAATGG + Exonic
1086785060 11:90958516-90958538 GATCTCAATAGATTCAGAAAAGG + Intergenic
1086838487 11:91655260-91655282 CATCTAACTTGCTTAACAGAAGG - Intergenic
1087051335 11:93889233-93889255 CATCTCTATTGCTTAAAAAAGGG - Intergenic
1092387829 12:8049799-8049821 GATCAGAATTGTTTAAGAAAAGG + Intronic
1095644787 12:44530705-44530727 GATCTCATTTCCTTAATACATGG - Intronic
1097349530 12:58533288-58533310 GCTCTAACTTGCTTGAGAATGGG + Intergenic
1098896287 12:76064946-76064968 GATTTCAATTGCCTAAGGAATGG - Intronic
1100184200 12:92121348-92121370 GAGCTGGCATGCTTAAGAAATGG - Intronic
1108143434 13:47450853-47450875 TATCTCACTAGATTCAGAAAAGG - Intergenic
1110041846 13:70770941-70770963 GTTCTCACCTGCTTCAGAAAAGG - Intergenic
1110083843 13:71352678-71352700 ATATTCACTTGCTTAAGAAAAGG + Intergenic
1113608902 13:111629399-111629421 GATTTCACTTTTTTAAAAAATGG - Intronic
1116376725 14:44211575-44211597 GATTTCACTTTCTTAAATAAGGG - Intergenic
1120447979 14:84625360-84625382 GTTCTCACTTTCGGAAGAAATGG - Intergenic
1123965696 15:25454764-25454786 GCTGTCAGTTACTTAAGAAATGG + Intergenic
1124814915 15:32980235-32980257 AATCTTAATTCCTTAAGAAATGG + Intronic
1125120317 15:36150013-36150035 CATCTCAGTTGATGAAGAAAAGG + Intergenic
1128472455 15:67966936-67966958 GGTCTCATTTGCTTGAGACAGGG + Intergenic
1137760876 16:50939301-50939323 GATCTCACTGGCATACTAAATGG + Intergenic
1144114913 17:12078560-12078582 GATATCACTTTCTTCAGAATGGG - Intronic
1144878228 17:18414078-18414100 GATAACACTTGGTTAAGACAAGG + Intergenic
1146154731 17:30512696-30512718 GATCTCATGTGCTGATGAAAAGG - Intronic
1148595605 17:48852726-48852748 GATGTCACTGGCTTTAGGAAAGG + Intronic
1149136386 17:53370165-53370187 AATCTTACTAGCTTAAAAAATGG + Intergenic
1150293833 17:63997622-63997644 GGTCTTCCTTGCTTAAGAACAGG - Intergenic
1150422955 17:65055787-65055809 GAACTCGCTTGCTTAGGAGACGG + Intronic
1153538109 18:6124873-6124895 GATCTCTATTGCTTTAAAAATGG + Intronic
1155176546 18:23306172-23306194 GTTGTCACTTGCTTAAGTCAAGG - Intronic
1155279215 18:24220783-24220805 AATCTCACTTCCTAAAGATACGG - Intronic
1155973210 18:32101016-32101038 AATATCACTTCCTAAAGAAAGGG - Intronic
1156339209 18:36196201-36196223 GATCTCACATACTTTGGAAAGGG + Intronic
1156907078 18:42366227-42366249 AATCTTTCTTGCTTCAGAAATGG + Intergenic
1158025111 18:52886554-52886576 AATGTCACTTGCCTAAGACAAGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164550976 19:29212475-29212497 GCACTTACATGCTTAAGAAATGG - Intronic
1165278830 19:34779675-34779697 AATCTCACTTGCTGTTGAAAGGG + Intergenic
928402714 2:30990920-30990942 GATCACACTTTCTTAACAGACGG + Intronic
928559370 2:32463178-32463200 GAACTCACTGGCATAAGACAAGG - Exonic
929471087 2:42193692-42193714 GACCCCACTTCATTAAGAAAAGG - Intronic
929767622 2:44860592-44860614 CATCTCACATGGTTAAGAATGGG - Intergenic
930668393 2:54122487-54122509 CACCTCACTTGCTGAAGAGAAGG - Intronic
932949199 2:76272761-76272783 GATATCAATTGCATAAAAAATGG - Intergenic
937692238 2:124769566-124769588 GCTCTCACTTGCTGAAGAGGTGG - Intronic
937949238 2:127370966-127370988 AATGCCACTTGCTTAAGACAGGG - Intronic
939164464 2:138625519-138625541 AATCTTACTTGCTTATAAAATGG - Intergenic
940393830 2:153164317-153164339 GTTCTCACTCGTTTAAAAAATGG - Intergenic
941788807 2:169528001-169528023 GTTATCACTTGCTTGAGAAATGG + Intergenic
942201005 2:173571329-173571351 AATCTGACTTGCTAGAGAAAGGG + Intergenic
945287049 2:208093397-208093419 AATCTCCCTTGCTAAAGATAAGG - Intergenic
945430246 2:209755366-209755388 GATCTGTCTTGCTTATGAGATGG + Intergenic
946782156 2:223203139-223203161 AATCCCACATGCTTCAGAAATGG + Intergenic
947275971 2:228392584-228392606 GATCTTGCTTGCTTAAGTATGGG + Intergenic
948434843 2:237946076-237946098 GATCCCACTTGGGTAAGAAATGG + Intergenic
1172332961 20:34088652-34088674 GTTCTCACTTGCTGAGGATAAGG - Exonic
1174537648 20:51264753-51264775 TATCTCAATTGATAAAGAAAAGG + Intergenic
1175273324 20:57750037-57750059 GATCGCAGTTGCGCAAGAAAGGG - Intergenic
1175352922 20:58338518-58338540 GATCTCATTAGCCTAAGAGATGG + Intronic
1176692185 21:9927974-9927996 GGGATCTCTTGCTTAAGAAAGGG + Intergenic
1177087154 21:16720293-16720315 GTTCTCACTTGCTTAATCATAGG - Intergenic
1178572680 21:33754813-33754835 AATTTCACTTCATTAAGAAATGG + Intronic
1183019883 22:35018521-35018543 GATCTCACTTATTTTACAAAAGG - Intergenic
1183950864 22:41352140-41352162 CATCTCCCTTGATGAAGAAACGG + Intronic
949632216 3:5940788-5940810 TATCTCACTTGATGCAGAAAAGG - Intergenic
950699355 3:14729517-14729539 GATGTCACTTCCTTATGGAATGG - Intronic
950728962 3:14939585-14939607 GGTCTCACTTTCTTAAGCTAAGG - Intergenic
954947874 3:54442554-54442576 GATCTTACTTGTTTAAGCCATGG + Intronic
956360742 3:68443973-68443995 GATCTCACTTTGTTAGGAAATGG - Intronic
958065157 3:88535594-88535616 GATCTAAATAGCTTACGAAAGGG + Intergenic
958929385 3:100192770-100192792 CATAATACTTGCTTAAGAAATGG - Intronic
966518030 3:180841341-180841363 GATCTCAATTGATGCAGAAAAGG - Intronic
967066984 3:185926967-185926989 GACCCCACTTCCTTCAGAAAGGG + Intronic
967302253 3:188026434-188026456 GCTCTTACATGCTGAAGAAAAGG + Intergenic
972902697 4:43703869-43703891 GATTTCTACTGCTTAAGAAAAGG - Intergenic
973840778 4:54858236-54858258 GAACTGAGTTGCTGAAGAAAAGG + Intergenic
974211016 4:58776421-58776443 CATGTGACTTGCTTTAGAAAAGG - Intergenic
974679610 4:65144462-65144484 TATATAACTTGCTTTAGAAAGGG - Intergenic
976098159 4:81531446-81531468 GCTCTTTCTTGCTTATGAAATGG - Intronic
976688703 4:87845086-87845108 ATTCTCACTGGCTTCAGAAAGGG - Exonic
976969497 4:91088015-91088037 GATCTCACTTGCTTAAGAAATGG + Intronic
977754807 4:100655997-100656019 GATCTCACTGGCTGGAGGAAAGG + Intronic
978962025 4:114691733-114691755 GACCTCTCTTGCTAAATAAAAGG + Intergenic
980364776 4:131788219-131788241 GGGATCACTTGCTTAAGAAAGGG + Intergenic
980580929 4:134749272-134749294 CATCTCACTAGCTGCAGAAAAGG + Intergenic
981410382 4:144423268-144423290 GATCTCCATTGCTGAATAAAGGG + Intergenic
982161189 4:152571411-152571433 AATCTCACTGGCCCAAGAAAGGG - Intergenic
982849692 4:160296872-160296894 GGTCTCACATACTGAAGAAATGG - Intergenic
983381888 4:167005798-167005820 AATCTCATTTGATAAAGAAAAGG + Intronic
983437579 4:167734492-167734514 TATCTCACTTGCTTCAGAGCAGG + Intergenic
986881434 5:12176732-12176754 GAACTCACTTGCTTTTTAAAAGG - Intergenic
987347126 5:16988983-16989005 TATCACACTTGCTTACAAAAGGG - Intergenic
989503200 5:42193498-42193520 GATCTCTCTTTCTAAAGAGAGGG + Intergenic
990803060 5:59627548-59627570 GATATCACTGGCTTAACAAAAGG - Intronic
991001876 5:61791223-61791245 TTACTCACTTGCTTCAGAAAAGG + Intergenic
991619307 5:68529160-68529182 TATACCACTTGCTTAAGGAATGG + Intergenic
992155927 5:73955193-73955215 GGAATCACTGGCTTAAGAAAAGG - Intergenic
998213257 5:140217666-140217688 GCTCTCAAGTTCTTAAGAAAGGG - Intronic
998375760 5:141689525-141689547 GATCTCAGTGGCATGAGAAATGG - Intergenic
998808498 5:145941957-145941979 GATGGCACTTGCTTAATAAGGGG - Intronic
998860152 5:146435204-146435226 GATCTCACATGTTTGAGTAATGG + Intergenic
1000442714 5:161282377-161282399 GATCTGACTTGCTTTTTAAAAGG + Intergenic
1003382715 6:5639513-5639535 GATTTCTCTTGCTTAAGTAGAGG + Intronic
1006280634 6:33050312-33050334 AATGCCACTTGCTTAAGACAAGG - Intergenic
1006715625 6:36117989-36118011 TATCTGCCTTGCCTAAGAAATGG + Intergenic
1007828006 6:44616048-44616070 GATCTCACTGGCTTAAAGCAAGG - Intergenic
1007936987 6:45741236-45741258 GATCTTACTTACATAAGAACAGG - Intergenic
1009549611 6:65071033-65071055 GACCTCTCTTCCTTAAGAAATGG + Intronic
1011741079 6:90361384-90361406 GCTGTCACTTACTTCAGAAAGGG - Intergenic
1012137449 6:95577277-95577299 GAACTCACTGCCTTTAGAAACGG - Intergenic
1015543124 6:134336053-134336075 GCTCTCCATTGCTGAAGAAAAGG - Intergenic
1015579765 6:134710955-134710977 GATCTCACTTCCTTTTGATAGGG - Intergenic
1017603225 6:156105926-156105948 AATATCAGTTGCTTGAGAAACGG - Intergenic
1018488852 6:164271458-164271480 TATCTCCCTTCCTTAACAAAAGG + Intergenic
1018934412 6:168264307-168264329 GAACTAACTTTCTTAAGAAGAGG + Intergenic
1020154516 7:5711619-5711641 GTCCTCATTTGCTTATGAAAAGG + Intronic
1020525984 7:9259502-9259524 GATTTTACTTGCTAAAGACAAGG + Intergenic
1023877199 7:44293317-44293339 GAGCTTATTTGGTTAAGAAATGG - Intronic
1024329389 7:48141076-48141098 AATGCCACTTGCTTAAGACAGGG - Intergenic
1024930534 7:54663562-54663584 GGTCTCACTTGGTTAGGATATGG + Intergenic
1027359568 7:77394124-77394146 GATCTAACTTGCTTCATAAAAGG - Intronic
1027863508 7:83615972-83615994 GGACTAACTTGATTAAGAAAAGG + Intronic
1030246244 7:107387043-107387065 AATGCCACTTGCTTAAGACAGGG - Intronic
1031458386 7:122012828-122012850 TTTCTCACTTGCATAGGAAATGG - Exonic
1031546231 7:123053904-123053926 GATCCCTTCTGCTTAAGAAAAGG - Intergenic
1032698814 7:134360916-134360938 GGTCTCACTTTTTTGAGAAACGG + Intergenic
1033599970 7:142882330-142882352 GTTCTCCCATGCTTCAGAAAAGG + Intronic
1034330104 7:150275283-150275305 AATTTCAGTCGCTTAAGAAAGGG + Intronic
1034667952 7:152834577-152834599 AATTTCAATCGCTTAAGAAAGGG - Intronic
1035059478 7:156058448-156058470 GATTTCACTTCCTTAAGAGGAGG - Intergenic
1035104554 7:156431184-156431206 GATCACAAGTGCTTTAGAAATGG - Intergenic
1036027928 8:4930845-4930867 GATCTTAATTTCTTAATAAAGGG + Intronic
1037608035 8:20453916-20453938 CTTCTCACTTGCTATAGAAAAGG - Intergenic
1037984005 8:23275390-23275412 GATCTCATTTACTAAACAAAAGG - Intronic
1041402141 8:57457239-57457261 GATGCCGCTTGCTTAAGACAAGG - Intergenic
1043140107 8:76577357-76577379 GATGTCACTTTGTTCAGAAAAGG + Intergenic
1046408898 8:113812941-113812963 GAGATCACTTGGGTAAGAAAAGG + Intergenic
1046416857 8:113927548-113927570 GTTCTCACTTACTTAAAATAAGG - Intergenic
1050695753 9:8277540-8277562 GCTTTCACCTGCTGAAGAAATGG - Intergenic
1053629127 9:39914074-39914096 GGGATCTCTTGCTTAAGAAAGGG + Intergenic
1054214760 9:62336628-62336650 GGGATCTCTTGCTTAAGAAAGGG - Intergenic
1054672721 9:67818721-67818743 GGGATCTCTTGCTTAAGAAAGGG + Intergenic
1056142305 9:83695079-83695101 GACCCCATTTGCTTAACAAAAGG + Intronic
1057025709 9:91732788-91732810 GATCTCACTTCCTGTGGAAATGG - Intronic
1060572289 9:124653346-124653368 GATGTCACTTGCCTATAAAATGG + Intronic
1187265039 X:17724260-17724282 GGTCTCATTAGCTTTAGAAATGG - Intronic
1187763856 X:22617703-22617725 GATCTCACTCCCTTCAGAATGGG + Intergenic
1188157001 X:26752349-26752371 GATCACAATGGCTTAACAAAAGG - Intergenic
1188295254 X:28439767-28439789 GATCTCACTAGCCAAAGAAGAGG + Intergenic
1189176058 X:38958635-38958657 GATCTCATTTTGTGAAGAAAAGG + Intergenic
1189269278 X:39739503-39739525 GATGTCTGTTGCTTAATAAATGG + Intergenic
1190725106 X:53184549-53184571 CATCTCACTTGATGCAGAAAAGG - Intergenic
1191963689 X:66731659-66731681 TTTCTCACATGCTTAATAAATGG + Intergenic
1193091995 X:77503723-77503745 GATTTCACTTTTTTAAGAATTGG + Intergenic
1193806562 X:86002637-86002659 GTTCTCCCTTGGTTAGGAAAGGG - Intronic
1194114501 X:89879619-89879641 GATAACACTAGTTTAAGAAAAGG + Intergenic
1195822469 X:108961260-108961282 TATCTCAATTGATTAAAAAAAGG - Intergenic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1198580354 X:138057419-138057441 GATTTCACTTTTTTAAAAAAAGG - Intergenic
1200467242 Y:3534985-3535007 GATAACACTAGTTTAAGAAAAGG + Intergenic
1202430673 Y:24775736-24775758 GTTTTTACTTGCTTAAGCAATGG - Intronic