ID: 976969564

View in Genome Browser
Species Human (GRCh38)
Location 4:91089185-91089207
Sequence CAATCTAGGCGGTATGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 10, 2: 10, 3: 25, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976969561_976969564 -8 Left 976969561 4:91089170-91089192 CCGTGATTGATTGAACAATCTAG 0: 1
1: 9
2: 5
3: 11
4: 104
Right 976969564 4:91089185-91089207 CAATCTAGGCGGTATGTGACAGG 0: 1
1: 10
2: 10
3: 25
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976969564 Original CRISPR CAATCTAGGCGGTATGTGAC AGG Intronic