ID: 976969564 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:91089185-91089207 |
| Sequence | CAATCTAGGCGGTATGTGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 95 | |||
| Summary | {0: 1, 1: 10, 2: 10, 3: 25, 4: 49} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 976969561_976969564 | -8 | Left | 976969561 | 4:91089170-91089192 | CCGTGATTGATTGAACAATCTAG | 0: 1 1: 9 2: 5 3: 11 4: 104 |
||
| Right | 976969564 | 4:91089185-91089207 | CAATCTAGGCGGTATGTGACAGG | 0: 1 1: 10 2: 10 3: 25 4: 49 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 976969564 | Original CRISPR | CAATCTAGGCGGTATGTGAC AGG | Intronic | ||