ID: 976976846

View in Genome Browser
Species Human (GRCh38)
Location 4:91176056-91176078
Sequence CTATCTAAACAAATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 1, 2: 5, 3: 86, 4: 939}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976976846_976976853 10 Left 976976846 4:91176056-91176078 CCCAGCACCATTTGTTTAGATAG 0: 1
1: 1
2: 5
3: 86
4: 939
Right 976976853 4:91176089-91176111 CCCCATTTCTGATTTTTGACAGG No data
976976846_976976856 29 Left 976976846 4:91176056-91176078 CCCAGCACCATTTGTTTAGATAG 0: 1
1: 1
2: 5
3: 86
4: 939
Right 976976856 4:91176108-91176130 CAGGTTTGTCACAGATCAGATGG 0: 19
1: 5809
2: 3906
3: 2423
4: 1956

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976976846 Original CRISPR CTATCTAAACAAATGGTGCT GGG (reversed) Intronic
900632098 1:3642434-3642456 CCTTCTAAATAAATGCTGCTGGG + Intronic
902590563 1:17471326-17471348 CCATTTAAAAAAATGGGGCTGGG + Intergenic
905100512 1:35517471-35517493 CTTACTCAATAAATGGTGCTGGG + Intronic
905633695 1:39534384-39534406 CCTTTTCAACAAATGGTGCTAGG + Intergenic
905896577 1:41550107-41550129 CTTTTTTAATAAATGGTGCTGGG - Intronic
906360587 1:45154501-45154523 CCTACTCAACAAATGGTGCTGGG + Intronic
907095773 1:51779309-51779331 CCTTCTCAACAAATGGTGCTGGG + Intronic
907134327 1:52124802-52124824 TTTTCTCAACAAATGGTGCTGGG - Intergenic
907562214 1:55401472-55401494 CTATCTACACAAATTGGGATAGG + Intergenic
907649511 1:56281377-56281399 CTTATTTAACAAATGGTGCTGGG - Intergenic
908104564 1:60828183-60828205 CCTTTTCAACAAATGGTGCTGGG - Intergenic
908298975 1:62742688-62742710 CCTTTTCAACAAATGGTGCTGGG + Intergenic
909292677 1:73903446-73903468 ATTTCTCAACAAATGGTGCTAGG + Intergenic
909405487 1:75283729-75283751 CCTGCTCAACAAATGGTGCTGGG - Intronic
909551489 1:76902792-76902814 TTTTTTAAACAAATGGTGCTAGG + Intronic
909674088 1:78219789-78219811 CCTTTTCAACAAATGGTGCTGGG + Intergenic
909680892 1:78290383-78290405 CCTTTTCAACAAATGGTGCTCGG - Intergenic
909947958 1:81684867-81684889 CCTTTTCAACAAATGGTGCTGGG - Intronic
910101884 1:83585987-83586009 CCTTTTCAACAAATGGTGCTGGG - Intergenic
910338898 1:86163583-86163605 CCTACTTAACAAATGGTGCTGGG - Intergenic
910380833 1:86624932-86624954 CCTTTTCAACAAATGGTGCTGGG + Intergenic
910734028 1:90432368-90432390 CCTTTTCAACAAATGGTGCTGGG + Intergenic
910738576 1:90490249-90490271 CCTTTTTAACAAATGGTGCTAGG - Intergenic
911418468 1:97607510-97607532 TTAGCAAAAAAAATGGTGCTGGG + Intronic
911588919 1:99723787-99723809 CTATTCAAAAAAATGGTGTTAGG + Intronic
911689536 1:100816924-100816946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
911903309 1:103532061-103532083 CTTATTCAACAAATGGTGCTGGG - Intronic
912227543 1:107752246-107752268 CCTTTTCAACAAATGGTGCTGGG + Intronic
912580480 1:110716810-110716832 ACATGTAAACAAATGGAGCTTGG + Intergenic
913024136 1:114818862-114818884 TAGTCTCAACAAATGGTGCTAGG - Intergenic
913143574 1:115966552-115966574 CCTTTTCAACAAATGGTGCTGGG + Intergenic
913466899 1:119152169-119152191 ATAAATAAATAAATGGTGCTGGG - Intergenic
913587661 1:120291772-120291794 CCTTTTCAACAAATGGTGCTGGG - Intergenic
913620524 1:120606597-120606619 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914346482 1:146803924-146803946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914569681 1:148903641-148903663 CCTTTTCAACAAATGGTGCTGGG - Intronic
914603148 1:149226617-149226639 CCTTTTCAACAAATGGTGCTGGG + Intergenic
915045843 1:153014828-153014850 CCTTTTCAACAAATGGTGCTGGG - Intergenic
915690331 1:157682476-157682498 CTTTATTAATAAATGGTGCTGGG - Intronic
915784368 1:158593074-158593096 CCTGTTAAACAAATGGTGCTGGG + Intergenic
915961503 1:160270804-160270826 GTTTTTCAACAAATGGTGCTGGG - Intergenic
916206602 1:162321163-162321185 CCTACTCAACAAATGGTGCTGGG - Intronic
916331278 1:163620086-163620108 CCCATTAAACAAATGGTGCTGGG - Intergenic
916981087 1:170137794-170137816 CCCTCTCAACAAATGGTGCTGGG + Intergenic
917053789 1:170956048-170956070 CCTTTTCAACAAATGGTGCTGGG - Intronic
917461985 1:175239390-175239412 CCTTTTCAACAAATGGTGCTAGG + Intergenic
917886727 1:179393199-179393221 CCTTTTCAACAAATGGTGCTGGG - Intronic
917898067 1:179512295-179512317 CCTTTTAAACAAATGGTGCTGGG - Intronic
917907591 1:179602609-179602631 CCTTTTAAACAAATGGTGCTGGG - Intronic
918158775 1:181877193-181877215 CCTTTTTAACAAATGGTGCTGGG + Intergenic
918665788 1:187149048-187149070 CTCTTCAATCAAATGGTGCTTGG - Intergenic
918791629 1:188837727-188837749 ATCTATAAATAAATGGTGCTGGG + Intergenic
918850841 1:189687768-189687790 TCAATTAAACAAATGGTGCTGGG - Intergenic
918909204 1:190543672-190543694 CCTATTAAACAAATGGTGCTAGG - Intergenic
919109184 1:193196222-193196244 CCTTTTCAACAAATGGTGCTGGG - Intronic
919541566 1:198853039-198853061 CTACTTCAACAAATGGTGTTGGG + Intergenic
919584338 1:199417455-199417477 CTTTTTCAATAAATGGTGCTGGG + Intergenic
919816165 1:201441323-201441345 TCATTTCAACAAATGGTGCTGGG + Intergenic
920687589 1:208121123-208121145 CTCTGTAAACCAATGCTGCTGGG + Intronic
920768991 1:208862505-208862527 CTAATTCAATAAATGGTGCTGGG + Intergenic
920990212 1:210930442-210930464 CTGATTCAACAAATGGTGCTGGG + Intronic
921409559 1:214820906-214820928 CCTTTTCAACAAATGGTGCTGGG - Intergenic
921690587 1:218144593-218144615 CTTATTCAACAAATGGTGCTGGG + Intergenic
921834921 1:219768635-219768657 CCTTTTCAACAAATGGTGCTGGG + Intronic
921846783 1:219891589-219891611 CCATATTAATAAATGGTGCTGGG + Intronic
921919160 1:220646812-220646834 CTATTTTAACAAATTGTGCTGGG + Intronic
922377588 1:224984300-224984322 CCTTTTTAACAAATGGTGCTGGG + Intronic
922395577 1:225197273-225197295 CCTACTCAACAAATGGTGCTGGG - Intronic
922637057 1:227184689-227184711 CTATCTAAAGGAATCTTGCTAGG + Intronic
922658391 1:227406330-227406352 CCTTTTCAACAAATGGTGCTGGG + Intergenic
922926959 1:229356628-229356650 CCTTTTCAACAAATGGTGCTGGG - Intergenic
922995536 1:229955881-229955903 CCTTTTCAACAAATGGTGCTGGG - Intergenic
923446838 1:234079229-234079251 CCTTGTCAACAAATGGTGCTGGG + Intronic
923640762 1:235758055-235758077 ATATCCTAACAAATGCTGCTGGG + Intronic
923658849 1:235941349-235941371 ATATTTAAACAAATGGAGCCAGG - Intergenic
923875712 1:238044697-238044719 CTTTTTCAACAAATGATGCTGGG + Intergenic
924161029 1:241232056-241232078 TTTTCTAAACAAATAGTGCTGGG - Intronic
924251204 1:242134819-242134841 CTATGAGAACCAATGGTGCTGGG - Intronic
924822670 1:247508743-247508765 CCTTCTTAATAAATGGTGCTGGG - Intronic
1063032904 10:2253839-2253861 CTATGGAAACAAATGTTGGTGGG + Intergenic
1063081188 10:2769061-2769083 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1063542391 10:6947169-6947191 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1063544605 10:6968287-6968309 CCTACTCAACAAATGGTGCTGGG + Intergenic
1063779829 10:9309063-9309085 CTATATAACCAAATAATGCTGGG - Intergenic
1063961682 10:11311171-11311193 CTATCTCAAAACATAGTGCTGGG + Intronic
1065079583 10:22114627-22114649 CCTATTAAACAAATGGTGCTAGG - Intergenic
1065165482 10:22972412-22972434 CAATTTCAACAAATGATGCTAGG - Intronic
1065227658 10:23561728-23561750 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1065245986 10:23758288-23758310 TTTTTAAAACAAATGGTGCTGGG - Intronic
1065439249 10:25733085-25733107 CTATCTTCATAATTGGTGCTGGG - Intergenic
1065470560 10:26076727-26076749 CCTTTTCAACAAATGGTGCTGGG - Intronic
1066424444 10:35293209-35293231 TTTTCTCAACAAATGGTGCTGGG - Intronic
1067351818 10:45482899-45482921 CCCTCTCAATAAATGGTGCTGGG + Intronic
1067975414 10:51019404-51019426 CTTTTCAAACAAATGGTGGTAGG + Intronic
1068073558 10:52225719-52225741 CCTTTTCAACAAATGGTGCTGGG - Intronic
1068097810 10:52513826-52513848 CCAATTCAACAAATGGTGCTGGG - Intergenic
1068145190 10:53060432-53060454 CCTACTCAACAAATGGTGCTGGG - Intergenic
1068232652 10:54190819-54190841 TTATAAAAATAAATGGTGCTCGG + Intronic
1068391386 10:56401676-56401698 CTGTGTAATCCAATGGTGCTTGG + Intergenic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1068979684 10:63049120-63049142 CAGTCTTAACAAATGGTGTTGGG + Intergenic
1069150064 10:64949089-64949111 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1069164220 10:65130346-65130368 CTGTCTAAACCTATTGTGCTTGG + Intergenic
1069325796 10:67230230-67230252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1069343109 10:67436232-67436254 CCTTTTCAACAAATGGTGCTGGG + Intronic
1070050180 10:72881169-72881191 CTTTTTCAATAAATGGTGCTAGG + Intronic
1070433617 10:76365973-76365995 CCTTTTCAACAAATGGTGCTGGG - Intronic
1070822345 10:79367146-79367168 TAATCTTAACAAGTGGTGCTGGG + Intergenic
1070941450 10:80351795-80351817 ATATCTAAATAACTGGAGCTGGG + Intronic
1071020736 10:81052231-81052253 CGTTTTCAACAAATGGTGCTGGG + Intergenic
1071023795 10:81088442-81088464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1071035036 10:81234533-81234555 CCTTTTCAACAAATGGTGCTCGG - Intergenic
1071405430 10:85325564-85325586 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1071425065 10:85541219-85541241 CACTCTAATCAAATGGGGCTTGG - Intergenic
1071881791 10:89907030-89907052 CTATTTGATAAAATGGTGCTGGG - Intergenic
1071900355 10:90114308-90114330 CTTATTTAACAAATGGTGCTGGG - Intergenic
1072112202 10:92333360-92333382 CTATCTCAGCACATGGTACTTGG - Intronic
1072953057 10:99865025-99865047 CTAATTTAATAAATGGTGCTGGG - Intergenic
1073742015 10:106418049-106418071 CAAATTCAACAAATGGTGCTGGG + Intergenic
1073889860 10:108088540-108088562 CTATTTCAACAAATGGTTCTGGG + Intergenic
1074117706 10:110469705-110469727 CCTTTTTAACAAATGGTGCTGGG - Intergenic
1074274694 10:111990130-111990152 ATATCTCTACAAAGGGTGCTAGG - Intergenic
1074985401 10:118654261-118654283 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1075660212 10:124188821-124188843 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1075889280 10:125931939-125931961 CCTTTTCAACAAATGGTGCTGGG - Intronic
1075947198 10:126444929-126444951 CTTTTTCAACAAATGGTGCTGGG + Intronic
1075982348 10:126751094-126751116 CATTTTCAACAAATGGTGCTGGG - Intergenic
1076578410 10:131489244-131489266 CATTTTCAACAAATGGTGCTGGG + Intergenic
1076665137 10:132083764-132083786 CCCTTTTAACAAATGGTGCTGGG - Intergenic
1077448320 11:2614611-2614633 GTCTTTTAACAAATGGTGCTGGG - Intronic
1077700952 11:4441972-4441994 GTTTTCAAACAAATGGTGCTGGG + Intergenic
1077802570 11:5555673-5555695 CTGCCTCAACAAATGGTGGTTGG - Intronic
1078289047 11:9988171-9988193 CCTTTTCAACAAATGGTGCTGGG + Intronic
1078632925 11:13019983-13020005 CAATTTCAACAAATGGTTCTGGG - Intergenic
1078842065 11:15086903-15086925 CATACTCAACAAATGGTGCTGGG - Intergenic
1079260005 11:18869372-18869394 CCTTTTAAATAAATGGTGCTGGG + Intergenic
1079463847 11:20709271-20709293 CCTATTAAACAAATGGTGCTGGG - Intronic
1079641977 11:22816770-22816792 CATTTTCAACAAATGGTGCTGGG - Intronic
1079791261 11:24742925-24742947 CCTTTTCAACAAATGGTGCTGGG - Intronic
1079843235 11:25429906-25429928 CTATTTAAATAAATGGTGCTGGG + Intergenic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1080324523 11:31054744-31054766 CTTTTTCAGCAAATGGTGCTGGG + Intronic
1080567750 11:33527352-33527374 CTTATTCAACAAATGGTGCTGGG + Intergenic
1080650433 11:34218537-34218559 CCTTTTTAACAAATGGTGCTAGG - Intronic
1080672127 11:34390243-34390265 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1080863026 11:36166871-36166893 CTCGCTATTCAAATGGTGCTTGG - Intronic
1081009384 11:37789615-37789637 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1081106110 11:39071880-39071902 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1081402041 11:42654666-42654688 CTATTTAAAAAAATGGTTCTAGG - Intergenic
1083017085 11:59465484-59465506 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1083086237 11:60148920-60148942 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1083500940 11:63107163-63107185 CTATTTTAATAAATGTTGCTGGG - Intronic
1084803217 11:71560036-71560058 GTACTTCAACAAATGGTGCTGGG + Intronic
1085485196 11:76857748-76857770 GTCTTTCAACAAATGGTGCTGGG - Intergenic
1085749047 11:79143707-79143729 ATAAATAAATAAATGGTGCTGGG + Intronic
1086082397 11:82918317-82918339 CCTTTTCAACAAATGGTGCTGGG - Intronic
1086824877 11:91484427-91484449 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1087442511 11:98204746-98204768 CCACTTCAACAAATGGTGCTGGG + Intergenic
1087602432 11:100333693-100333715 CCATTTCAACAAATGGTGCTGGG + Intronic
1087878483 11:103387734-103387756 CTATTTTAATAAATGGTGCTGGG - Intronic
1087992645 11:104764790-104764812 GTATCTAAACAGAAGGTGCTGGG + Intergenic
1088197459 11:107291327-107291349 CTTTATAATAAAATGGTGCTGGG - Intergenic
1088206839 11:107401990-107402012 CCTTTTCAACAAATGGTGCTGGG + Intronic
1088362494 11:109005739-109005761 CCTACTTAACAAATGGTGCTGGG + Intergenic
1088414207 11:109570966-109570988 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1089952489 11:122542218-122542240 CCCTTTAAACAAATGGTGCTGGG - Intergenic
1090142651 11:124281168-124281190 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1090368773 11:126230846-126230868 CTATCAAAACAAGAGCTGCTGGG + Intronic
1091210056 11:133849608-133849630 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1091503357 12:1041046-1041068 CTACATAAACAAAAGCTGCTTGG - Intronic
1091772402 12:3161472-3161494 TTATGTCAACAAATGGTGCTGGG - Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1092399300 12:8160056-8160078 CCTTTTCAACAAATGGTGCTGGG - Intronic
1093011034 12:14107044-14107066 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1093319813 12:17700608-17700630 CTATTTAATAAAATGGTGCTGGG - Intergenic
1093326095 12:17776002-17776024 CCAACTCAACAAATGGTGCCGGG + Intergenic
1093408812 12:18840483-18840505 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1093951978 12:25172861-25172883 CCTTTTCAACAAATGGTGCTGGG + Intronic
1093995413 12:25635892-25635914 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094253081 12:28388765-28388787 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094778719 12:33764234-33764256 CCTACTCAACAAATGGTGCTGGG + Intergenic
1094802444 12:34052376-34052398 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1094816973 12:34197341-34197363 CCTACTCAACAAATGGTGCTGGG - Intergenic
1095115605 12:38348315-38348337 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1095229044 12:39715294-39715316 CCTTTTCAACAAATGGTGCTGGG - Intronic
1095234893 12:39784483-39784505 CCTACTTAACAAATGGTGCTGGG + Intronic
1095560439 12:43558484-43558506 CATTTTCAACAAATGGTGCTGGG - Intergenic
1095896491 12:47285241-47285263 CTTACTCAATAAATGGTGCTGGG + Intergenic
1096437463 12:51606321-51606343 CCTTTTCAACAAATGGTGCTGGG - Intronic
1096733039 12:53629833-53629855 CTTTTCCAACAAATGGTGCTGGG - Intergenic
1096750489 12:53755904-53755926 TTATCCAAAAAACTGGTGCTGGG - Intergenic
1096892644 12:54787606-54787628 GTTTGTTAACAAATGGTGCTGGG - Intergenic
1097200611 12:57275227-57275249 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097465956 12:59924785-59924807 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1097492355 12:60285596-60285618 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1097607500 12:61773615-61773637 CCTTTTCAACAAATGGTGCTAGG + Intronic
1097638943 12:62155702-62155724 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097660152 12:62421323-62421345 CCACTTCAACAAATGGTGCTGGG + Intergenic
1097760867 12:63462430-63462452 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1097787330 12:63775769-63775791 CTATCTCAAAAAATAGTTCTAGG + Intergenic
1098004549 12:65982119-65982141 CCTTTTTAACAAATGGTGCTGGG + Intergenic
1098015034 12:66095666-66095688 CCTTTTTAACAAATGGTGCTGGG - Intergenic
1098371423 12:69764375-69764397 CTTATTCAACAAATGGTGCTAGG - Intronic
1098406954 12:70137097-70137119 CTTATTCAACAAATGGTGCTGGG + Intergenic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1098654222 12:73007989-73008011 CCTACTCAACAAATGGTGCTGGG - Intergenic
1098945045 12:76580528-76580550 TATCCTAAACAAATGGTGCTGGG + Intergenic
1098952727 12:76658378-76658400 CCTTTTAAACAAATGGTGCTCGG + Intergenic
1099059001 12:77882339-77882361 CTATTTCAATAAATGGTGCTGGG + Intronic
1099393136 12:82103964-82103986 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1099472604 12:83069921-83069943 CCTTTTCAACAAATGGTGCTGGG - Intronic
1099730405 12:86492555-86492577 CTATTTAATAAAATGGTGCTGGG + Intronic
1099777019 12:87146845-87146867 CCTTGTCAACAAATGGTGCTGGG - Intergenic
1100046592 12:90389076-90389098 CCTTTTAAAGAAATGGTGCTGGG + Intergenic
1100534847 12:95498662-95498684 CAGTCTTAACAAATGGTGCTGGG - Intronic
1100834044 12:98548807-98548829 CTTTCTAATCAAATTATGCTGGG - Intronic
1100925505 12:99542742-99542764 TTTTTTCAACAAATGGTGCTGGG + Intronic
1101303954 12:103508620-103508642 ATAAATAAATAAATGGTGCTAGG - Intergenic
1101634868 12:106531006-106531028 CCTTTTCAACAAATGGTGCTGGG - Intronic
1102069956 12:110010295-110010317 CAATCTAAATGAAAGGTGCTAGG - Intronic
1102916270 12:116755219-116755241 CCTTTTCAACAAATGGTGCTGGG - Intronic
1104332956 12:127864780-127864802 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1105340983 13:19525455-19525477 CCTACTCAACAAATGGTGCTGGG + Intronic
1105908693 13:24839640-24839662 CCTTTTCAACAAATGGTGCTGGG + Intronic
1105931206 13:25054265-25054287 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106393616 13:29359451-29359473 CTTTCTAAAGAAATGCTGCGTGG - Exonic
1106691472 13:32122011-32122033 CCTTTTCAACAAATGGTGCTGGG - Intronic
1106921169 13:34564864-34564886 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106963160 13:35025398-35025420 CTAACTCAATAAATGGTGCTGGG - Intronic
1106977886 13:35244347-35244369 CTCTTTCAACAAATGGTGCTGGG - Intronic
1107201763 13:37728938-37728960 TTTTTTCAACAAATGGTGCTGGG + Intronic
1107453163 13:40530595-40530617 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1107755579 13:43618471-43618493 CCTTTTCAACAAATGGTGCTGGG - Intronic
1107960932 13:45557663-45557685 CTTATTCAACAAATGGTGCTGGG - Intronic
1108987310 13:56609088-56609110 CTTTTCAAAAAAATGGTGCTGGG - Intergenic
1109125775 13:58515238-58515260 CCTTGTCAACAAATGGTGCTGGG + Intergenic
1109213208 13:59558800-59558822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1109478000 13:62910201-62910223 CATTGTCAACAAATGGTGCTGGG + Intergenic
1109585748 13:64400869-64400891 TTTTTTCAACAAATGGTGCTGGG - Intergenic
1109597593 13:64576949-64576971 CCAATTAACCAAATGGTGCTGGG + Intergenic
1109920601 13:69052872-69052894 CCTTTTTAACAAATGGTGCTAGG + Intergenic
1110336671 13:74340472-74340494 CTTTTTTAATAAATGGTGCTGGG - Intergenic
1110394872 13:75018087-75018109 CTTATTTAACAAATGGTGCTGGG + Intergenic
1110501787 13:76236962-76236984 CAGTCTCAATAAATGGTGCTTGG + Intergenic
1110975565 13:81829603-81829625 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1111021083 13:82453358-82453380 CCTGTTAAACAAATGGTGCTGGG + Intergenic
1111963633 13:94838264-94838286 CTTTTTCAACAAATGGTACTGGG + Intergenic
1111988827 13:95094427-95094449 CCTTTTCAACAAATGGTGCTGGG + Intronic
1112055497 13:95686604-95686626 CTAATTCAATAAATGGTGCTGGG - Intronic
1112087391 13:96046243-96046265 CTATTCAAAAAAATGGTGCTGGG + Intronic
1112738532 13:102448252-102448274 CCTTTTTAACAAATGGTGCTAGG + Intergenic
1112747714 13:102545928-102545950 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1112972368 13:105275901-105275923 CTTTTTTAAAAAATGGTGCTAGG + Intergenic
1113905574 13:113817718-113817740 CAAGCAAAACCAATGGTGCTAGG - Intergenic
1114358180 14:21938338-21938360 CTCATTCAACAAATGGTGCTGGG - Intergenic
1114961117 14:27891050-27891072 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1115293832 14:31803184-31803206 CTATTTAAAGTAATGGTGCATGG - Intronic
1115324517 14:32124403-32124425 CTATCTTAATAAGTTGTGCTAGG + Intronic
1115350272 14:32386838-32386860 CGTTTTCAACAAATGGTGCTGGG - Intronic
1115392834 14:32872825-32872847 CTTATTCAACAAATGGTGCTGGG - Intergenic
1115526784 14:34288644-34288666 CCTTTTCAACAAATGGTGCTGGG - Intronic
1115708641 14:36025808-36025830 CTCTTCAAATAAATGGTGCTAGG - Intergenic
1116088628 14:40275130-40275152 CCTATTAAACAAATGGTGCTAGG - Intergenic
1116157561 14:41226820-41226842 CTATCTAATCTAATTGTGATGGG + Intergenic
1116223724 14:42120601-42120623 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1116489489 14:45489481-45489503 GTCTCTCAATAAATGGTGCTGGG - Intergenic
1116773998 14:49158954-49158976 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1117124325 14:52604792-52604814 CAATCTCAATAAATGGTGCTGGG - Intronic
1117768933 14:59112595-59112617 CGTTTTCAACAAATGGTGCTGGG + Intergenic
1117890154 14:60412223-60412245 CTTATTCAACAAATGGTGCTGGG - Intronic
1118162714 14:63306695-63306717 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1118197033 14:63636674-63636696 CCTTTTCAACAAATGGTGCTGGG + Intronic
1118250322 14:64153935-64153957 CTTTCTTGAAAAATGGTGCTGGG + Intronic
1118449917 14:65891252-65891274 CTATATAAACAAACGGTATTTGG - Intergenic
1119837821 14:77766647-77766669 TTTTTTCAACAAATGGTGCTGGG + Intronic
1120356059 14:83435536-83435558 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1121032309 14:90669122-90669144 TTTTTTCAACAAATGGTGCTAGG + Intronic
1121295940 14:92823193-92823215 CTATTTAAAAAAATGATACTAGG - Intronic
1121516180 14:94551911-94551933 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1122677354 14:103426766-103426788 CTTTCTGAACAAAGGCTGCTAGG + Intronic
1123863366 15:24490828-24490850 ATATTTTAACAAATGTTGCTAGG - Intergenic
1124176551 15:27430630-27430652 TCATTTAAACAAATGTTGCTGGG - Intronic
1124682848 15:31750835-31750857 CTTATTCAACAAATGGTGCTGGG + Intronic
1124806683 15:32890970-32890992 CCTTTTCAACAAATGGTGCTGGG - Intronic
1124905730 15:33866863-33866885 ATATCTAAACAAATAAAGCTGGG + Intronic
1125268952 15:37916865-37916887 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1125273058 15:37961273-37961295 CTTTTTCAACAAATAGTGCTGGG - Intronic
1125307322 15:38333803-38333825 CTATTTCAATAAATGTTGCTAGG - Intronic
1125377427 15:39045479-39045501 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1125396876 15:39258567-39258589 CTATTTAAATAAATGGTGCTGGG + Intergenic
1125465942 15:39952569-39952591 ATAGATATACAAATGGTGCTGGG - Intronic
1125741589 15:41968971-41968993 ATAGTTCAACAAATGGTGCTAGG - Intronic
1126060060 15:44772102-44772124 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1126424181 15:48508004-48508026 CAAACTAAAAAAATGGTTCTTGG + Intronic
1126460385 15:48908783-48908805 CCTTTTCAACAAATGGTGCTGGG - Intronic
1126566317 15:50103990-50104012 CCAATTTAACAAATGGTGCTGGG + Intronic
1126611766 15:50537196-50537218 CTTTTTCAACAAATGGTGCTAGG + Intronic
1127050557 15:55079151-55079173 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1127194864 15:56573276-56573298 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1127525190 15:59785989-59786011 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1128415469 15:67441645-67441667 CCTTTTCAACAAATGGTGCTGGG + Intronic
1129096500 15:73214504-73214526 CCTTTTCAACAAATGGTGCTGGG - Intronic
1130366590 15:83245831-83245853 CTTATTCAACAAATGGTGCTGGG - Intergenic
1130523650 15:84684634-84684656 CTATTAAACCAAATGGGGCTGGG + Intronic
1130731813 15:86501679-86501701 CCTTTTCAACAAATGGTGCTAGG - Intronic
1130779960 15:87025916-87025938 CCTTTTCAACAAATGGTGCTGGG + Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1130852396 15:87807534-87807556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1130998311 15:88917848-88917870 CTTTCTACATAAAAGGTGCTGGG - Intergenic
1132412501 15:101593764-101593786 CTCATTCAACAAATGGTGCTGGG - Intergenic
1133501174 16:6368260-6368282 CTTTCCAGAAAAATGGTGCTGGG + Intronic
1134333947 16:13277147-13277169 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1135674023 16:24399637-24399659 GTCTTTCAACAAATGGTGCTGGG + Intergenic
1137020180 16:35417302-35417324 CCTATTAAACAAATGGTGCTGGG - Intergenic
1137821937 16:51454397-51454419 CTCTCTAAACACATGGGACTTGG + Intergenic
1137946565 16:52738360-52738382 TTATTTTAATAAATGGTGCTGGG + Intergenic
1138035769 16:53604423-53604445 CTAACTTAACAAATGGGACTAGG + Intronic
1138259386 16:55603557-55603579 CTATTTAAATAAATGGTGCTGGG + Intergenic
1138924316 16:61572219-61572241 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1138937416 16:61745956-61745978 CTATCTAAACATATCTTCCTGGG - Intronic
1140064386 16:71598339-71598361 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1140620088 16:76719293-76719315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1142293538 16:89204354-89204376 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1142553555 17:756205-756227 CAATCTAAACTAATCGCGCTTGG + Intergenic
1143221797 17:5268127-5268149 CTTCTTCAACAAATGGTGCTGGG + Intergenic
1144139256 17:12332065-12332087 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1146139584 17:30353575-30353597 CCTTTTTAACAAATGGTGCTGGG - Intergenic
1146147647 17:30435420-30435442 TTTTTTAAATAAATGGTGCTGGG + Intronic
1146454823 17:33001264-33001286 TTTTTTCAACAAATGGTGCTGGG - Intergenic
1146583798 17:34064285-34064307 CCTTTTCAACAAATGGTGCTGGG + Intronic
1146750931 17:35379388-35379410 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1146751045 17:35380837-35380859 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1146981838 17:37169999-37170021 CTGACTAAACAAGTGGTCCTAGG + Intronic
1147462733 17:40584325-40584347 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1149106062 17:52966873-52966895 TTATTTAAAAAAATGGTACTGGG - Intergenic
1149182748 17:53958858-53958880 CTGTTCAAAAAAATGGTGCTGGG + Intergenic
1149410501 17:56400820-56400842 CCTTTTCAACAAATGGTGCTGGG - Intronic
1149934852 17:60794636-60794658 CCTTTTCAACAAATGGTGCTGGG - Intronic
1150189929 17:63227837-63227859 ATAAATAAATAAATGGTGCTGGG - Intronic
1151048779 17:70952400-70952422 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1151050072 17:70967980-70968002 CAATATAAACAAATGCTGTTGGG + Intergenic
1152521901 17:80861479-80861501 TTATGTAAACAAAGGGTGTTTGG + Intronic
1153069095 18:1084783-1084805 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1153079516 18:1206015-1206037 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153168519 18:2289144-2289166 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153399166 18:4664209-4664231 CTTTTAAAACAAATGGTGGTTGG + Intergenic
1153402286 18:4694304-4694326 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1153425490 18:4958756-4958778 CTTATTTAACAAATGGTGCTGGG + Intergenic
1154931398 18:21000616-21000638 CTCTTCAAACAAATGTTGCTGGG + Intronic
1154990904 18:21597620-21597642 CTATATAAACAAAAGCTACTTGG + Intronic
1155013742 18:21810642-21810664 TCTTTTAAACAAATGGTGCTTGG + Intronic
1155467169 18:26149693-26149715 TCTTCTAAACAAATGGTGCAGGG + Intronic
1155664531 18:28292760-28292782 CTTTCTAAAGAAATAGTGATTGG + Intergenic
1156094985 18:33518779-33518801 CTATCTAAAGAAAAAGTGGTGGG + Intergenic
1156411877 18:36837816-36837838 TTTTTTTAACAAATGGTGCTGGG - Intronic
1156614197 18:38764076-38764098 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1156667881 18:39430176-39430198 CTTATTCAACAAATGGTGCTGGG + Intergenic
1156881073 18:42080154-42080176 CTTCCTAAAGAAATGGTACTCGG - Intronic
1156984757 18:43336825-43336847 CTTTTTCAACAAATGGTGCTAGG - Intergenic
1157003520 18:43554849-43554871 CCTACTCAACAAATGGTGCTGGG - Intergenic
1157023962 18:43820534-43820556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1157121387 18:44914603-44914625 CTATGTAATCAAATGATGGTGGG + Intronic
1157219420 18:45816048-45816070 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1158003023 18:52641124-52641146 CCTTTTCAACAAATGGTGCTGGG + Intronic
1158082101 18:53604853-53604875 CTATCCAAACAAAATGTTCTGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158278923 18:55799713-55799735 CTATTTAACAAAATGGTGCTGGG - Intergenic
1158443188 18:57495575-57495597 CTGTTTAACAAAATGGTGCTGGG + Intergenic
1158460032 18:57638154-57638176 CCATCTCAATAAATGGTGCCGGG - Intergenic
1158756912 18:60336236-60336258 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1159391422 18:67797433-67797455 CTATCTGCACTAATTGTGCTGGG + Intergenic
1160105767 18:75974494-75974516 CTTTCTTCACAAATGGTGTTTGG - Intergenic
1160270471 18:77378947-77378969 CTATTTAAAAAAATGCTGTTGGG + Intergenic
1160469986 18:79122196-79122218 CTATATAAATAAAATGTGCTTGG + Intronic
1163208910 19:15825710-15825732 CTATTTTAAAAAATGGTGCTGGG + Intergenic
1163416023 19:17187021-17187043 CTATAAAGACAAACGGTGCTGGG - Intronic
1164298812 19:23940248-23940270 CCTTTTCAACAAATGGTGCTGGG - Intronic
1165824666 19:38698907-38698929 TTGTCAAAACACATGGTGCTTGG + Intronic
1166910448 19:46151330-46151352 ATTTTTCAACAAATGGTGCTGGG - Intronic
1167154048 19:47727416-47727438 CTTTCTGTACACATGGTGCTGGG + Intronic
1167202915 19:48079430-48079452 CTTATTCAACAAATGGTGCTGGG + Intronic
1167421506 19:49406673-49406695 CCATCTATAAAAATGGAGCTAGG - Intronic
1167918308 19:52760565-52760587 TTATTTAAACAAATTGTGTTTGG - Intergenic
925069970 2:958887-958909 ATATCTAAAACAATGATGCTTGG + Intronic
925302894 2:2829552-2829574 ATTTCTAAACAAATGGAGTTGGG - Intergenic
925441658 2:3892615-3892637 CTTATTCAACAAATGGTGCTGGG - Intergenic
926033669 2:9616223-9616245 TTATTTCAACAAATGGTGCCAGG + Intronic
926122209 2:10248923-10248945 TTTTTTCAACAAATGGTGCTGGG - Intergenic
926130303 2:10299074-10299096 CTTTTTCAACAAATGGTGCTGGG + Intergenic
926539558 2:14158621-14158643 CTTTTTTAATAAATGGTGCTGGG - Intergenic
926560573 2:14412924-14412946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
926649020 2:15321153-15321175 CTTATTTAACAAATGGTGCTTGG + Intronic
927116328 2:19905783-19905805 TTTTTTAAACAAATGGTGCTAGG + Intergenic
927230538 2:20820523-20820545 CCTACTTAACAAATGGTGCTGGG + Intronic
927315961 2:21682875-21682897 ATCTTTAAACAAATGGTTCTAGG + Intergenic
927327940 2:21828005-21828027 CCTTTTCAACAAATGGTGCTGGG - Intergenic
928264161 2:29797126-29797148 CAATCTAAAGAAAGGTTGCTAGG - Intronic
928473375 2:31597231-31597253 CCTACTCAACAAATGGTGCTGGG + Intergenic
928581780 2:32715305-32715327 CTTATTCAACAAATGGTGCTGGG - Intronic
928766693 2:34654871-34654893 CTTATTTAACAAATGGTGCTGGG + Intergenic
929009883 2:37430639-37430661 CCTTTTCAACAAATGGTGCTGGG - Intergenic
929039313 2:37728037-37728059 CTTATTTAACAAATGGTGCTGGG + Intronic
929186774 2:39103550-39103572 CCTGCTCAACAAATGGTGCTGGG + Intronic
929339659 2:40799638-40799660 CCATTTTAACAAATGGTGCTGGG - Intergenic
929620028 2:43345385-43345407 TTCTCTAAACAGAAGGTGCTTGG - Intronic
929806260 2:45148226-45148248 CCTTTTCAACAAATGGTGCTGGG + Intergenic
930486112 2:52013360-52013382 CCTTTTCAACAAATGGTGCTGGG - Intergenic
930757890 2:54996594-54996616 TCTTTTAAACAAATGGTGCTAGG + Intronic
931017083 2:57994688-57994710 CCATATAAACAAATGGTCTTTGG - Intronic
931524690 2:63140045-63140067 CCTTTTCAACAAATGGTGCTGGG - Intronic
931558920 2:63535620-63535642 CTATTACAATAAATGGTGCTAGG + Intronic
931710344 2:64984686-64984708 GTCTCTCAATAAATGGTGCTGGG - Intergenic
932270772 2:70407424-70407446 CCTTTTCAACAAATGGTGCTGGG + Intergenic
932535254 2:72586008-72586030 CTAATTCAATAAATGGTGCTGGG + Intronic
932926044 2:75976074-75976096 CCTACTCAACAAATGGTGCTGGG - Intergenic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
934044180 2:88158327-88158349 CCTTTTCAACAAATGGTGCTGGG - Intergenic
935001095 2:99016404-99016426 CTTATTCAACAAATGGTGCTGGG + Intronic
935007505 2:99094161-99094183 CTTATTCAACAAATGGTGCTGGG + Intronic
935467564 2:103417063-103417085 CCTTTTCAACAAATGGTGCTGGG + Intergenic
936050589 2:109220184-109220206 CCTTTTTAACAAATGGTGCTGGG + Intronic
936407454 2:112219340-112219362 GTCTTTCAACAAATGGTGCTAGG + Intronic
936517311 2:113190246-113190268 CTTTTTCAACAAATGGTGTTGGG - Intronic
936555255 2:113491405-113491427 CCTTTTCAACAAATGGTGCTGGG + Intronic
936590680 2:113800964-113800986 CCGTTTTAACAAATGGTGCTGGG - Intergenic
936860047 2:117006027-117006049 CTTATTTAACAAATGGTGCTGGG + Intergenic
936958058 2:118043211-118043233 ATTTTTCAACAAATGGTGCTGGG - Intergenic
937058277 2:118958895-118958917 CCTTTTCAACAAATGGTGCTGGG + Intronic
937068832 2:119045902-119045924 CCTTTTCAACAAATGGTGCTGGG - Intergenic
937178968 2:119971875-119971897 TCATTTTAACAAATGGTGCTGGG - Intronic
937823725 2:126341585-126341607 ATATTTTCACAAATGGTGCTGGG + Intergenic
938168326 2:129052711-129052733 TTTTCATAACAAATGGTGCTGGG + Intergenic
938597845 2:132806989-132807011 CCTTTTCAACAAATGGTGCTAGG - Intronic
938640840 2:133277893-133277915 CTTTTTAAACAAACAGTGCTGGG + Intronic
939032052 2:137088387-137088409 CCTTTTAAACAAATGGTACTGGG + Intronic
939141704 2:138361557-138361579 TTTTTTCAACAAATGGTGCTAGG - Intergenic
939172893 2:138716160-138716182 CTATTTAAAAAAATGGAGTTCGG - Intronic
939179732 2:138790129-138790151 CTTATTTAACAAATGGTGCTGGG - Intergenic
939759100 2:146152359-146152381 CTTATTTAACAAATGGTGCTGGG - Intergenic
940028263 2:149231867-149231889 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940537958 2:154970669-154970691 CTATCTAGACAAATTATGTTAGG - Intergenic
940594626 2:155774348-155774370 TTTTTTCAACAAATGGTGCTTGG - Intergenic
940623306 2:156141605-156141627 CCTACTTAACAAATGGTGCTGGG + Intergenic
940680726 2:156781694-156781716 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940707212 2:157120278-157120300 CCTTTTCAACAAATGGTGCTGGG - Intergenic
940709002 2:157139570-157139592 CCTTTTCAACAAATGGTGCTGGG - Intergenic
941356262 2:164496223-164496245 CAATTTAAACAAGTGGTGATGGG - Intronic
941425201 2:165335511-165335533 CCTTTTCAACAAATGGTGCTTGG + Intronic
941627841 2:167849489-167849511 CCTTTTCAACAAATGGTGCTGGG + Intergenic
941742468 2:169049622-169049644 CTTTCCAACAAAATGGTGCTGGG + Intergenic
942154330 2:173111656-173111678 CCTTTTCAACAAATGGTGCTGGG - Intronic
942341582 2:174954202-174954224 CTAATTCAACAAATGGTGCTGGG + Intronic
942365119 2:175218025-175218047 TAATTTCAACAAATGGTGCTAGG + Intergenic
942726536 2:179014180-179014202 CCTTTTCAACAAATGGTGCTGGG + Intronic
942739390 2:179157054-179157076 CCTTTTCAACAAATGGTGCTGGG - Intronic
942744006 2:179211579-179211601 CCTACTAAACAAATGGTGCTGGG + Intronic
942746738 2:179242710-179242732 CTATTCAAATAAATGGTGCTGGG + Intronic
943580551 2:189678656-189678678 CTTATTCAACAAATGGTGCTGGG - Intronic
943610444 2:190027148-190027170 CTCTTTTAACAAATGGTGTTGGG - Intronic
943620922 2:190147232-190147254 CCTTTTCAACAAATGGTGCTAGG - Intronic
944031901 2:195244549-195244571 CCAATTCAACAAATGGTGCTAGG + Intergenic
944261928 2:197687301-197687323 CCTATTAAACAAATGGTGCTGGG - Intergenic
944418469 2:199502855-199502877 TTTTTTCAACAAATGGTGCTAGG + Intergenic
944421106 2:199531224-199531246 CCTTTTCAACAAATGGTGCTGGG + Intergenic
944431583 2:199639570-199639592 CCTTCTCAACAAATGTTGCTGGG - Intergenic
944528489 2:200644293-200644315 CCTTTTCAACAAATGGTGCTAGG - Intronic
944592325 2:201229345-201229367 CAATTTAAACAAATGGTCCATGG + Intronic
944602514 2:201318004-201318026 CTTATTCAACAAATGGTGCTGGG + Intronic
944608399 2:201374528-201374550 CTATTTAATAAAATGGTGCTGGG + Intergenic
945075557 2:206035497-206035519 CCCTTTCAACAAATGGTGCTGGG + Intronic
945337652 2:208611940-208611962 CCTATTAAACAAATGGTGCTGGG - Intronic
945362836 2:208912259-208912281 CCTACTCAACAAATGGTGCTGGG + Intergenic
945612468 2:212021479-212021501 CCTGCTTAACAAATGGTGCTGGG + Intronic
945826222 2:214723107-214723129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
945838670 2:214862464-214862486 CCTTTTCAACAAATGGTGCTGGG - Intergenic
945861250 2:215125035-215125057 CCTTTTCAACAAATGGTGCTGGG - Intronic
945865187 2:215166542-215166564 CCTTTTCAACAAATGGTGCTGGG + Intergenic
947002595 2:225474042-225474064 CTTATTTAACAAATGGTGCTGGG - Intronic
947462274 2:230313731-230313753 CTGTCTAGCCCAATGGTGCTGGG + Intergenic
948065007 2:235071390-235071412 CTTTTTCAACAAATGGTGCTGGG + Intergenic
948985033 2:241516315-241516337 TTTTTTCAACAAATGGTGCTGGG + Intergenic
1169401780 20:5287713-5287735 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1169517041 20:6328583-6328605 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1169624942 20:7555315-7555337 CCTTTTAAACAAATGGTGCTGGG - Intergenic
1169722603 20:8695399-8695421 CTATTTAAAAAAATGATGGTAGG + Intronic
1169797048 20:9474238-9474260 CTAACTAAACAGTTGGTGTTTGG - Intronic
1170054333 20:12182843-12182865 CCCTTTCAACAAATGGTGCTAGG - Intergenic
1170720626 20:18874912-18874934 CTTTTTCAACAAATGGTGCTGGG - Intergenic
1170862744 20:20123485-20123507 CCTTATCAACAAATGGTGCTGGG - Intronic
1170984762 20:21247389-21247411 CCATTTCAACAAATGATGCTGGG + Intergenic
1171192927 20:23172669-23172691 CATTTTCAACAAATGGTGCTAGG - Intergenic
1172469821 20:35184313-35184335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1172879031 20:38185948-38185970 GTCTTTCAACAAATGGTGCTAGG - Intergenic
1173568776 20:44062898-44062920 CTTATTCAACAAATGGTGCTTGG + Intronic
1173716746 20:45214537-45214559 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1174241485 20:49139005-49139027 CTTGTTCAACAAATGGTGCTAGG + Intronic
1174600691 20:51722099-51722121 CCTTTTCAACAAATGGTGCTGGG + Intronic
1175629519 20:60523030-60523052 CATTTTCAACAAATGGTGCTGGG + Intergenic
1175684537 20:61018143-61018165 CCTTTTTAACAAATGGTGCTAGG + Intergenic
1176174424 20:63712235-63712257 TCTTTTAAACAAATGGTGCTGGG - Intronic
1176906481 21:14507965-14507987 CCTTTTCAACAAATGGTGCTAGG + Intronic
1177325689 21:19585744-19585766 TCATCTCAATAAATGGTGCTGGG - Intergenic
1177386620 21:20417855-20417877 CATTCAAAACAAATGGGGCTGGG + Intergenic
1177548703 21:22593413-22593435 CCTTATCAACAAATGGTGCTGGG + Intergenic
1177688317 21:24469029-24469051 CAATTTCAACAAATGGTGCTGGG + Intergenic
1177750046 21:25269947-25269969 CCAGTTCAACAAATGGTGCTGGG + Intergenic
1177813110 21:25945990-25946012 CTTTTTCAACAAATGGTGCTGGG + Intronic
1178054876 21:28787121-28787143 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1178059861 21:28840124-28840146 TTCTTTCAACAAATGGTGCTGGG + Intergenic
1178964859 21:37106932-37106954 CTCTTTTAATAAATGGTGCTGGG - Intronic
1179063466 21:38002252-38002274 TTTTCTCAACAAATGCTGCTGGG - Intronic
1179191876 21:39129830-39129852 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1182513266 22:30835363-30835385 TATTCTCAACAAATGGTGCTGGG - Intronic
1185121105 22:48971172-48971194 CTTGTTCAACAAATGGTGCTGGG + Intergenic
949509895 3:4758624-4758646 CTGTGTAAACAAGTGGTCCTGGG - Intronic
949727400 3:7065422-7065444 CCTTTTCAACAAATGGTGCTGGG - Intronic
949814667 3:8045457-8045479 CCTTTTCAACAAATGGTGCTGGG + Intergenic
950137707 3:10593472-10593494 CCTACTTAACAAATGGTGCTGGG + Intronic
950599668 3:14021894-14021916 CCAGTTCAACAAATGGTGCTAGG - Intronic
951302316 3:21013105-21013127 CTTATTCAACAAATGGTGCTGGG - Intergenic
951353639 3:21637333-21637355 CCTTTTCAACAAATGGTGCTGGG - Intronic
951463360 3:22975076-22975098 CTTTTTCAACAAATGGTGCTGGG + Intergenic
951572033 3:24074308-24074330 CCTTTTCAACAAATGGTGCTGGG - Intergenic
951749890 3:26023044-26023066 CTTATTCAACAAATGGTGCTGGG - Intergenic
951763837 3:26174696-26174718 CCTTTTCAACAAATGGTGCTAGG - Intergenic
951852398 3:27156046-27156068 CCTTTTCAACAAATGGTGCTGGG + Intronic
951858125 3:27220929-27220951 TTATTTCAACAAATGGTACTGGG + Intronic
952097018 3:29965959-29965981 CCTTTTCAACAAATGGTGCTGGG - Intronic
952657136 3:35800485-35800507 CTATCTAGACAAATTGGACTGGG - Intergenic
953004166 3:38962099-38962121 CCTTTTCAACAAATGGTGCTGGG - Intergenic
953255270 3:41284503-41284525 CCCTTTCAACAAATGGTGCTGGG + Intronic
953554110 3:43928799-43928821 GTCTTTCAACAAATGGTGCTGGG + Intergenic
954095515 3:48323678-48323700 CTTTTTAAACAAATGCTGCTAGG - Intronic
955477143 3:59349042-59349064 CCTTTTCAACAAATGGTGCTGGG - Intergenic
955859700 3:63314966-63314988 CCTTTTCAACAAATGGTGCTGGG - Intronic
955937722 3:64118111-64118133 CCTGCTAAATAAATGGTGCTGGG + Intronic
956111439 3:65873733-65873755 CCTTTTCAACAAATGGTGCTGGG + Intronic
956394366 3:68809787-68809809 ATCTCTCAATAAATGGTGCTGGG - Intronic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
957015831 3:75064050-75064072 CCTTTTCAACAAATGGTGCTGGG - Intergenic
957288812 3:78250434-78250456 CTATCAAAAGGAATGGTGGTGGG + Intergenic
957308965 3:78494608-78494630 CTATCTATACAAATGGCATTAGG + Intergenic
957415199 3:79893040-79893062 CTTTCCAAACAAATGGGACTTGG + Intergenic
957428031 3:80065075-80065097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
957473477 3:80692367-80692389 ATATCTTCATAAATGGTGCTGGG - Intergenic
957641995 3:82866371-82866393 CCTTCTAAATAAATGGTGCTGGG - Intergenic
958480393 3:94638778-94638800 CCTTTTCAACAAATGGTGCTGGG - Intergenic
958495003 3:94833721-94833743 CTTCCTATTCAAATGGTGCTGGG + Intergenic
958507544 3:94999432-94999454 CTATTTAATAAAATGGTGTTGGG - Intergenic
958512872 3:95071481-95071503 CCACCTGAACAAATGGTGTTGGG + Intergenic
958827246 3:99045919-99045941 CTTCCTGAATAAATGGTGCTGGG + Intergenic
958969516 3:100596194-100596216 CCTTTTTAACAAATGGTGCTGGG - Intergenic
959034534 3:101345677-101345699 CTTATTCAACAAATGGTGCTGGG + Intronic
959131897 3:102366484-102366506 CCTTTTCAACAAATGGTGCTGGG - Intronic
959186450 3:103052936-103052958 GTATGTAAAAAAATGGAGCTTGG - Intergenic
959274921 3:104266511-104266533 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959325264 3:104928996-104929018 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959436571 3:106322145-106322167 CCTTTTCAACAAATGGTGCTGGG + Intergenic
959462102 3:106639838-106639860 CTATCTATACCGATGGTGCCTGG - Intergenic
959900852 3:111660777-111660799 CTAATTCAATAAATGGTGCTGGG + Intronic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
960491246 3:118318861-118318883 CTGTCTTCAAAAATGGTGCTGGG + Intergenic
960510065 3:118539471-118539493 CTATTTTAACAAATGGTGATAGG - Intergenic
960524837 3:118697799-118697821 CCTTTTCAACAAATGGTGCTGGG + Intergenic
961264319 3:125628609-125628631 CCTTTTCAACAAATGGTGCTGGG - Intergenic
961468372 3:127095811-127095833 CCCTTTCAACAAATGGTGCTGGG - Intergenic
962504444 3:136031735-136031757 CTTTTCAAACAAATGGTGCTGGG - Intronic
963113328 3:141704550-141704572 CCTTTTCAACAAATGGTGCTGGG + Intergenic
963143511 3:141967893-141967915 CTATCAGAAAGAATGGTGCTGGG - Intronic
963635375 3:147788229-147788251 CTGTTTAAAGAAATGCTGCTTGG + Intergenic
963699702 3:148609177-148609199 CCTTTTCAACAAATGGTGCTGGG - Intergenic
964062815 3:152544720-152544742 CTTTTTCAATAAATGGTGCTGGG + Intergenic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964142136 3:153415902-153415924 CTTACTCAATAAATGGTGCTGGG - Intergenic
964166302 3:153709933-153709955 CCTTTTCAACAAATGGTGCTGGG + Intergenic
964430102 3:156596564-156596586 CCTTTTCAACAAATGGTGCTGGG + Intergenic
965052345 3:163667010-163667032 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965128937 3:164669620-164669642 CTAATTTAACAAATGGTGTTGGG + Intergenic
965200678 3:165654113-165654135 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965321582 3:167258426-167258448 CCTTTTAAACAAATGGTGCTGGG - Intronic
965361881 3:167751631-167751653 TTATCGACACAAATGGTGATGGG + Intronic
965631402 3:170736837-170736859 CCTTTTAAATAAATGGTGCTGGG + Intronic
965982145 3:174706212-174706234 CTTTTTCAAAAAATGGTGCTGGG + Intronic
966114840 3:176449369-176449391 CCTACTTAACAAATGGTGCTGGG - Intergenic
966117298 3:176480727-176480749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966164430 3:177001242-177001264 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966344114 3:178959500-178959522 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966492015 3:180538457-180538479 CTTATTTAACAAATGGTGCTGGG - Intergenic
967505540 3:190249122-190249144 CTGTTTCAACAAATGATGCTGGG - Intergenic
969546489 4:7832911-7832933 CCTTTTCAACAAATGGTGCTGGG + Intronic
970107405 4:12600374-12600396 CCTACTTAACAAATGGTGCTGGG + Intergenic
970217058 4:13770449-13770471 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970640575 4:18061167-18061189 TCATTTCAACAAATGGTGCTGGG - Intergenic
970658237 4:18255783-18255805 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970874464 4:20853400-20853422 CCTTTTCAACAAATGGTGCTGGG + Intronic
971107740 4:23545284-23545306 CTTACTCAATAAATGGTGCTAGG + Intergenic
971182714 4:24344986-24345008 CCTTTTCAACAAATGGTGCTGGG - Intergenic
971276297 4:25200666-25200688 CCTTTTCAACAAATGGTGCTGGG + Intronic
971565164 4:28129904-28129926 CCTTTTCAACAAATGGTGCTGGG + Intergenic
972013775 4:34218029-34218051 CCATTTCAACAAATGATGCTGGG + Intergenic
972233695 4:37104395-37104417 CCTTCTTAATAAATGGTGCTGGG + Intergenic
972269614 4:37498142-37498164 CCCTTTCAACAAATGGTGCTTGG - Intronic
972616962 4:40708286-40708308 CTTTTTAGACAAATAGTGCTGGG + Intergenic
973179187 4:47247251-47247273 CCTTTTCAACAAATGGTGCTGGG - Intronic
973244128 4:47991899-47991921 CCTTTTCAACAAATGGTGCTTGG - Intronic
973787445 4:54346370-54346392 CCTTTTCAACAAATGGTGCTGGG + Intergenic
973792195 4:54388658-54388680 CCTTTTCAACAAATGGTGCTGGG - Intergenic
974172822 4:58290008-58290030 CTATATAAACAAATGATGGGAGG - Intergenic
974221177 4:58973631-58973653 CTTATTAAATAAATGGTGCTGGG - Intergenic
974327773 4:60437293-60437315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
974458097 4:62154445-62154467 CCTTTTCAACAAATGGTGCTGGG + Intergenic
975061703 4:70011085-70011107 CTTATTCAACAAATGGTGCTGGG - Intergenic
975158475 4:71098257-71098279 CTATTTAATAAAATGGTGCTGGG - Intergenic
975357207 4:73421781-73421803 CTTTTTCAACAAATGGTGCTAGG + Intergenic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976372504 4:84305355-84305377 CTCTCTTAATAAATGGTGCTAGG + Intergenic
976393777 4:84533928-84533950 CCTTTTAAATAAATGGTGCTGGG + Intergenic
976976846 4:91176056-91176078 CTATCTAAACAAATGGTGCTGGG - Intronic
977588987 4:98805804-98805826 CTTATTTAACAAATGGTGCTGGG + Intergenic
977825939 4:101531683-101531705 CCTTTTCAACAAATGGTGCTGGG - Intronic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
977844524 4:101752782-101752804 CTTATTCAACAAATGGTGCTGGG - Intronic
978434924 4:108673915-108673937 CCTTTTTAACAAATGGTGCTGGG + Intergenic
978726221 4:111972831-111972853 CCTTTTCAACAAATGGTGCTGGG - Intergenic
978785017 4:112599859-112599881 CTTTTTCAATAAATGGTGCTGGG + Intronic
978960693 4:114674436-114674458 CTGACTAAAAAAATGGTGGTGGG - Intronic
978999043 4:115194984-115195006 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979156514 4:117398432-117398454 CTTATTCAACAAATGGTGCTAGG + Intergenic
979496407 4:121388363-121388385 GTCTTTCAACAAATGGTGCTGGG + Intergenic
979498002 4:121406591-121406613 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979658431 4:123224150-123224172 ATAAATAAATAAATGGTGCTGGG - Intronic
979663960 4:123290428-123290450 CTTTTTCAATAAATGGTGCTGGG - Intronic
979705903 4:123720285-123720307 CCTTTTCAACAAATGGTGCTGGG + Intergenic
979709750 4:123765332-123765354 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979794534 4:124830314-124830336 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979995832 4:127429735-127429757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
980622596 4:135328552-135328574 CCATATAAACTAATGGAGCTTGG - Intergenic
980665941 4:135935760-135935782 ATATTAAAACGAATGGTGCTTGG + Intergenic
980944475 4:139305503-139305525 CTATGTAATCAAGTGTTGCTAGG + Intronic
981347102 4:143688784-143688806 CCTTTTCAACAAATGGTGCTGGG + Intronic
981626387 4:146760695-146760717 CCTTTTCAACAAATGGTGCTGGG + Intronic
981680687 4:147394286-147394308 CTTATTCAACAAATGGTGCTGGG + Intergenic
981760352 4:148187952-148187974 ACATTTCAACAAATGGTGCTGGG - Intronic
981825241 4:148933073-148933095 CCTTTTCAACAAATGGTGCTGGG + Intergenic
981887037 4:149688860-149688882 CCTTTTCAACAAATGGTGCTGGG + Intergenic
981896479 4:149807340-149807362 CTTTTTAAATAAATTGTGCTGGG + Intergenic
982119201 4:152124571-152124593 CCTTTTCAACAAATGGTGCTGGG - Intergenic
982189353 4:152838009-152838031 CCTTTTCAACAAATGGTGCTGGG - Intronic
982323416 4:154104392-154104414 CTTATTCAACAAATGGTGCTGGG - Intergenic
982631041 4:157829456-157829478 CCTTTTCAACAAATGGTGCTGGG + Intergenic
982679706 4:158414375-158414397 CCTTTTCAACAAATGGTGCTGGG - Intronic
982971233 4:161990143-161990165 CTATCTAAACTAGTGGTGCTAGG + Intronic
983175303 4:164581213-164581235 CCTTTTCAACAAATGGTGCTGGG - Intergenic
983424072 4:167559744-167559766 CTTTTTCAACAAATGGTGCTGGG - Intergenic
983544477 4:168948598-168948620 CCTTTTCAACAAATGGTGCTGGG - Intronic
983845223 4:172509675-172509697 CCTACTCAACAAATGGTGCTGGG - Intronic
983921723 4:173353002-173353024 ATTTTTAAATAAATGGTGCTAGG + Intergenic
984020687 4:174481416-174481438 CCTATTAAACAAATGGTGCTGGG + Intergenic
984026897 4:174553434-174553456 ATATCTCAACAAATATTGCTGGG + Intergenic
984077297 4:175199049-175199071 ATTTTTAAACAAATGGTGCTGGG - Intergenic
984149245 4:176106386-176106408 CAGTCTTAACATATGGTGCTGGG + Intronic
984377524 4:178952112-178952134 CTTCTTCAACAAATGGTGCTGGG + Intergenic
984527144 4:180871039-180871061 CCTTTTCAACAAATGGTGCTGGG - Intergenic
984787043 4:183576840-183576862 CTATGTAGACAAATGGTGATGGG - Intergenic
984942480 4:184945049-184945071 TTTTTTCAACAAATGGTGCTGGG - Intergenic
985240314 4:187924373-187924395 CTATTCAACAAAATGGTGCTGGG - Intergenic
985300468 4:188482933-188482955 TTATTTCAATAAATGGTGCTAGG - Intergenic
985325286 4:188761229-188761251 CTTATTAAACAAATGGTGCAAGG - Intergenic
985439350 4:189968594-189968616 CTTATTTAACAAATGGTGCTGGG + Intergenic
985906064 5:2837793-2837815 TTCTTTCAACAAATGGTGCTGGG + Intergenic
986089106 5:4485801-4485823 ATCTTTCAACAAATGGTGCTGGG + Intergenic
986176199 5:5354105-5354127 TTATTTCAACAAGTGGTGCTGGG - Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
988652054 5:33163397-33163419 CCTTTTCAACAAATGGTGCTAGG - Intergenic
989028873 5:37096313-37096335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
989533397 5:42535390-42535412 CCTTTTCAACAAATGGTGCTTGG - Intronic
989592370 5:43123285-43123307 CTATCTCCACCAATGGTTCTTGG - Exonic
990497491 5:56363175-56363197 CTTATTCAACAAATGGTGCTGGG - Intergenic
990656422 5:57961784-57961806 CCTTTTAAATAAATGGTGCTGGG - Intergenic
990673058 5:58154075-58154097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
990712432 5:58600081-58600103 CTTTTTCAACAACTGGTGCTGGG - Intronic
991536218 5:67672016-67672038 CTATCTCAAAAATTGGGGCTGGG + Intergenic
991924279 5:71688821-71688843 CCTTTTTAACAAATGGTGCTGGG + Intergenic
991932901 5:71772137-71772159 TTTTTTAAATAAATGGTGCTGGG - Intergenic
992345713 5:75875339-75875361 CCAACTCAATAAATGGTGCTGGG + Intergenic
992892680 5:81218430-81218452 CCTTTTCAACAAATGGTGCTCGG - Intronic
993785754 5:92133402-92133424 CTTTCTCAATAAATGGTGCTGGG - Intergenic
993917456 5:93760660-93760682 CCTTTTCAACAAATGGTGCTGGG + Intronic
994422939 5:99544983-99545005 CTAATTCAATAAATGGTGCTAGG - Intergenic
994480488 5:100328158-100328180 CCTACTCAACAAATGGTGCTGGG - Intergenic
994846952 5:105001796-105001818 CCAATTCAACAAATGGTGCTGGG - Intergenic
994875699 5:105418287-105418309 CCTTTTCAACAAATGGTGCTGGG + Intergenic
994883334 5:105526667-105526689 CCTTTTCAACAAATGGTGCTGGG - Intergenic
994922929 5:106074387-106074409 CTTTTTCAACAAATGGTGCTGGG + Intergenic
995102057 5:108323844-108323866 CCTTTTCAACAAATGGTGCTGGG + Intronic
995134608 5:108667358-108667380 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995291216 5:110456781-110456803 CTCTTAAAACAAATGGTGCTGGG + Intronic
995293351 5:110486549-110486571 CCTTTTCAACAAATGGTGCTGGG - Intronic
995472608 5:112518861-112518883 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995964461 5:117887731-117887753 GTCTCTTAATAAATGGTGCTGGG - Intergenic
996025714 5:118643421-118643443 CCTTTTCAACAAATGGTGCTGGG + Intergenic
996325814 5:122271974-122271996 CTTTTTCAACAAATGGTGCAGGG + Intergenic
996599729 5:125248291-125248313 CCTCCTTAACAAATGGTGCTTGG - Intergenic
996708385 5:126520101-126520123 CTGTCTAAATGAATGCTGCTGGG - Intergenic
996834955 5:127781062-127781084 CCTTTTTAACAAATGGTGCTGGG - Intergenic
997036424 5:130197691-130197713 TCATCTAAACAAATGGTTCCAGG + Intergenic
997707354 5:135969345-135969367 CTTTTTTAACAAACGGTGCTGGG - Intergenic
997797951 5:136829727-136829749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
998603536 5:143609653-143609675 CGTTTTCAACAAATGGTGCTGGG + Intergenic
998776926 5:145614051-145614073 CCTTTTCAACAAATGGTGCTGGG - Intronic
998941273 5:147285211-147285233 CCTTTTCAACAAATGGTGCTGGG + Intronic
999343402 5:150793580-150793602 CCTTTTCAACAAATGGTGCTGGG + Intronic
999469792 5:151843830-151843852 TCTTCTCAACAAATGGTGCTGGG + Intronic
999484290 5:151979385-151979407 CCTTTTCAACAAATGGTGCTGGG - Intergenic
999526199 5:152408840-152408862 CCTTTTCAACAAATGGTGCTGGG - Intronic
999677536 5:154019791-154019813 CCTATTAAACAAATGGTGCTGGG + Intronic
999916150 5:156263824-156263846 CCTACTCAACAAATGGTGCTGGG - Intronic
999918730 5:156293551-156293573 TCATTTCAACAAATGGTGCTGGG - Intronic
1000024929 5:157350355-157350377 CCTTTTCAACAAATGGTGCTGGG - Intronic
1000404463 5:160872607-160872629 CTTTTTCAACAAATGGTGCTAGG - Intergenic
1000713337 5:164607780-164607802 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1000757421 5:165179047-165179069 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1000861742 5:166464114-166464136 CATTTTCAACAAATGGTGCTGGG - Intergenic
1001023096 5:168200217-168200239 TTATCTACTGAAATGGTGCTTGG - Intronic
1001256305 5:170186023-170186045 CTTTCAAAACAAAGGGTGTTTGG + Intergenic
1001336323 5:170800250-170800272 CCTACTTAACAAATGGTGCTGGG + Intronic
1001349849 5:170950005-170950027 CTCTTTAATAAAATGGTGCTGGG + Intronic
1001969673 5:175944611-175944633 CCTTCTTAACAAATGGTGTTAGG + Intronic
1002247761 5:177899154-177899176 CCTTCTTAACAAATGGTGTTAGG - Intergenic
1002965628 6:1963613-1963635 CCTTTTCAACAAATGGTGCTGGG - Intronic
1003029020 6:2584781-2584803 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1003063576 6:2882402-2882424 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1003297078 6:4839651-4839673 CTTATTTAACAAATGGTGCTGGG - Intronic
1003582425 6:7352803-7352825 CCTTTTCAACAAATGGTGCTGGG + Intronic
1003929907 6:10914255-10914277 CCTTTTCAACAAATGGTGCTGGG - Intronic
1004504231 6:16234730-16234752 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1004822673 6:19384649-19384671 CCTACTCAACAAATGGTGCTGGG + Intergenic
1005305442 6:24509348-24509370 CTCCCTCAACAAATGGTGCTGGG - Intronic
1005877776 6:30026785-30026807 CTTATTGAACAAATGGTGCTGGG + Intergenic
1006287803 6:33111180-33111202 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1006722480 6:36166027-36166049 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1007350003 6:41264914-41264936 CCTTCTAAATAAATGGTGCTGGG + Intergenic
1008121295 6:47620293-47620315 CCCTTTCAACAAATGGTGCTGGG - Intronic
1008313172 6:50003840-50003862 CCTTTTCAACAAATGGTGCTAGG + Intergenic
1008791853 6:55244894-55244916 CTTACTCAATAAATGGTGCTGGG - Intronic
1008941006 6:57045962-57045984 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1008967607 6:57329373-57329395 TTATTTCAACAAATGATGCTGGG - Intronic
1009790604 6:68396949-68396971 CATTTTCAACAAATGGTGCTAGG + Intergenic
1010008593 6:71024442-71024464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1010181399 6:73090643-73090665 CCTTTTCAACAAATGGTGCTGGG - Intronic
1010319515 6:74489579-74489601 CAAAACAAACAAATGGTGCTGGG + Intergenic
1010333202 6:74648331-74648353 CTTTTTCAATAAATGGTGCTAGG + Intergenic
1010878169 6:81135469-81135491 CTATTTAATTAAATGGTGTTGGG + Intergenic
1010948652 6:82008501-82008523 CTATTCAAAAAAATGGTGCTGGG + Intergenic
1011086088 6:83542650-83542672 CTTGTTTAACAAATGGTGCTAGG - Intergenic
1011123473 6:83980886-83980908 CGGTCTCAATAAATGGTGCTGGG - Intergenic
1011156197 6:84336013-84336035 CCTTTTTAACAAATGGTGCTGGG - Intergenic
1011892912 6:92189633-92189655 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1011965444 6:93151792-93151814 CCTAGTAAACAAATGGTGCTGGG - Intergenic
1012208853 6:96495591-96495613 CCTACTTAACAAATGGTGCTGGG - Intergenic
1012294607 6:97505441-97505463 CTATTTAATAAAATTGTGCTGGG + Intergenic
1012362565 6:98401185-98401207 GTTTCTAAACAAATGGTATTGGG - Intergenic
1012794204 6:103739143-103739165 CGTTTTCAACAAATGGTGCTGGG + Intergenic
1013930161 6:115521001-115521023 CTTACTTAATAAATGGTGCTGGG + Intergenic
1014235969 6:118955134-118955156 GTATCTGAACAGAAGGTGCTTGG - Intergenic
1014285451 6:119492086-119492108 CATTTTCAACAAATGGTGCTGGG + Intergenic
1014304444 6:119723041-119723063 CCTTCTCAACAAATGGTGCTAGG - Intergenic
1014330621 6:120059402-120059424 CACTCTATTCAAATGGTGCTGGG + Intergenic
1014334246 6:120112335-120112357 TTGTCCCAACAAATGGTGCTGGG + Intergenic
1014337238 6:120151924-120151946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1014343029 6:120232190-120232212 CCTTCTCAATAAATGGTGCTGGG + Intergenic
1014386678 6:120811806-120811828 CTTTTTAAATAAACGGTGCTGGG + Intergenic
1014604294 6:123453010-123453032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1014645459 6:123967425-123967447 CTAACTACAGAAATGGTGCTTGG - Intronic
1014658598 6:124137773-124137795 CCAATTCAACAAATGGTGCTGGG + Intronic
1015087146 6:129309326-129309348 CTATCTAAACACATGGTTAATGG + Intronic
1015217469 6:130766920-130766942 CTCTCCACACAAATGGGGCTGGG + Intergenic
1015256733 6:131186050-131186072 GTCTTTCAACAAATGGTGCTAGG - Intronic
1015662852 6:135595612-135595634 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1015687393 6:135880387-135880409 CCATCTAAACATATGATGTTTGG - Intronic
1015914347 6:138200583-138200605 CCTTTTCAACAAATGGTGCTGGG + Intronic
1016197047 6:141357043-141357065 CCTTATCAACAAATGGTGCTGGG - Intergenic
1016311747 6:142740611-142740633 CAATAAAAACAAATGCTGCTGGG - Intergenic
1016924104 6:149324714-149324736 CTGACTAAACAAAAGTTGCTTGG - Intronic
1016994203 6:149949783-149949805 CCAATTCAACAAATGGTGCTGGG + Intergenic
1017004138 6:150017764-150017786 CTAATTCAATAAATGGTGCTGGG - Intergenic
1017190086 6:151643938-151643960 CCTTTTGAACAAATGGTGCTGGG - Intergenic
1017374523 6:153752803-153752825 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1018010056 6:159661341-159661363 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1018574267 6:165242907-165242929 TCAACTAAACAAATGGAGCTGGG - Intergenic
1020064789 7:5179263-5179285 CTTTGCAAACAAATGGTGCTGGG + Intergenic
1020214020 7:6175367-6175389 CCTTTTCAACAAATGGTGCTGGG - Intronic
1020566754 7:9807585-9807607 GTATCTCCACAAATGGTGGTGGG - Intergenic
1020666495 7:11050091-11050113 TTAACAAAACAAATGGTACTTGG + Intronic
1020915365 7:14185776-14185798 CCTTTTTAACAAATGGTGCTGGG + Intronic
1021004794 7:15380941-15380963 CTAATTCAATAAATGGTGCTGGG + Intronic
1021204697 7:17766284-17766306 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1021269049 7:18562490-18562512 GTTTTTCAACAAATGGTGCTGGG - Intronic
1021797734 7:24274211-24274233 GTATTTAAATAAATGGTGCTGGG - Intergenic
1022295759 7:29051010-29051032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1022550139 7:31230468-31230490 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1023325175 7:39046933-39046955 GTCTGTTAACAAATGGTGCTGGG - Intronic
1023544383 7:41302372-41302394 CTTTTTCAACAAATGTTGCTGGG + Intergenic
1023748519 7:43346724-43346746 CCTTTTCAACAAATGGTGCTGGG - Intronic
1023885816 7:44354763-44354785 CTAATTCAATAAATGGTGCTGGG - Intergenic
1024126826 7:46307129-46307151 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024179276 7:46873496-46873518 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024668890 7:51573040-51573062 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1024744949 7:52395360-52395382 CTTTTTCAATAAATGGTGCTGGG - Intergenic
1024840317 7:53578007-53578029 CTTATTCAACAAATGGTGCTGGG + Intergenic
1027191482 7:75998652-75998674 TCATTTCAACAAATGGTGCTAGG + Intronic
1027349954 7:77301418-77301440 CCTTTTCAACAAATGGTGCTGGG - Intronic
1027416398 7:77979188-77979210 CTATGTAAACAAAAGGTCTTTGG + Intergenic
1027488776 7:78795896-78795918 CTGTTTAAATAAATGGTGCCAGG + Intronic
1027650575 7:80862851-80862873 CCTTTTCAACAAATGGTGCTGGG + Intronic
1027812422 7:82921503-82921525 CTTATTCAACAAATGGTGCTAGG + Intronic
1028499303 7:91500825-91500847 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028506423 7:91575890-91575912 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028750141 7:94373670-94373692 CTTTCTCAATAAATGGTGCTGGG + Intergenic
1028792514 7:94868764-94868786 CTAATTCAACAAATGGTGCTGGG - Intergenic
1028818711 7:95180283-95180305 CCTTTTTAACAAATGGTGCTGGG + Intronic
1028870219 7:95763191-95763213 CTTACTCAATAAATGGTGCTGGG + Intergenic
1030188407 7:106786641-106786663 CTCTCCAATCAAATGGAGCTAGG - Intergenic
1030309280 7:108053373-108053395 CTATTAAAAAAAATGTTGCTGGG - Intronic
1030456239 7:109777729-109777751 CCTACTCAACAAATGGTGCTGGG + Intergenic
1030691070 7:112534339-112534361 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1030695884 7:112584708-112584730 CAATCTAAACAAATTCTTCTAGG - Intergenic
1030852289 7:114504404-114504426 CTTACTATACAAATGTTGCTGGG - Intronic
1031234752 7:119160420-119160442 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1031596247 7:123653101-123653123 TTTTTTCAACAAATGGTGCTAGG + Intergenic
1031760706 7:125710070-125710092 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1033260107 7:139836573-139836595 CTTTATCAACAAATGGTACTGGG + Intronic
1033522769 7:142178586-142178608 CTTTATTAATAAATGGTGCTGGG - Intronic
1033623332 7:143082799-143082821 CTTACTCAAAAAATGGTGCTGGG + Intergenic
1033623720 7:143087678-143087700 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1033721761 7:144067244-144067266 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1034058545 7:148063962-148063984 CCTTTTCAACAAATGGTGCTGGG - Intronic
1034229740 7:149513210-149513232 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1034376729 7:150651712-150651734 CTTTTTCAACAAATGTTGCTGGG - Intergenic
1035473208 7:159124377-159124399 CTATTCAATTAAATGGTGCTGGG - Intronic
1036743221 8:11385205-11385227 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1037135955 8:15460761-15460783 CCTTTTCAACAAATGGTGCTGGG - Intronic
1037358505 8:18048275-18048297 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1037560409 8:20068695-20068717 CCCTCTCAACAAATGATGCTAGG + Intergenic
1038237469 8:25773942-25773964 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1038366839 8:26944867-26944889 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1038433377 8:27517654-27517676 CTCTTCAAACAAATGGTGGTGGG + Intronic
1039241832 8:35565798-35565820 CTAATTCAATAAATGGTGCTGGG - Intronic
1039660666 8:39460541-39460563 CCTGCTCAACAAATGGTGCTGGG - Intergenic
1039728071 8:40243197-40243219 CTTTTTCAACAAATGGTGCTGGG + Intergenic
1040565953 8:48567514-48567536 CTTTTTAATAAAATGGTGCTGGG + Intergenic
1040635272 8:49266051-49266073 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1040712442 8:50205800-50205822 CCTACTTAACAAATGGTGCTGGG - Intronic
1040920466 8:52611259-52611281 CTACCTCAAGAAATGTTGCTGGG + Intergenic
1041228163 8:55721260-55721282 CCTTTTCAACAAATGGTGCTGGG + Intronic
1041495732 8:58483385-58483407 ATGTCTGAATAAATGGTGCTGGG + Intergenic
1041516597 8:58706395-58706417 CTTTTTAAACAAATGATGCTGGG - Intergenic
1041589893 8:59565955-59565977 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1041818378 8:62000577-62000599 CTTTTTCAACAAATGGTACTAGG - Intergenic
1041877561 8:62707957-62707979 CCTTTTCAACAAATGGTGCTCGG - Intronic
1042085058 8:65098471-65098493 ATATCTTAATAAATGGTGTTGGG - Intergenic
1042115316 8:65425405-65425427 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1042682386 8:71400054-71400076 CTATTCCAAAAAATGGTGCTGGG + Intergenic
1042995899 8:74698265-74698287 CTTATTTAACAAATGGTGCTGGG + Intronic
1043041273 8:75264818-75264840 CTCTTTCAACAACTGGTGCTGGG + Intergenic
1043224307 8:77703488-77703510 TTTTTTCAACAAATGGTGCTGGG - Intergenic
1043261314 8:78202182-78202204 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1043568426 8:81573181-81573203 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1043988277 8:86719905-86719927 CCTTTTCAACAAATGGTGCTGGG + Intronic
1044311450 8:90697602-90697624 CTATGTAAACACAGGGTGCTGGG - Intronic
1044376711 8:91482796-91482818 TTTTTTTAACAAATGGTGCTGGG + Intergenic
1044943910 8:97372563-97372585 TTTTTTCAACAAATGGTGCTGGG + Intergenic
1045735178 8:105287694-105287716 TTTTTTAAACAAATGGTGCTAGG - Intronic
1045789909 8:105971097-105971119 CCTTTTAAATAAATGGTGCTGGG + Intergenic
1046075797 8:109310378-109310400 CCTTTTCAACAAATGGTGCTGGG + Intronic
1046225524 8:111273905-111273927 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1046235749 8:111422191-111422213 CGTTTTCAACAAATGGTGCTGGG - Intergenic
1046408931 8:113813528-113813550 TTATCTTAACAAATGCTGCTTGG - Intergenic
1046409376 8:113819323-113819345 TTCTCTTAATAAATGGTGCTGGG + Intergenic
1046417425 8:113936092-113936114 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1046467551 8:114626052-114626074 CTTATTCAACAAATGGTGCTGGG + Intergenic
1046580969 8:116091881-116091903 CTATCTAAATGAATGGTGACAGG + Intergenic
1047332097 8:123899734-123899756 TTTTTTCAACAAATGGTGCTGGG - Intronic
1047530714 8:125672086-125672108 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1048796821 8:138158208-138158230 CTTTTTAAATAAATGGTGCTGGG + Intronic
1049141462 8:140958959-140958981 CTTTTTCAATAAATGGTGCTGGG - Intronic
1049897744 9:125779-125801 CCTTTTCAACAAATGGTGCTGGG - Intronic
1050382669 9:5046627-5046649 GTCTTTCAACAAATGGTGCTAGG - Intronic
1050396129 9:5198325-5198347 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1050499070 9:6275917-6275939 CTTTTTCAACAAATGGTGCTTGG + Intergenic
1050635852 9:7611920-7611942 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1050675494 9:8048056-8048078 CTTTTCCAACAAATGGTGCTGGG + Intergenic
1050722223 9:8603547-8603569 TTAACTTAAAAAATGGTGCTTGG - Intronic
1050824370 9:9926784-9926806 CTCTCTAAACAAATGCTCATGGG - Intronic
1051700617 9:19819107-19819129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1051801030 9:20934472-20934494 CCTACTCAACAAATGGTGCTGGG - Intronic
1051807635 9:21013260-21013282 CTTTTTCAACAAATGGTGTTGGG - Intronic
1051893108 9:21963369-21963391 CCTTTTAAACAAATGTTGCTGGG - Intronic
1051957098 9:22709511-22709533 CACTTTCAACAAATGGTGCTGGG - Intergenic
1052346968 9:27419563-27419585 CCTTTTCAACAAATGGTGCTGGG + Intronic
1052483059 9:29056820-29056842 CTTATTCAACAAATGGTGCTGGG - Intergenic
1052514232 9:29459647-29459669 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1052737853 9:32362808-32362830 CCAACTCAACAAATGGTGCTGGG + Intergenic
1053188948 9:36043751-36043773 CCTACTCAACAAATGGTGCTGGG - Intronic
1053212085 9:36238963-36238985 CTTTTTCAACAAATGGTGCTGGG - Intronic
1053400932 9:37821540-37821562 CCTTTTCAACAAATGGTGCTAGG + Intronic
1053740833 9:41136069-41136091 CCTTTTCAACAAATGGTGCTGGG - Intronic
1054443821 9:65292214-65292236 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1054486452 9:65729289-65729311 CCTTTTCAACAAATGGTGCTGGG + Intronic
1054687518 9:68295230-68295252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1055345925 9:75338800-75338822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1055495548 9:76850919-76850941 TTATATATACAAATGGTGCAGGG - Intronic
1055532649 9:77200929-77200951 CCTTTTAAATAAATGGTGCTAGG - Intronic
1055534912 9:77230461-77230483 TTTTTTCAACAAATGGTGCTAGG - Intronic
1055610270 9:78016016-78016038 TTTTTTCAACAAATGGTGCTGGG + Intronic
1055656789 9:78458480-78458502 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1056125164 9:83529236-83529258 TTTTTTCAACAAATGGTGCTGGG + Intronic
1056322325 9:85447560-85447582 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1056698633 9:88882478-88882500 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1057333286 9:94136367-94136389 GTCTTTCAACAAATGGTGCTGGG + Intergenic
1057453777 9:95189378-95189400 CTATGTAAACAACGGGCGCTGGG - Intronic
1058084632 9:100735320-100735342 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058224405 9:102342104-102342126 CTTATTTAACAAATGGTGCTGGG + Intergenic
1058308012 9:103466999-103467021 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058631119 9:106987895-106987917 CCTTTTCAACAAATGGTGCTGGG - Intronic
1058721059 9:107764549-107764571 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058771158 9:108233422-108233444 CTTCTTCAACAAATGGTGCTGGG + Intergenic
1059363025 9:113761998-113762020 ATAATTTAACAAATGGTGCTAGG + Intergenic
1059493306 9:114688048-114688070 TCTTCTCAACAAATGGTGCTGGG - Intergenic
1059611819 9:115906155-115906177 GTATTTAAATAAATGGTGTTGGG - Intergenic
1059675271 9:116532594-116532616 CTTATTTAACAAATGGTGCTGGG - Intronic
1059815609 9:117909769-117909791 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1186976086 X:14906351-14906373 CTTTTTAAATAAAAGGTGCTAGG + Intronic
1187218753 X:17303041-17303063 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187421901 X:19142448-19142470 CTATTTCAACAAATGGTGCTGGG + Intergenic
1187636423 X:21234063-21234085 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187639207 X:21269303-21269325 CCATTTCAATAAATGGTGCTGGG - Intergenic
1188040057 X:25361469-25361491 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1188176565 X:26998002-26998024 CTTATTCAACAAATGGTGCTGGG + Intergenic
1188363801 X:29289312-29289334 CCTTTTCAACAAATGGTGCTGGG - Intronic
1188376883 X:29442318-29442340 CCTTTTCAACAAATGGTGCTGGG + Intronic
1188524421 X:31073706-31073728 TCTTCTCAACAAATGGTGCTAGG - Intergenic
1188841210 X:35020420-35020442 GTCTTTAAGCAAATGGTGCTGGG - Intergenic
1188855326 X:35187447-35187469 CTTACTCAATAAATGGTGCTGGG - Intergenic
1189218567 X:39349536-39349558 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189414121 X:40799636-40799658 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189716774 X:43875168-43875190 CAACCTGATCAAATGGTGCTGGG - Intronic
1189941175 X:46122935-46122957 TTTTTTCAACAAATGGTGCTAGG - Intergenic
1189963510 X:46348608-46348630 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1190631781 X:52394330-52394352 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1190967531 X:55315105-55315127 CCACTTCAACAAATGGTGCTGGG - Intergenic
1191012951 X:55779735-55779757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1191024836 X:55902857-55902879 CCTTTTTAACAAATGGTGCTGGG - Intergenic
1191763725 X:64672434-64672456 CTTTTTCAATAAATGGTGCTAGG + Intergenic
1191778058 X:64839846-64839868 CCTTTTGAACAAATGGTGCTAGG - Intergenic
1191905853 X:66089223-66089245 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1191919122 X:66235429-66235451 CTAATTGAATAAATGGTGCTAGG - Intronic
1191954575 X:66630099-66630121 CATTTTCAACAAATGGTGCTGGG + Intronic
1191997300 X:67109322-67109344 CTTATTCAACAAATGGTGCTGGG - Intergenic
1192014074 X:67309871-67309893 CTGTTTCAACAAATAGTGCTGGG - Intergenic
1192310299 X:70006984-70007006 TTTTTTCAACAAATGGTGCTGGG - Intronic
1192413493 X:70955835-70955857 CCTTTTAAACAAATGGTGGTGGG + Intergenic
1192475913 X:71442894-71442916 CTAATTTAATAAATGGTGCTGGG - Intronic
1193015381 X:76726547-76726569 CATTTTAAATAAATGGTGCTGGG - Intergenic
1193017019 X:76746034-76746056 CCTACTCAACAAATGGTGCTGGG + Intergenic
1193102049 X:77625152-77625174 CCTTTTCAACAAATGGTGCTGGG + Intronic
1193157340 X:78188365-78188387 CTTTTCAACCAAATGGTGCTGGG + Intergenic
1193237576 X:79127688-79127710 CCTTTTAAACAAATGGTGCTGGG + Intergenic
1193357736 X:80541609-80541631 GTCTCTTAAAAAATGGTGCTTGG - Intergenic
1193423378 X:81311629-81311651 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1193578901 X:83237334-83237356 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193589940 X:83376753-83376775 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1193676595 X:84461430-84461452 CCTTTTCAACAAATGGTGCTAGG + Intronic
1193779518 X:85685318-85685340 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193826092 X:86229199-86229221 CCTTTTCAACAAATGGTGCTGGG - Intronic
1193864804 X:86718710-86718732 CCTTTTCAACAAATGGTGCTGGG - Intronic
1193982334 X:88198101-88198123 CTTATTATACAAATGGTGCTGGG + Intergenic
1194012170 X:88575770-88575792 CTTATTCAACAAATGGTGCTGGG - Intergenic
1194070001 X:89310705-89310727 TCATTTTAACAAATGGTGCTAGG - Intergenic
1194190872 X:90835755-90835777 CTTTTTTAATAAATGGTGCTGGG + Intergenic
1194242405 X:91468414-91468436 CTTATTAAACAAATAGTGCTAGG - Intergenic
1194274259 X:91859690-91859712 CTTTTTTAATAAATGGTGCTGGG - Intronic
1194441074 X:93935145-93935167 CTTCCTCAATAAATGGTGCTGGG - Intergenic
1194478060 X:94384250-94384272 CTTTTTCAACAAATGGTTCTGGG + Intergenic
1194528201 X:95006864-95006886 TTTTTTTAACAAATGGTGCTAGG - Intergenic
1194543078 X:95199024-95199046 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194554412 X:95339279-95339301 CCTACTCAACAAATGGTGCTGGG + Intergenic
1194637847 X:96367374-96367396 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194923393 X:99795348-99795370 ATATAGAAACCAATGGTGCTGGG - Intergenic
1194926272 X:99828635-99828657 CATTCTCAAAAAATGGTGCTGGG - Intergenic
1194956029 X:100181584-100181606 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1195018990 X:100807433-100807455 CTTTTTCAACAAATGGTGCTGGG - Intergenic
1195142991 X:101982398-101982420 TTTTTTCAACAAATGGTGCTTGG + Intergenic
1195177466 X:102324721-102324743 TCTTCTTAACAAATGGTGCTGGG + Intronic
1195181398 X:102362372-102362394 TCTTCTTAACAAATGGTGCTGGG - Intronic
1195197025 X:102508484-102508506 ACCTTTAAACAAATGGTGCTAGG + Intergenic
1195300202 X:103522240-103522262 TTGTTTCAACAAATGGTGCTGGG + Intergenic
1195556897 X:106237001-106237023 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1195913003 X:109907672-109907694 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1196111214 X:111949096-111949118 CCTTTTCAACAAATGGTGCTGGG + Intronic
1196204845 X:112927750-112927772 CTTATTCAACAAATGGTGCTGGG + Intergenic
1196590140 X:117477673-117477695 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1196711313 X:118766371-118766393 CTTTTTTAATAAATGGTGCTGGG - Intronic
1196737989 X:118997380-118997402 CCTTTTCAACAAATGGTGCTGGG + Intronic
1197065783 X:122232578-122232600 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197145101 X:123163294-123163316 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197525560 X:127557942-127557964 CCATTTCAACAAATGGTGCTGGG - Intergenic
1197548267 X:127855077-127855099 CTTATTAAATAAATGGTGCTGGG - Intergenic
1198228329 X:134666942-134666964 TCTTTTAAACAAATGGTGCTGGG + Intronic
1198367457 X:135956016-135956038 TCTTCTCAACAAATGGTGCTAGG + Intergenic
1198616900 X:138468108-138468130 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1198668692 X:139053987-139054009 CCTTTTCAACAAATGGTGCTGGG - Intronic
1198695831 X:139336518-139336540 CTTATTCAACAAATGGTGCTAGG - Intergenic
1199007985 X:142724660-142724682 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199390682 X:147274364-147274386 AACACTAAACAAATGGTGCTTGG + Intergenic
1199421072 X:147644987-147645009 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199521098 X:148736847-148736869 CCTTTTCAACAAATGGTGCTGGG - Intronic
1199668953 X:150125756-150125778 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199739857 X:150724819-150724841 CTTATTCAACAAATGGTGCTGGG - Intronic
1199821098 X:151447511-151447533 CTTTTTCAATAAATGGTGCTGGG + Intergenic
1199821312 X:151451123-151451145 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200317704 X:155151054-155151076 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200537531 Y:4418175-4418197 CTTTTTTAATAAATGGTGCTGGG + Intergenic
1200724240 Y:6646339-6646361 TCATTTTAACAAATGGTGCTAGG - Intergenic
1201015829 Y:9600420-9600442 ATATCTAAACAAATTGTTCAGGG - Intergenic
1201408934 Y:13678733-13678755 CCTTTTAAACAAATGGTGCTGGG + Intergenic
1201761871 Y:17549241-17549263 CCTACTTAACAAATGGTGCTGGG - Intergenic
1201839681 Y:18356749-18356771 CCTACTTAACAAATGGTGCTGGG + Intergenic
1202043385 Y:20711448-20711470 CTTTCTTAATAAATAGTGCTGGG + Intergenic
1202591182 Y:26485147-26485169 CCTACTCAACAAATGGTGCTGGG - Intergenic