ID: 976978437

View in Genome Browser
Species Human (GRCh38)
Location 4:91193011-91193033
Sequence TTGCATGTATAGTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976978437 Original CRISPR TTGCATGTATAGTTTGAGGA AGG (reversed) Intronic
903489589 1:23718189-23718211 TTGGGTGCATAGTTTGAGCATGG + Intergenic
904062661 1:27724013-27724035 TTGCATATATATTTTGAGACAGG + Intergenic
904086838 1:27915290-27915312 ATGCATGAGTATTTTGAGGAAGG - Intergenic
904482461 1:30802532-30802554 TTGTATTTTTAGTTTGAGGCTGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905247114 1:36622786-36622808 TTGGGTGTGTAGTTTGAGGAAGG + Intergenic
905848177 1:41252051-41252073 TTTCATATATGGTGTGAGGAAGG + Intergenic
909328915 1:74388984-74389006 TTGCATGAGTGCTTTGAGGATGG - Intronic
909537232 1:76751001-76751023 ATGCTTGTATAGTCTGATGATGG + Intergenic
909717968 1:78733104-78733126 ATGTATGTATATTTTTAGGAGGG - Intergenic
911303293 1:96202399-96202421 TTTTATGTATGGTGTGAGGAAGG - Intergenic
911463464 1:98220502-98220524 TAGCATGGATAGTTTGGGTAAGG + Intergenic
911862014 1:102963470-102963492 TTTCATGTATAAATAGAGGATGG + Intronic
912091813 1:106086872-106086894 TTACATGTCTAGTTTGAAAATGG - Intergenic
914736589 1:150423342-150423364 TTGCTTGTATTGTGTCAGGATGG + Intronic
915230371 1:154441440-154441462 ATGCATGTGTGGTTTGAGGCAGG + Intronic
916856006 1:168750700-168750722 TTGCTAGTATAGTTTGAAGTTGG + Intergenic
917243146 1:172971353-172971375 TGGCATGTAAAGTATGTGGAGGG - Intergenic
919594871 1:199548617-199548639 TGACATTTATAGTTTGGGGAGGG - Intergenic
922995023 1:229949833-229949855 TTGTATGTGTAACTTGAGGAAGG - Intergenic
924111988 1:240709148-240709170 TTGCATGTCTATTCTGAGGATGG - Intergenic
924257953 1:242201154-242201176 TTCCATATACAGTTTGCGGAGGG + Intronic
1063852815 10:10212272-10212294 TTGCATATAGTGTTTGGGGAAGG - Intergenic
1064601475 10:16997958-16997980 TAGCATGTATTCTGTGAGGAAGG + Intronic
1066408952 10:35146943-35146965 TTGGATGTATAGTTAGACTAAGG + Intronic
1067050719 10:43017944-43017966 TTGCATGTTTATTTTGCTGAAGG + Intergenic
1068807687 10:61217351-61217373 TTCCATGTATGGTGGGAGGATGG + Intergenic
1072894312 10:99353000-99353022 TTTTATGTATAGTATGAGGTAGG + Intronic
1074053856 10:109904373-109904395 TTGCATGTAGAGGTGGATGAAGG - Intronic
1075435460 10:122437200-122437222 TTGCCTGTCTAGTTTGAAGGTGG + Exonic
1075508620 10:123049736-123049758 TTGTATGTATGGTGTGAGGTAGG - Intronic
1077864137 11:6209329-6209351 TGGTATGTATGGTATGAGGAGGG - Intronic
1079464282 11:20713951-20713973 TTGCATGTATGTTTGGAGGCCGG + Intronic
1079753321 11:24225683-24225705 TTATTTGTATAGTATGAGGAGGG + Intergenic
1080753935 11:35177329-35177351 TTGGAGCCATAGTTTGAGGAAGG - Intronic
1081642779 11:44767772-44767794 TTTCATATATAGTGTGAGGTAGG + Intronic
1084630165 11:70342736-70342758 TAGCATGTATAATTGGAGTAAGG + Intronic
1085131708 11:74045091-74045113 TTTTGTGTATGGTTTGAGGAAGG + Intronic
1085362418 11:75902362-75902384 TTGCATGTATAGTTTACAGTAGG + Intronic
1087383349 11:97437628-97437650 ATGCATCTGTAGTTTGAGGAAGG - Intergenic
1087701180 11:101438462-101438484 TTTCATGTATGGTGTAAGGAAGG - Intergenic
1087802683 11:102520856-102520878 TTGCCTGTATAATCTTAGGATGG - Intronic
1087867344 11:103247228-103247250 TTCCATGTTGAGTTTGAGTATGG + Intronic
1088656589 11:112005718-112005740 TTTCATGTATTTTTTGAGGGGGG - Intronic
1088902320 11:114127633-114127655 TTGCGTCAATAGTTAGAGGAGGG + Intronic
1090421902 11:126581024-126581046 TTGCAGGCATGGTTTGAGAAGGG - Intronic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1093189022 12:16053781-16053803 TTGCATATATGGTGTAAGGAAGG - Intergenic
1093721441 12:22446970-22446992 TTAAGTGTATAGTTTGAGGTTGG - Intergenic
1094607102 12:31958514-31958536 TTGAGTGCAAAGTTTGAGGATGG + Intergenic
1096033316 12:48440678-48440700 TTGGATGAATAGTTTGAAGCAGG + Intergenic
1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG + Intergenic
1107232818 13:38130891-38130913 TTGCCTGTTTAGTATGATGATGG + Intergenic
1108480125 13:50860867-50860889 TTTCATGTATGGTGTAAGGAAGG - Intergenic
1109229279 13:59736972-59736994 TTTTATATATAGTTTAAGGAAGG - Intronic
1109828331 13:67753328-67753350 TTTAATGTTTAGGTTGAGGAAGG + Intergenic
1112544768 13:100356087-100356109 TTTTATGTATGGTGTGAGGAAGG - Intronic
1114638771 14:24205103-24205125 TTGTATGTAGGGATTGAGGAAGG + Intronic
1115017029 14:28629864-28629886 TTGCATGCCTAGTTTGTTGATGG + Intergenic
1115055355 14:29119739-29119761 TTGCATTTATATTTTTAAGAAGG - Intergenic
1117764602 14:59068254-59068276 TTGTATGTATATTTTAAGTAAGG + Intergenic
1120050075 14:79855832-79855854 TTGCATTGATGGTTTGAGGTAGG + Intronic
1120627310 14:86844481-86844503 TTGCATGTATTGTGTGTGTATGG - Intergenic
1120779228 14:88471209-88471231 TTGCAAGTATTATTTGAGAAGGG - Intronic
1122847576 14:104508582-104508604 TTTCATGTATGGTGTGAGGAAGG - Intronic
1123022307 14:105406069-105406091 TTGGCTGTATAGTTAGAAGACGG + Intronic
1124457947 15:29862013-29862035 TTTTGTGTATAGTATGAGGAAGG + Intronic
1125030304 15:35069487-35069509 TGGCAGGGATAATTTGAGGACGG + Intergenic
1125702043 15:41695093-41695115 TTGTATGGATATTTTGAGGTGGG + Intronic
1125782154 15:42279317-42279339 TTGCATGTTTAGCCTGAGCAAGG + Intronic
1126638505 15:50802401-50802423 TGTCATGTTTACTTTGAGGAGGG + Intergenic
1126845576 15:52757746-52757768 TTGCATGTAGAGTTCGACGCTGG + Exonic
1127951384 15:63810156-63810178 TTGTATGTATACTTTGATGTGGG - Intronic
1137464926 16:48699132-48699154 TTCCTTCTATGGTTTGAGGATGG - Intergenic
1138048768 16:53754004-53754026 TTGCCTGTATCGTTAGAGAACGG + Intronic
1139114811 16:63936984-63937006 TTGTATTTATAGTTGGTGGAGGG - Intergenic
1139749555 16:69101087-69101109 TTGCAAGTACTGTTTGGGGAAGG - Intergenic
1141732094 16:85829693-85829715 TTGCTTTTTTATTTTGAGGAAGG - Intergenic
1147592087 17:41690007-41690029 TTGTATGTATTGTTAGCGGAAGG + Intronic
1149163013 17:53717605-53717627 TTTCATATATAGTTTAAGGAAGG + Intergenic
1150457562 17:65319577-65319599 TTGCATATATAATTTGAAGTAGG + Intergenic
1157110126 18:44812804-44812826 TTGCATTTATAATTTGATGAGGG + Intronic
1158177556 18:54674305-54674327 TTGCATGGACATTTAGAGGAAGG - Intergenic
1158898822 18:61941700-61941722 TTCCATTTCTGGTTTGAGGAAGG + Intergenic
1159062400 18:63529709-63529731 CTGTATGTATAGTTTGGGGTGGG + Intergenic
1159206602 18:65261435-65261457 TAGAATATATAGTTTGAGGCTGG - Intergenic
1160049742 18:75421667-75421689 TTCCATGTGTAGCTTGGGGAAGG + Intronic
1161595768 19:5150352-5150374 CTGCAGGTGGAGTTTGAGGACGG + Exonic
1161642730 19:5434578-5434600 TTAAATGTATACTTTGAGGCAGG + Intergenic
1162186996 19:8913606-8913628 TTGCATGTGTAGCTTGAGCTGGG + Intronic
1165081132 19:33306806-33306828 TTGTTTGTCTAGTTGGAGGAAGG - Intergenic
1165418075 19:35707231-35707253 ATGCATGTATATTATGAGGAGGG + Intronic
1166666653 19:44684192-44684214 ATGAATGCATAGTTTGGGGAAGG - Exonic
1167952827 19:53041191-53041213 TTGTAGGTAAATTTTGAGGAAGG + Intergenic
1168463795 19:56585411-56585433 TTTCATATATAGTGTGAGGTAGG - Intronic
926227053 2:10974142-10974164 TTTCATTCATAGTTTGATGAAGG - Intergenic
926511230 2:13782254-13782276 ATCCAAGTATAGTTTGAGTAGGG + Intergenic
926561775 2:14425770-14425792 TTGCATAGGTTGTTTGAGGAGGG + Intergenic
926566004 2:14474854-14474876 TTGCCTGTATACTTTGTTGATGG - Intergenic
930414050 2:51066819-51066841 TTTCCTTTAGAGTTTGAGGAGGG - Intergenic
930542241 2:52721106-52721128 TCCCATGTTTAGTTTGAGGTGGG - Intergenic
930850094 2:55951255-55951277 TTGCCTATATAGTCTAAGGAAGG + Intergenic
931339578 2:61386382-61386404 TTTTATTTATAGTTTCAGGAGGG - Intronic
932170355 2:69549665-69549687 ATGCATGTATAGTATGATGTGGG - Intronic
932902776 2:75718266-75718288 TTGCATGAATAGCTTGTGGTTGG - Intergenic
933398379 2:81760761-81760783 TTGGGTGTATAGTTGGAGGGAGG + Intergenic
933423598 2:82083204-82083226 TTGTATGTCTATTTTCAGGATGG - Intergenic
935837222 2:107068104-107068126 TTCCCTGTTTTGTTTGAGGAGGG - Intergenic
936264257 2:110989159-110989181 TTTTGTGTATGGTTTGAGGAAGG + Intronic
938999810 2:136721287-136721309 TTGTATGTTTACTTTCAGGATGG - Intergenic
939036874 2:137142927-137142949 CTGCATGAATAGATTGAGGGAGG - Intronic
939332096 2:140777440-140777462 TTGTAGGTTTAGTTTCAGGAGGG - Intronic
940549114 2:155129686-155129708 TTCAATGTAAAATTTGAGGAAGG - Intergenic
941552193 2:166930582-166930604 TTGCATGTATTGTTTTATGTTGG + Intronic
941946132 2:171099826-171099848 TTGCATATATGGTATGAGGTAGG - Intronic
943539141 2:189189953-189189975 TTGCATGTATATTTAGTGTATGG - Intergenic
943976135 2:194480244-194480266 TTGCTTGTTTATTTTGAGGAAGG + Intergenic
944064533 2:195604714-195604736 TTGCATATATATTTTGAGACAGG - Intronic
944386996 2:199178161-199178183 TTGTATGTAGAGTTTGAAGTAGG - Intergenic
944900575 2:204210307-204210329 TTGTTTGTATGGTATGAGGAAGG + Intergenic
946818660 2:223608110-223608132 TTGCATATATAATATGATGAGGG + Intergenic
947385652 2:229587650-229587672 TTGCATGGAAAGTGTGGGGAGGG + Intronic
947964051 2:234264267-234264289 TTGCTTGAATAGTATGAGCATGG + Intergenic
1170576922 20:17671209-17671231 TTGCCTATTTAGTTTGAGTAAGG + Intronic
1177310538 21:19386676-19386698 CTACATGAATATTTTGAGGAGGG - Intergenic
1177376873 21:20281770-20281792 TTGCATGTGGAATTTGAGGAGGG - Intergenic
1177691659 21:24517961-24517983 TAGTAAGTATAGTTTGAGGTTGG - Intergenic
1180753755 22:18145744-18145766 TTTCATGAATCGTTTGAAGATGG + Intronic
1182031865 22:27165462-27165484 TTTCAGGTAGAGTTGGAGGAGGG + Intergenic
1182132035 22:27861427-27861449 TAGCATGTTTATTTTCAGGAAGG + Intronic
949251720 3:1993009-1993031 ATGCATGGATAGTTGGTGGAAGG + Intergenic
949831184 3:8216190-8216212 GTGCATGTGCATTTTGAGGATGG + Intergenic
955447386 3:59028421-59028443 TTGTCTGTAGAGTTTCAGGAAGG - Intronic
955963447 3:64364140-64364162 TTGCATCCATAGGGTGAGGAAGG - Intronic
957314688 3:78562111-78562133 TTTCACGTATAATTGGAGGAGGG - Intergenic
958458223 3:94360101-94360123 TTCCACGTATTGTTTGAGAAAGG + Intergenic
959144234 3:102524519-102524541 GTGCATCTATTCTTTGAGGAAGG - Intergenic
959178608 3:102949969-102949991 ATGAATGTATAATTTGAAGAAGG + Intergenic
959526871 3:107387336-107387358 TTGCATGTATTTTCTCAGGATGG - Intergenic
960787886 3:121394580-121394602 TTGTATGTCTAGTTTGTTGAGGG + Intronic
966031299 3:175351563-175351585 TTGAATGTAAGGTATGAGGAAGG + Intronic
967766298 3:193283243-193283265 TTTGGTGTATAGTTTGAGGTAGG - Intronic
970523438 4:16908282-16908304 TTGAATGTATATTTTGTGGGTGG - Intergenic
974803242 4:66846598-66846620 TAGCATGTTTAGTTAGAAGAAGG - Intergenic
975360660 4:73466889-73466911 TTGTATGTATAGCTAGAAGAGGG - Intergenic
976447400 4:85147076-85147098 TTGGATTTATACTTTGAGGCTGG + Intergenic
976978437 4:91193011-91193033 TTGCATGTATAGTTTGAGGAAGG - Intronic
977796098 4:101166976-101166998 TTGCACGTATAATTAAAGGAGGG - Intronic
978306869 4:107338546-107338568 TTGTATGTATAGTATGAGCTAGG - Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980892699 4:138832026-138832048 TAGGATATATAGTTTCAGGAAGG + Intergenic
982390157 4:154854795-154854817 TTGCATGTATAGTTCTTGGATGG + Intergenic
983285925 4:165739059-165739081 TTATATGTGTAGTTTGAGTAAGG + Intergenic
983541240 4:168913102-168913124 TTTAATGTATGGTTTGGGGAAGG + Intronic
983988016 4:174083688-174083710 TTGCATGTTTTGTTTCAGGAAGG + Intergenic
985937505 5:3108092-3108114 GTGCATGCATGGTTTGGGGATGG + Intergenic
986291492 5:6403181-6403203 TTTCATATGTAATTTGAGGAAGG - Intergenic
986320429 5:6628031-6628053 TTTAATGTCTAGATTGAGGATGG - Intronic
986784386 5:11098808-11098830 TCGCCTGTAATGTTTGAGGAAGG - Intronic
986999744 5:13648172-13648194 TTCCATGTATGATTTTAGGATGG - Intergenic
987110021 5:14676851-14676873 TTGCATGTCTACTTAGTGGATGG - Intronic
987378122 5:17256801-17256823 TTGCATGCTAAGGTTGAGGAAGG + Intronic
989602364 5:43211931-43211953 TTGCATGTGTGGTTTGATGAAGG - Intronic
990927887 5:61049921-61049943 TGACATGTATAGTCTGATGAGGG + Intronic
993724614 5:91353685-91353707 CACCATGAATAGTTTGAGGATGG - Intergenic
994863530 5:105232009-105232031 TTGCCTGCATTGTTTCAGGAAGG - Intergenic
994986771 5:106943500-106943522 TTTCATGTATTATTTGAAGAAGG + Intergenic
996890823 5:128417524-128417546 TTCTATGCATAGTTTGTGGAGGG + Intronic
997593747 5:135092377-135092399 TTGCGTGTCCAGTTTGAGTATGG + Intronic
998622188 5:143807036-143807058 CTGCATGTATAGTATTAGGAAGG - Intergenic
1003011420 6:2430884-2430906 TTGCATGGATACTTTAAGCAGGG + Intergenic
1003335061 6:5163229-5163251 TTTCATGTATGGTATGAGGAAGG + Intronic
1003464224 6:6363046-6363068 CTGCATGAAGAGTTTGAGAAAGG - Intergenic
1004419435 6:15454820-15454842 TTGCATGTTGAGTATGAAGATGG + Intronic
1005658077 6:27964305-27964327 TTTTATGTATGGTGTGAGGAAGG + Intergenic
1006548974 6:34804600-34804622 TTGAATGTAGGGTTTGAGGGTGG + Intronic
1007852771 6:44821170-44821192 TTTCATGTATGGCTTGAAGAAGG + Intronic
1009762178 6:68021735-68021757 TTGAAAGTATAGTTGGAGGAAGG - Intergenic
1011503586 6:88017192-88017214 TGCCATGTATGGTATGAGGATGG - Intergenic
1012830421 6:104197723-104197745 TTGTATATATGGTGTGAGGAAGG - Intergenic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1015938756 6:138428636-138428658 TTGCATGAAGAGTTTCAGGTAGG + Intronic
1016554940 6:145325939-145325961 TTGCAGGTATACATTGTGGAAGG + Intergenic
1017560118 6:155617902-155617924 TTTTGTGTATGGTTTGAGGAAGG + Intergenic
1018201675 6:161401163-161401185 TTGCATGTAAAGTATCAGGCTGG + Intronic
1021256672 7:18400652-18400674 TTGCATGTATAAATTGATGCAGG - Intronic
1021465033 7:20932808-20932830 TTGCATGTGTATTTTGAGTGTGG + Intergenic
1022661596 7:32372459-32372481 TTTCGTGTATTGTGTGAGGAAGG - Intergenic
1022939622 7:35220593-35220615 TTCCAGGTATAGATTGAAGAAGG - Intronic
1023894185 7:44418368-44418390 TTGTATGTATAGAGTAAGGAGGG + Intronic
1027347998 7:77281700-77281722 ATGCATGCATGTTTTGAGGAAGG + Intronic
1027634241 7:80649983-80650005 TTGAAAGTATACTTTGAGTAGGG + Intronic
1027737558 7:81953098-81953120 TTGAAGGTAGAGTTAGAGGATGG - Intronic
1029311068 7:99665358-99665380 CTGCATGTATAGTGGAAGGACGG - Intronic
1030717773 7:112830546-112830568 TCTCATGTATATCTTGAGGAAGG + Intronic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1036445551 8:8819230-8819252 TTGCATGTATATAATGAGTAGGG - Intronic
1037155147 8:15690670-15690692 TTTTATGTATAGTGTAAGGAAGG + Intronic
1040883090 8:52229704-52229726 TTTCATGGATATTTTGGGGAGGG + Intronic
1042232656 8:66574540-66574562 TTGGAGGTATATTTTGAGGCTGG - Intronic
1043620426 8:82184702-82184724 TTTAATGATTAGTTTGAGGAAGG - Intergenic
1043782681 8:84355908-84355930 TTGCATGTTGAATTGGAGGAGGG + Intronic
1044074797 8:87807096-87807118 TTGTAAGTATAGTTTGAAGCTGG + Intergenic
1044201146 8:89439528-89439550 TTGCATGTTCAGTATGAGGTTGG - Intergenic
1045771196 8:105742441-105742463 TAGGAGGTATAGTTTGAGAATGG + Intronic
1047948598 8:129908059-129908081 TGTAATGTATAGTTTGAGAAGGG - Intronic
1048488038 8:134866861-134866883 TTCCATGTTTATTTTGAGAATGG + Intergenic
1050737203 9:8777460-8777482 TTGTCTTTATATTTTGAGGAAGG - Intronic
1052548561 9:29914681-29914703 ATACATGAATACTTTGAGGATGG + Intergenic
1054856669 9:69907777-69907799 TTGGATGTATAGTAAGTGGAAGG - Intergenic
1056234179 9:84575102-84575124 TTGCATGTTTACTTTGTGGCAGG + Intergenic
1057691002 9:97285497-97285519 TTTTATGTATGGTTTGAGGTAGG + Intergenic
1059792013 9:117650286-117650308 TGGCATGTATAGGTGGAGGTGGG + Intergenic
1186991627 X:15075583-15075605 TTGCATGCAAAATGTGAGGAAGG - Intergenic
1192113220 X:68386392-68386414 TTTCTTGTCTAGTTTCAGGAAGG - Intronic
1192849488 X:74939705-74939727 TTCAATGTATAGTTTGTTGAGGG + Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1194201961 X:90962984-90963006 TTTTATGTATAGTGTAAGGAAGG - Intergenic
1194375675 X:93130360-93130382 TTTCATGTATGGTGTGAGGTAGG + Intergenic
1195162438 X:102183783-102183805 ATGCATGTATGGTTTGAAGGTGG + Intergenic
1196974763 X:121147198-121147220 ATGCATGCATAGTTTCCGGATGG - Intergenic
1197377687 X:125701898-125701920 TTCAATGTCTAGTTTGAGGAGGG + Intergenic
1198329828 X:135611977-135611999 TTGCATGCATAGTGTCATGAAGG + Intergenic
1198406425 X:136317068-136317090 TTTCATGTACAGTTTGAGATGGG - Intronic
1200521819 Y:4218435-4218457 TTTCTAGTATAGTTTGAAGATGG - Intergenic
1200547797 Y:4538436-4538458 TTTTATGTATAGTGTAAGGAAGG - Intergenic
1201525987 Y:14935119-14935141 TTGAATGTCTAGCTTGTGGAAGG - Intergenic