ID: 976978757

View in Genome Browser
Species Human (GRCh38)
Location 4:91197236-91197258
Sequence CCTTATATGGGGAGAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976978757_976978764 21 Left 976978757 4:91197236-91197258 CCTTGCTTTCTCCCCATATAAGG 0: 1
1: 0
2: 2
3: 11
4: 195
Right 976978764 4:91197280-91197302 TGTGAATATATCTAATTGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 219
976978757_976978763 17 Left 976978757 4:91197236-91197258 CCTTGCTTTCTCCCCATATAAGG 0: 1
1: 0
2: 2
3: 11
4: 195
Right 976978763 4:91197276-91197298 CTTATGTGAATATATCTAATTGG 0: 1
1: 0
2: 1
3: 19
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976978757 Original CRISPR CCTTATATGGGGAGAAAGCA AGG (reversed) Intronic
906567413 1:46811013-46811035 CATGATATGGGGAGGAAGCCTGG + Intronic
906839461 1:49121318-49121340 ACAAATATGGGGAGAAACCAAGG - Intronic
907456424 1:54579412-54579434 CCTTTTTTGGGAAGAAGGCAGGG + Intronic
909327093 1:74364518-74364540 CCTTACATGGGGAAGAATCAAGG + Intronic
909327113 1:74364611-74364633 CCTTACATGGGGAAGAATCAAGG + Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
915228352 1:154427800-154427822 CCTTGGATGGGGTGAAAGGAAGG + Intronic
915339760 1:155170428-155170450 CCTTTTATGGGAGGAAAGCCAGG - Intronic
917083932 1:171286375-171286397 CTTTTAATGGAGAGAAAGCAGGG + Intergenic
918915644 1:190633809-190633831 CCATTTAGGGGGAGAAAGTAAGG - Intergenic
920733983 1:208514380-208514402 CTTTTTATGGGGTGAAAGAAAGG - Intergenic
921475253 1:215599427-215599449 CCTTATATGGGAAGATAGACTGG + Intronic
921611017 1:217212613-217212635 CCTTATATTAGGAGAATGAAAGG - Intergenic
921783118 1:219192477-219192499 CATTACGTGAGGAGAAAGCAGGG + Intronic
923361128 1:233212169-233212191 CCTTGTATGTGGAGCAAGCAAGG + Intronic
924242437 1:242054289-242054311 CCTTATGTGGCCAAAAAGCAAGG + Intergenic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
1063485687 10:6418464-6418486 CATGAGAGGGGGAGAAAGCAGGG - Intergenic
1066333138 10:34447015-34447037 GTTTATATGGATAGAAAGCAAGG - Intronic
1067128414 10:43540085-43540107 CCTTATAGGGAGAGACATCAGGG - Intergenic
1068642767 10:59428781-59428803 CCTTATATGGGGATCTAGCTAGG + Intergenic
1073550349 10:104394402-104394424 GCTAATATGTGCAGAAAGCAAGG - Intronic
1074960240 10:118438137-118438159 CCTGATATGGGAAGAAAGAGAGG - Intergenic
1077811145 11:5638391-5638413 CCTTAACTGGGAAGAAAGTAAGG - Intronic
1078108142 11:8371543-8371565 ACTGATATAGGGAGAAAGCATGG + Intergenic
1079241048 11:18722172-18722194 AGCTACATGGGGAGAAAGCAGGG + Intronic
1080242465 11:30142410-30142432 CCTAATCTGGGGAGATAGAAAGG + Intergenic
1085889331 11:80559025-80559047 ACTTTTATGGGGAAAAATCAAGG - Intergenic
1089783298 11:120889964-120889986 CCTAATAAGGGGAGAAGGGAAGG + Intronic
1090985365 11:131761506-131761528 CCTCATAAGAGGAGAAAGCCGGG + Intronic
1091357873 11:134951872-134951894 CTCTATAAGGGAAGAAAGCAAGG + Intergenic
1092079732 12:5705852-5705874 TCTTAAATGGGTAGAAAGAAGGG - Intronic
1096423566 12:51481545-51481567 CCTTCTGTGGGGAGACAGCAGGG + Intronic
1096753850 12:53782422-53782444 CTTTTTCTGGGGGGAAAGCAGGG + Intergenic
1097249205 12:57623150-57623172 CCTTGGATGAGGAGAAAGGATGG + Intronic
1098127402 12:67313544-67313566 CATTATCTGGAGAGAAAGAAAGG + Exonic
1098517495 12:71394368-71394390 CCCTAAATTGGGAAAAAGCATGG - Intronic
1098987409 12:77027621-77027643 CATTATTTGGTGAAAAAGCACGG - Intronic
1100737385 12:97551811-97551833 TCCTATGTGGGGAGATAGCATGG - Intergenic
1104004738 12:124884127-124884149 CCTCAGATGGGGAGAATGAAAGG - Intergenic
1104471969 12:129036602-129036624 CCTTATAAGAGGAGAAGGCCAGG + Intergenic
1106577100 13:30985055-30985077 ACTTATATAGGCAGAAAACAGGG + Intergenic
1107348648 13:39490341-39490363 CCTGATAGGGGAACAAAGCAGGG + Intronic
1107807758 13:44171246-44171268 CATTTTTTGGGGAGAAAGTAAGG - Intergenic
1108414020 13:50179203-50179225 CCTCATCTTGGGAGTAAGCATGG - Intronic
1109682117 13:65765501-65765523 CCTTATATGGTTTTAAAGCAGGG + Intergenic
1110168321 13:72470218-72470240 ACTTAGATGGGGGGAAAGAAAGG - Intergenic
1110471277 13:75862740-75862762 CCCTCTATGGGGAGAAACAAGGG + Intergenic
1112391778 13:98991904-98991926 CCACAGGTGGGGAGAAAGCAAGG - Intronic
1112712258 13:102143054-102143076 CCATGTATGGGGATAAACCATGG - Intronic
1114228300 14:20758450-20758472 CCGTATATGTGGAATAAGCAGGG + Intergenic
1118374222 14:65162852-65162874 CCTTTTCTGGGGCTAAAGCAGGG + Intergenic
1125579131 15:40773492-40773514 CCAGATATGGAGAGAAAGCAAGG + Intronic
1125781013 15:42268146-42268168 CCTTATGTTTGGAGAAAGGATGG - Intronic
1126558596 15:50018697-50018719 CCATTTATGGGGACAAAGCTTGG - Intronic
1130978907 15:88799226-88799248 CCTTATATTGGGACTTAGCAAGG + Intergenic
1132715740 16:1289069-1289091 GCATATGTGGGGAGAAAGCCGGG + Intergenic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1135634648 16:24063624-24063646 TTTTATAAGGGGAGAAAGAATGG + Intronic
1136342711 16:29655417-29655439 AGTGCTATGGGGAGAAAGCAAGG + Intergenic
1137455789 16:48616843-48616865 CCTTCTCTGGGGAAAAAGCGTGG + Intronic
1138877524 16:60970753-60970775 GCTAATAAGGGGAGAAAGAAGGG + Intergenic
1139872980 16:70122586-70122608 CATTACAAGGGGAGAAAACAGGG - Intronic
1142250211 16:88988526-88988548 CCTTATAAGAGGAGGAAGCTTGG - Intergenic
1142573831 17:893295-893317 TCTTTTTAGGGGAGAAAGCATGG + Intronic
1145107136 17:20127654-20127676 CATTATCTGGGGTGAAAGTAAGG + Intronic
1148565327 17:48629285-48629307 CATTGTCTGGGGAGAAAACAAGG - Intronic
1153037810 18:780932-780954 CTTTATATTGGGAGAAAGAGGGG - Intronic
1153254136 18:3153164-3153186 CCTCATGTGGGCAGAAAGAAAGG + Intronic
1156166792 18:34430713-34430735 TCTTCTAGGGGGAGAAAGAAAGG - Intergenic
1156331132 18:36124370-36124392 CCTTGAATGTGAAGAAAGCAAGG - Intronic
1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG + Intergenic
1157119161 18:44892327-44892349 CCTTATATGGGAATTAAGGATGG + Intronic
1158754809 18:60309424-60309446 TCTCATATGATGAGAAAGCAAGG + Intergenic
1158944113 18:62433537-62433559 TGTGATATGTGGAGAAAGCAAGG - Intergenic
1159242940 18:65766690-65766712 TTTTATATGGGGAGAAGGAAGGG + Intronic
1159659361 18:71075049-71075071 CATTATATGGGCTGGAAGCAAGG - Intergenic
1160321912 18:77904506-77904528 CCTGATATTTTGAGAAAGCAAGG + Intergenic
1162623187 19:11861075-11861097 CCGTATATTTGGAGAATGCAGGG - Intronic
1162909170 19:13840267-13840289 ACCTATGTGGGGAGAAGGCAGGG - Intergenic
1164435372 19:28224128-28224150 CCTTGTAAGGGGAGAAAAGAGGG + Intergenic
1164765351 19:30760852-30760874 CCCAAGATGGGAAGAAAGCAAGG - Intergenic
1165882426 19:39053393-39053415 CTTTGTATGGGGACCAAGCAGGG - Intergenic
1167770492 19:51512078-51512100 CCTAAGATTGGGAGAAAGGAAGG - Intergenic
1168474597 19:56666767-56666789 CCTTATAAGAGGAGACACCAGGG + Intronic
925075763 2:1014505-1014527 ATTTATATGGGCAGAAAGAAGGG + Intronic
925878581 2:8332183-8332205 CCATGGTTGGGGAGAAAGCAAGG - Intergenic
925996555 2:9298329-9298351 CCTTAGAAGGGGAGAAATGAGGG + Intronic
926781323 2:16474987-16475009 AATTATAGAGGGAGAAAGCATGG - Intergenic
928796318 2:35025311-35025333 CCTTACTTTGGGAGAATGCAGGG - Intergenic
928835594 2:35541016-35541038 TCTTTTATGGGGAGAAATCTGGG + Intergenic
929041714 2:37750928-37750950 CATCACATGGGGAGAAACCATGG - Intergenic
934774329 2:96927524-96927546 CCTTGTGTGGGAGGAAAGCAGGG - Intronic
935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG + Intergenic
936152895 2:110031296-110031318 CCAAAGCTGGGGAGAAAGCATGG + Intergenic
936191785 2:110340116-110340138 CCAAAGCTGGGGAGAAAGCATGG - Intergenic
937587924 2:123578171-123578193 CCTTTTTTGGGGGGATAGCAGGG - Intergenic
939134460 2:138276971-138276993 CCTTATATTAGCAGAAAACAAGG - Intergenic
939179340 2:138785647-138785669 TCATATATGGAGCGAAAGCAGGG + Intergenic
939303195 2:140374366-140374388 CCTTATATGGGGATGAACCTGGG - Intronic
939623975 2:144453707-144453729 CCTTTTGTGGCGACAAAGCAAGG + Intronic
939919795 2:148095868-148095890 TCTTATGTGGGGAGAAGGAAGGG + Intronic
939950581 2:148468056-148468078 CTTTATCTGTTGAGAAAGCATGG - Intronic
943201040 2:184824429-184824451 CTTTATATGTGAAGAAAACATGG + Intronic
944318732 2:198311336-198311358 CCATATGTGGAGATAAAGCAGGG - Intronic
945686578 2:212978137-212978159 CCTTATATGACTATAAAGCAAGG - Intergenic
948866003 2:240775162-240775184 CCTGAGCTGGGGAGCAAGCATGG + Intronic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169052963 20:2596020-2596042 ACTTATCTGGGGTGAGAGCAGGG - Intronic
1169470966 20:5885341-5885363 CATCATATGGGGAGAAACCTTGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170105812 20:12753587-12753609 CCTTATATGAGGAGCAAGGAGGG - Intergenic
1171423075 20:25032059-25032081 CCTAGCTTGGGGAGAAAGCAGGG - Intronic
1172382890 20:34511642-34511664 CCAGGTATGGGGAGAAAGCCTGG + Intergenic
1173953617 20:47013150-47013172 CCACATATGGGGAGACTGCAGGG + Intronic
1175448167 20:59040861-59040883 GATTATGTGGGGAGAAAGCACGG + Intronic
1175919072 20:62441635-62441657 CCTTGTGTGGGGAGCAAGCTGGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1181384447 22:22533609-22533631 CCTTATAAGAGGAGGAAACATGG + Intergenic
1181844178 22:25693319-25693341 CCTTGTATGTGGTAAAAGCATGG + Intronic
1183165792 22:36146314-36146336 CCGTACATGGGGAGAAAGCATGG - Intronic
1183172107 22:36196087-36196109 CCGTACATGGGGAGAAAACATGG - Intronic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
952204603 3:31168283-31168305 CATTAGATGGGGAGAAGGAAAGG - Intergenic
954280225 3:49571908-49571930 CCTTCTCTGAGGATAAAGCAGGG - Intronic
956387472 3:68735361-68735383 CCTTTGATGCAGAGAAAGCAAGG + Intronic
957146347 3:76429267-76429289 GCTTATAGGGGTAGAAAGAAGGG + Intronic
960848771 3:122030191-122030213 TATTATAAGGGGAGAAACCAAGG + Intergenic
961230192 3:125299772-125299794 CATTATTTGGGCAGAAAGCATGG - Intronic
961393146 3:126568630-126568652 CCTTGTATGTGGTGAAAGGAGGG - Intergenic
962337651 3:134550803-134550825 CCTTAAATGGAGAATAAGCAGGG + Intronic
963782401 3:149499394-149499416 TCTTATATGGGAAGAAAAAAGGG + Intronic
965855250 3:173080382-173080404 CCTTAGAGGTGGAGAAACCAAGG + Intronic
966426768 3:179788198-179788220 CCTTCTGTGGGGAGATGGCAGGG + Exonic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
968061406 3:195728738-195728760 CTATACATGGGGAGAAAGCTTGG + Intronic
973306325 4:48655367-48655389 CATTATATGAGGAGAAATCCTGG - Intronic
973698403 4:53513420-53513442 CCATATAAGGGGAGAAAGCATGG - Intronic
974459985 4:62174833-62174855 CTTTATATGAGGAGATAGCAAGG + Intergenic
974750643 4:66136270-66136292 CCTTGTCTGAGGAGAAAGCAGGG + Intergenic
975383459 4:73728735-73728757 CCTTAAATGGAAAGAAAACAGGG + Intergenic
976277652 4:83294029-83294051 CCTAATATGGTCAGGAAGCAAGG - Exonic
976365083 4:84224137-84224159 GCTTATAAGGAGAGAAAGTAGGG - Intergenic
976978757 4:91197236-91197258 CCTTATATGGGGAGAAAGCAAGG - Intronic
979122980 4:116926472-116926494 CATTACCTGGGGAGAAGGCAAGG + Intergenic
980563495 4:134507423-134507445 TGATATATGGGGAGAGAGCAGGG - Intergenic
981648223 4:147024419-147024441 CTTTATAGGGGCAGGAAGCAGGG - Intergenic
982506827 4:156228876-156228898 ACTTTTATGGGGTGAGAGCAAGG - Intergenic
986159205 5:5209592-5209614 GCTTATATTGGGAGAGAGGAGGG - Intronic
987364780 5:17139218-17139240 CCTTGGATGGGGAGAGGGCAGGG - Intronic
987454540 5:18126984-18127006 CCTTATACTGGGAGAGAGGATGG + Intergenic
989329869 5:40244210-40244232 CCAGATATGGGGAGAAAAGAAGG + Intergenic
994548149 5:101196036-101196058 CCTTATGTGGGGAGGAAAAATGG + Intergenic
996358965 5:122624634-122624656 CCATCTATGGGTAGACAGCAGGG - Intergenic
997659217 5:135577145-135577167 CCTTGCAGGGGAAGAAAGCAGGG - Intronic
998420442 5:141980320-141980342 CCTTACATGGGGAGACCCCATGG - Exonic
999544036 5:152607075-152607097 CCTTGTAGGGGGAGAAAATAAGG - Intergenic
1003314882 6:5003493-5003515 CCTGATTTGGGGAAAAAGCGAGG + Intronic
1003807206 6:9738417-9738439 CTTTCTATGGGCAGGAAGCAGGG + Intronic
1008192482 6:48476308-48476330 CATTTTTTGGGGAGAAAGTAAGG + Intergenic
1008206588 6:48667355-48667377 GCTTATATTTGGTGAAAGCAGGG - Intergenic
1009217705 6:60944039-60944061 CCTTATATGGGGAAAAACGGTGG + Intergenic
1009475280 6:64083519-64083541 CTTTGAATGGGGAGAAAGTAAGG + Intronic
1010007696 6:71013207-71013229 CATTATTTGGGGAGGAAGCGGGG + Intergenic
1012271810 6:97222289-97222311 CCTTATAGGGAGAGAAAAAAAGG + Intronic
1013849809 6:114500662-114500684 CCTTATGTTGGTAGAAAGCTGGG - Intergenic
1015755388 6:136600903-136600925 GCTTACATGGGGGGAAAGGAGGG - Intronic
1016063967 6:139660051-139660073 CTTTACATGGGCAGAAATCAAGG + Intergenic
1016705527 6:147102409-147102431 CCTGAAGTGGGGAGAAATCAGGG + Intergenic
1016844465 6:148557239-148557261 CCTCCAATGGGTAGAAAGCAAGG + Intergenic
1016911909 6:149207673-149207695 CCTTATAAGAGGAGAAGGCTAGG - Intergenic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1018678775 6:166245902-166245924 CCTTTTATGGGGGGAGAGGAGGG + Intergenic
1019930235 7:4217817-4217839 CCTGAAATGGGGAGAAGGCCAGG + Intronic
1021537749 7:21724453-21724475 ACTTCTATGGGGAAAAATCACGG + Intronic
1022063014 7:26819591-26819613 ACTGAGAAGGGGAGAAAGCATGG - Intronic
1022549645 7:31227023-31227045 CATTTTCTGGGGAGAAATCAAGG + Intergenic
1022971308 7:35519903-35519925 CCTTTTCTGGGGTGAAAGAAGGG - Intergenic
1023117149 7:36873666-36873688 CCTTACAAAGGGAGAAATCATGG - Intronic
1027241206 7:76330443-76330465 CCTTTTCTGGGGAGGAAGCCAGG - Intronic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1028150098 7:87362270-87362292 CCTTATATGAGGTAAAAGCCTGG + Intronic
1030184679 7:106750159-106750181 CCTTATATGGGCAGAACTCCAGG - Intergenic
1031623923 7:123970341-123970363 CCTTATAAGGGGAAGAAACAAGG - Intronic
1032141386 7:129333989-129334011 ACTCATATGGGAAAAAAGCAAGG - Intronic
1033299235 7:140172063-140172085 CCTTAGATTGGGAGGATGCAGGG + Intronic
1034322266 7:150197254-150197276 GCTTCTATGCGGAGAAGGCAGGG - Intergenic
1034770475 7:153769955-153769977 GCTTCTATGCGGAGAAGGCAGGG + Intergenic
1038351036 8:26776494-26776516 CTTTATATGTGAAGACAGCAAGG + Intronic
1038658070 8:29472397-29472419 CGTTCTATGATGAGAAAGCAGGG - Intergenic
1038949587 8:32399962-32399984 GGTGATATGGGGAGAAGGCAAGG - Intronic
1039358519 8:36848453-36848475 TTTTATATGGGGTGAAAGAAAGG + Intronic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1047969956 8:130076066-130076088 GTTTATAAGGGGAGAAAGAATGG + Intronic
1048115318 8:131515336-131515358 AGTTTTATGGGAAGAAAGCAAGG - Intergenic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1054987975 9:71284407-71284429 CCTTATATGTGAAGAAAACGTGG + Intronic
1055785279 9:79864155-79864177 CCGCATGTGGGGAGATAGCAGGG - Intergenic
1056123167 9:83509571-83509593 CCTTATCCTGGGAAAAAGCAGGG + Intronic
1056849542 9:90070682-90070704 CCTTACATGGGGTGGCAGCAGGG + Intergenic
1058475906 9:105332757-105332779 TCTTATATGGGCATAAAACAGGG - Intronic
1059064805 9:111072066-111072088 CATATTAAGGGGAGAAAGCAAGG + Intergenic
1059556040 9:115281566-115281588 ACTTAAACGGGGAGAAAGGAAGG - Intronic
1186030254 X:5360715-5360737 CCTTGTAGGGAGAAAAAGCAAGG - Intergenic
1188021997 X:25169187-25169209 CCTAAAATGGGCAGTAAGCATGG + Intergenic
1193806666 X:86003291-86003313 ACAAAGATGGGGAGAAAGCAGGG + Intronic
1197382657 X:125764974-125764996 ACTTTTGTGGGGAGAAAGTAAGG - Intergenic
1199735976 X:150687060-150687082 CCTCATATGGTGAGGAAGCTAGG + Intergenic
1201223418 Y:11792680-11792702 CCTTATAAGGAGAGACAGCAAGG + Intergenic