ID: 976979020

View in Genome Browser
Species Human (GRCh38)
Location 4:91202035-91202057
Sequence AAAAGTGCTAAAAGTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976979020 Original CRISPR AAAAGTGCTAAAAGTGATAT TGG (reversed) Intronic
901591528 1:10348098-10348120 AAAAGTATTAAAAGTGACATAGG - Intronic
902054802 1:13591439-13591461 AAATGTTCTAAAATTGATAGTGG - Intronic
902270187 1:15298621-15298643 AAAAGTGATAGACATGATATTGG - Intronic
904967668 1:34391092-34391114 AAAAGTACTAAAAGAAATAATGG - Intergenic
905900541 1:41579368-41579390 AAAAGTTCTAAAATTGCTACAGG + Intronic
906388346 1:45391473-45391495 AAAAGTTTCAAGAGTGATATGGG - Intronic
908879411 1:68713770-68713792 AAAATTGACAAATGTGATATAGG + Intergenic
908961107 1:69697798-69697820 ATTAGTGATAAAACTGATATTGG + Intronic
909094237 1:71267611-71267633 TAAACTGCTATATGTGATATTGG + Intergenic
909640705 1:77868827-77868849 AAACATGTGAAAAGTGATATTGG - Intronic
910266819 1:85346642-85346664 ATAAGTGATAAAAGTGGTATTGG - Intronic
910313929 1:85860291-85860313 AAATGTTCTAAAATTGATTTTGG - Intronic
910548455 1:88448057-88448079 AAATGTGCTAAAATTGATTGTGG - Intergenic
910980681 1:92957825-92957847 AAATGTTCTAAAATTGATAGTGG - Intronic
911684368 1:100757798-100757820 CAAAGTGTTAAAATTGATAGTGG + Intergenic
911685584 1:100773320-100773342 AATAATGCTAAAATTAATATTGG + Intergenic
912003544 1:104864341-104864363 CAAAGTGGTAAAATGGATATTGG - Intergenic
912545417 1:110447647-110447669 GAAAGTGCTAAAAGTGGACTTGG - Intergenic
912636853 1:111303303-111303325 AAAAAAGCTAAAAGGCATATAGG - Intronic
912982708 1:114391221-114391243 AAAACTGAGAAAAGTCATATTGG + Intergenic
913036752 1:114974276-114974298 AAAAGTGCTAAATAAAATATTGG - Intronic
913060536 1:115201657-115201679 AAAAATCCTAAAATTCATATAGG + Intergenic
913364695 1:118024420-118024442 AAAGTTGGTAAAAGTGATATAGG - Intronic
913402063 1:118447766-118447788 AAAAATCCTAAACATGATATTGG + Intergenic
913433225 1:118818864-118818886 AAAAATTCTAAAATTCATATGGG + Intergenic
914215383 1:145622442-145622464 AAATGTTCTAAAATTGATTTAGG + Intronic
914467333 1:147942827-147942849 AAATGTTCTAAAATTGATTTAGG + Intronic
914860050 1:151378216-151378238 AAAAGTGCTATGTGGGATATGGG + Intergenic
915684135 1:157614553-157614575 AAAAGTGCTTAAAGGGAAATTGG + Intergenic
915781844 1:158560761-158560783 GAAATTGTTACAAGTGATATAGG - Intergenic
916837204 1:168558361-168558383 AGAAGTGCAAAAAGATATATGGG + Intergenic
917943900 1:179950238-179950260 AAATGTTCTAAAATTGATAGTGG - Intergenic
918056753 1:181028141-181028163 AAAAGTGTTAACATAGATATAGG + Intergenic
918911070 1:190570380-190570402 AAAAGTTCTAGAAGAGATATAGG - Intergenic
918995818 1:191757946-191757968 CATAGTGCTAAAAGTTGTATAGG - Intergenic
919242574 1:194934477-194934499 AAAAGTTATAAATGTGTTATAGG + Intergenic
919347581 1:196404699-196404721 AAAAATGCTAAAAATTAGATGGG - Intronic
919437244 1:197577058-197577080 AAATGTGTTTAAAGTAATATAGG + Intronic
921195187 1:212749797-212749819 AAAAGTGCTAAGAGTAGTTTGGG + Intronic
923994782 1:239481381-239481403 AAAAGTGCAAACAGTGCTAACGG - Intronic
924301806 1:242647029-242647051 TAAATTGCTAAGAGTGATAGTGG - Intergenic
1063780256 10:9314746-9314768 AATAGTGCATGAAGTGATATGGG + Intergenic
1064866618 10:19887771-19887793 AAAAGTGCTAAAACTTATTCAGG + Intronic
1065760291 10:28975537-28975559 AGAAGTGCTAAAGGAGAGATGGG - Intergenic
1068077557 10:52275677-52275699 AAAAATTCTAAAATTCATATGGG - Intronic
1068840311 10:61606014-61606036 AAATGTTCTAAAATTGATGTGGG + Intergenic
1071340987 10:84648495-84648517 AAAAATGATAAAGGGGATATGGG - Intergenic
1071383183 10:85091936-85091958 CAGAGTGCTAAAAGTGTAATTGG + Intergenic
1071443330 10:85723613-85723635 AATACTAATAAAAGTGATATGGG - Intronic
1071589453 10:86858918-86858940 AAAAATCCTAAAATTAATATAGG + Intronic
1071752168 10:88492306-88492328 AAAAGTCCAATAAGTGGTATTGG + Intronic
1072147738 10:92657487-92657509 AAAAGTGCTCAAAGAGCTAAGGG + Intergenic
1072590658 10:96825908-96825930 AAATGTTCTAAAAGTGATTGTGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072879215 10:99207557-99207579 AAAAGTACTAAAAATAATAATGG + Intronic
1072940024 10:99754352-99754374 AGAAGTGATAAAAGATATATAGG - Intronic
1073197700 10:101706642-101706664 AAAATTGCCAAGAGTGATGTGGG - Intergenic
1073451809 10:103614256-103614278 AAAAATGTAAAAAGTGATTTGGG + Intronic
1074625389 10:115178246-115178268 ACAACTTCTAAAAGTGATGTCGG + Intronic
1074804219 10:117031146-117031168 AAAAGTGCTACTAGGCATATTGG - Intronic
1075771608 10:124942620-124942642 AAAAGTGGTTCAAGTGATGTTGG + Exonic
1078029246 11:7732489-7732511 AAAAATGCTAAAATTCATATGGG + Intergenic
1078174171 11:8956647-8956669 AAAATGGTTTAAAGTGATATGGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079634370 11:22717143-22717165 AAAAATCCTAAAATTCATATGGG + Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079767349 11:24411272-24411294 AAAACTCCTTAAGGTGATATAGG + Intergenic
1080096261 11:28411239-28411261 AAAAATTCTAAAATTCATATGGG + Intergenic
1080184291 11:29461721-29461743 AAATGTGCTACAAGTGTTACTGG + Intergenic
1080899992 11:36480638-36480660 AAAAGTGTTTAAAGTAATAGTGG - Intergenic
1082685902 11:56239168-56239190 AAAAATCCTAAAATTCATATGGG - Intergenic
1085239154 11:75037367-75037389 AAACATTCTAAAAGTGATTTTGG - Intergenic
1085552650 11:77389010-77389032 AAATGTTCTAAAATTGATTTTGG - Intronic
1085832943 11:79921391-79921413 AAATGTCCTAAAAGTGATCTTGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088824968 11:113485705-113485727 AAAAATTCTAAAATTCATATGGG + Intergenic
1089029285 11:115307269-115307291 AAAATTGCTAAAAATTATTTGGG - Intronic
1089411856 11:118250445-118250467 AAATGTTCTAAAATTGATAGTGG + Intronic
1089507050 11:118970662-118970684 CATAGTGCTAAAAGGGATAACGG + Intergenic
1091187239 11:133657827-133657849 TAAAGTATTAAAATTGATATTGG - Intergenic
1092559125 12:9591345-9591367 AAAAATTCTAAAAGTAATTTTGG - Intergenic
1092945069 12:13445833-13445855 AAAAATTCTAAAATTCATATGGG - Intergenic
1094245193 12:28283202-28283224 AAAAATCCTAAAATTCATATGGG - Intronic
1094665441 12:32515750-32515772 ATAAGTGATAAAAGAGACATGGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096861947 12:54535642-54535664 AAAAGTGTTAAGTGTGAGATGGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097487688 12:60226326-60226348 AAAAATGCTCAAAGAGATAAAGG + Intergenic
1098574201 12:72022639-72022661 ACAAGTGCGAAAAGTGAGGTCGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099514641 12:83582808-83582830 AAAAGTGTTGAAAGTGCTAATGG - Intergenic
1099539372 12:83886916-83886938 AAACGTGCCAAAAGTGATAAAGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099672637 12:85714708-85714730 AAATGTGGTAAAAGAAATATCGG - Intergenic
1100053053 12:90473949-90473971 AAAATTTGTAAAAATGATATTGG + Intergenic
1100368000 12:93939161-93939183 AAATGTGCTCTAAGGGATATGGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101472091 12:105007450-105007472 TAAAGTGCTACTAGTGATGTTGG - Intronic
1101744975 12:107532625-107532647 AAAAGTCCTGTGAGTGATATAGG + Intronic
1105229714 13:18480800-18480822 AAAACAACTAAAAGTGATATAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105856040 13:24372964-24372986 AAAAGTGCTCAAAGAAATAATGG + Intergenic
1106466546 13:30019061-30019083 AAAAAAGATAAAAGTGCTATGGG + Intergenic
1107066894 13:36223934-36223956 AATAGTACTAAAATTGATATAGG + Intronic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1108763229 13:53595451-53595473 GAAATTGCTCAAAGTGATACAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109619419 13:64881815-64881837 AAATGTTCTAAAAGTGATTGTGG - Intergenic
1109982656 13:69928812-69928834 AAATGTTCTACAAGTGATAGTGG + Intronic
1110125870 13:71941643-71941665 AAAAGTGACAAAAATGATATTGG + Intergenic
1110272923 13:73611108-73611130 AAAAGTGCTAAACCAGACATGGG + Intergenic
1110346816 13:74458217-74458239 AAATGTTCTAAAATTGATTTTGG + Intergenic
1110720706 13:78758495-78758517 AAAAATGATAAAACTGAGATAGG + Intergenic
1111072964 13:83193719-83193741 GAAAGTGGTAAAAGTGACAGTGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111404467 13:87784832-87784854 AAAAGTATTAAAAATCATATAGG + Intergenic
1112740389 13:102466587-102466609 CAATGTGATAAAAGTGAAATTGG + Intergenic
1112770311 13:102788116-102788138 AAAAGTTTGAAAAGTCATATTGG + Intronic
1113104338 13:106757089-106757111 AAAAGTTTTAAAAATGAGATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114435728 14:22706213-22706235 AAAGGTGCTAACAGTGGTAGTGG - Intergenic
1116119140 14:40699618-40699640 AGAAATACTAACAGTGATATCGG + Intergenic
1116326956 14:43541675-43541697 AAAACTGCTTAAAGACATATGGG - Intergenic
1116478717 14:45371678-45371700 AAAAGTGCTAAAACTTAAAAAGG - Intergenic
1116804743 14:49482015-49482037 GAAAGAGCTAAAAGTTTTATGGG - Intergenic
1116956591 14:50929806-50929828 AAAAGTTATAAAAATGAAATAGG - Intronic
1117706332 14:58473532-58473554 ATAAGAGCAAAAAGTGATTTTGG + Intronic
1119108231 14:71944691-71944713 AAAGGTGCAAAAAGGGATAATGG + Intronic
1120504730 14:85341063-85341085 AAAAGTGCAAAAAGTATAATTGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121765447 14:96481688-96481710 AAAAAAGGTAAAAGTCATATCGG - Intronic
1122435993 14:101699583-101699605 AAAAATCCTAAAATTTATATGGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123957012 15:25347197-25347219 ATAAGTTCTATAAGTCATATTGG + Intronic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124637720 15:31375575-31375597 AAAAGGCCTAAAATTGATCTGGG + Exonic
1126168721 15:45676120-45676142 AGAAGTGTTGAAAATGATATTGG - Exonic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128410593 15:67393045-67393067 AAAAGTTCTGAAATTGATAGTGG - Intronic
1130200094 15:81817629-81817651 AAAAGTGAGAAAAGTGATTTAGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1130937353 15:88481707-88481729 AAAAGAGGCACAAGTGATATTGG + Intergenic
1131090053 15:89617282-89617304 TAAATTGCGAAAAGTGAAATTGG + Intronic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131715939 15:95110974-95110996 AAAAGGACTAAAAATGAAATGGG + Intergenic
1133012376 16:2921258-2921280 AAAAGTCCTAAAATTGATGGTGG - Intronic
1133012380 16:2921333-2921355 AAAAGTCCTAAAATTGATGGTGG - Intronic
1133771870 16:8871302-8871324 AAATGTGCTGAAAGTGATGGTGG + Intergenic
1136991745 16:35156268-35156290 AATTCTGCGAAAAGTGATATTGG + Intergenic
1137876672 16:52003369-52003391 AAGAGTAATAAAGGTGATATTGG + Intergenic
1137939165 16:52665952-52665974 AAAAATGCTTAATGTGATATTGG - Intergenic
1138079411 16:54074811-54074833 AAAAGTGCAACAAGTTATATAGG + Intronic
1139519605 16:67473337-67473359 AAAAGTCCTAAAACTGATTGTGG - Intronic
1140848392 16:78911443-78911465 TAAAGTGCTAGAAATGATAATGG + Intronic
1142537079 17:625742-625764 AAAAGTGTTTTAAGGGATATTGG - Intronic
1147294314 17:39469373-39469395 AAACGTTCTAAAAGTTATTTTGG + Intronic
1153152142 18:2107612-2107634 AAAAGAGATAATAGTGATAAAGG - Intergenic
1153322102 18:3783675-3783697 AAATGTTCTAAAATTGATAGTGG + Intronic
1153558041 18:6337871-6337893 AAAAATCTTAAAAGTAATATGGG + Intronic
1154523688 18:15259040-15259062 AAAACAACTAAAAGTGATATAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157407542 18:47435583-47435605 AAATGTGCACAAAGTGTTATGGG + Intergenic
1157723082 18:49940669-49940691 AAAAGGCCTAGAAGTGATATGGG - Intronic
1157845003 18:50995122-50995144 AAATGTTCTAAAATTGATAGTGG - Intronic
1158176442 18:54662401-54662423 AAAATTCCTAAAAGTGTAATTGG - Intergenic
1158527607 18:58229134-58229156 AAAAGTTCTAAAAGGTAAATAGG - Intronic
1158749933 18:60246964-60246986 AAAATTGTTAAAAGTGATGCTGG + Intergenic
1159081985 18:63745354-63745376 AAAAGGGCTCAGAGAGATATGGG + Intergenic
1159212932 18:65351412-65351434 ATAAGTTCTAAAAGTGAAAATGG + Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1160339607 18:78078072-78078094 AGAATTGTTAAAAGTAATATTGG + Intergenic
1162231308 19:9269283-9269305 AAAAGTGGTTAAAATGGTATTGG - Intergenic
1162610843 19:11750048-11750070 AAAAATTCTAAAATTTATATGGG - Intergenic
1166625516 19:44350090-44350112 AGAAGTGTTAAAATTGATAGTGG + Intronic
1166994148 19:46711372-46711394 AAAAGTGCTTAAAATGTTGTGGG + Intronic
1167784573 19:51626728-51626750 AAATGTTCTAAAATTGATTTTGG + Intronic
926402107 2:12507826-12507848 AAAAGTGAAAAAAGGAATATAGG - Intergenic
926984050 2:18601853-18601875 AAAAGTGCTGAAAGAAACATGGG - Intergenic
928304143 2:30152425-30152447 AAAACTTCCAAAAGTGATTTAGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929617844 2:43326411-43326433 ACAAGTGCTAAAAGGGACAATGG + Intronic
929988726 2:46765393-46765415 AAAAATACTAAAAATGAAATGGG + Intergenic
930212450 2:48655035-48655057 AAAATTGCTAAGACTGATTTGGG + Intronic
930626476 2:53704024-53704046 ATAACTGGTAAAAGTGATATAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931584455 2:63810371-63810393 AAAAGTTATAAAAGTGTTATAGG + Intronic
935231156 2:101097679-101097701 AAAAATGTAAAAAGTGAGATGGG - Intronic
935297895 2:101666346-101666368 AAATGGGCTAGAAGTGATAGAGG - Intergenic
935870246 2:107440220-107440242 AAAATTGCTATAAGTACTATAGG - Intergenic
936254169 2:110895497-110895519 AAAAGTGCTCAAAGAAATAATGG + Intronic
936803080 2:116289885-116289907 AAAAATTCTAAAATTAATATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938003380 2:127765970-127765992 AAAAGTGCAAAAAAAGTTATTGG - Intronic
938404440 2:131021815-131021837 AAAAGTCCTCAATGTGATAAAGG - Intronic
938522994 2:132091896-132091918 AAAACAACTAAAAGTGATATAGG - Intergenic
938918918 2:135974278-135974300 AAAAGTGCTGCAAGTGTTCTGGG + Intronic
939517986 2:143192979-143193001 ACAAGTGCTAACACTGAAATGGG - Intronic
939539997 2:143482207-143482229 AATAGAGCCAAAAGAGATATGGG - Intronic
939666591 2:144960308-144960330 AAAAGTACGAAATATGATATAGG + Intergenic
939768627 2:146287049-146287071 AAAAGTGCTCAAAGAATTATGGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941483096 2:166042761-166042783 AAAAGTCCTACAAGTGATCAAGG + Intronic
941522637 2:166566406-166566428 AAAATTTTTAAAAGTGGTATTGG + Intergenic
942778641 2:179614410-179614432 CAAACTGCTAAAAGTCATCTAGG - Intronic
942967577 2:181915558-181915580 GCAAGTGCTGAAAGTGATGTGGG + Exonic
943709179 2:191071301-191071323 TAAAATGCTACAAGTGGTATTGG - Intronic
944156650 2:196614002-196614024 AAATGTGCTAAAATTGATTGTGG - Intergenic
944333105 2:198495609-198495631 AAAAGTACTCAAACTCATATTGG - Intronic
944611667 2:201415257-201415279 AAAAGTGTTAAAATTTATTTTGG - Intronic
945461570 2:210115962-210115984 ATAAGAGCTAAAAGTCAGATTGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945549902 2:211208570-211208592 AAGAGCTCTATAAGTGATATAGG - Intergenic
945769474 2:214022787-214022809 AAAAGAAATAAAAGTGAAATAGG - Intronic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948330939 2:237164708-237164730 AAAATTGTTGAAAGTGAGATTGG + Intergenic
1168734754 20:122961-122983 AAAAGTGTTCAAACTGAAATTGG - Intergenic
1170189900 20:13635047-13635069 AAAAGTTCTAAAATTGAATTTGG + Intronic
1170498716 20:16952236-16952258 AAAAGTTCTAGAGGTGATTTCGG + Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1171334288 20:24369826-24369848 AAAAGTGAGAAGAGTGATGTTGG + Intergenic
1173718015 20:45227921-45227943 AAAAGTGGTGAAAGAAATATCGG - Intergenic
1174782209 20:53400264-53400286 AAAAGCCCTCAAAGTGATAAAGG - Intronic
1176773704 21:13109159-13109181 AAAACAACTAAAAGTGATATAGG + Intergenic
1176918222 21:14652185-14652207 AAAAATCCTAAAATTTATATGGG + Intronic
1177329192 21:19634262-19634284 AAAAATCCTAAAACTCATATAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178042869 21:28659876-28659898 AAAAGTGCTAGAATTTTTATTGG + Intergenic
1179040573 21:37798807-37798829 AAAGGTTCTAAAATTGATCTCGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181277915 22:21698229-21698251 AAAAGTGATAAAAGTGTTGTTGG + Exonic
1181581329 22:23829766-23829788 AAAAGTCCTAAAATTGACAGTGG - Intronic
1182388205 22:29965123-29965145 AATTGTGCTAAATGTGATAAAGG - Intronic
1183150216 22:36031063-36031085 AAAAGTGAATAAAGTGATAATGG - Intergenic
949492508 3:4603115-4603137 ACAAGTGAAAAAAGTGATAAAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951049037 3:18073705-18073727 AAAAAACCTAAAAGTCATATAGG - Intronic
951648698 3:24923854-24923876 AAAAGTACTAACAGTGAATTTGG + Intergenic
951679750 3:25282423-25282445 AAAAGTGTTAGAAGTGAGAGTGG - Intronic
951683766 3:25322324-25322346 CAAAGTTCTAAAAGAAATATGGG + Intronic
951733905 3:25841906-25841928 AATAGTGCTTAAATTCATATAGG + Intergenic
951918413 3:27826426-27826448 AAAAGTGCTTAAAATGATGATGG + Intergenic
952571231 3:34719998-34720020 AAAAAGGCTAAAAGTTATTTGGG + Intergenic
953048258 3:39315326-39315348 AAAAGAGCAAAAAGTGCTATTGG + Intergenic
953915389 3:46916735-46916757 AAATGTTCTAAAAGTGATTGTGG - Intergenic
954009263 3:47620594-47620616 AAAAGGGCCAAAAGTGAGAGTGG - Intronic
955035149 3:55260527-55260549 AAAAATGCGAAAAGAGAGATGGG + Intergenic
955895715 3:63697541-63697563 AAAAATGATAAAGGGGATATCGG + Intergenic
956226538 3:66965287-66965309 AAAGGTGTTGAAAGTGCTATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958588754 3:96125618-96125640 AAAAATTCTAAAATTCATATGGG + Intergenic
959009108 3:101053879-101053901 AAAAGACCTAGAAGTGATGTAGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959265499 3:104132115-104132137 TAAAGTGATAAGAGTTATATAGG + Intergenic
959633603 3:108536547-108536569 AAAGGTGCTAACATTGATAATGG + Intergenic
961682137 3:128606639-128606661 AAAAATTGTAAAAGTGGTATGGG - Intergenic
962940904 3:140124076-140124098 ATAAGTGCTAAAAGTAATGTAGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963564035 3:146905070-146905092 TAAAGGACTAAAAGTGATTTTGG - Intergenic
964056403 3:152465474-152465496 AAAAATGCAAAATGTGATAATGG + Exonic
964566725 3:158064040-158064062 AAAATCACTAAAAGTGATTTGGG + Intergenic
965052962 3:163675099-163675121 AAAAGTTTCAAAAATGATATAGG - Intergenic
965369081 3:167838624-167838646 AATAGTGGTACAAGTGATCTTGG - Intergenic
965740149 3:171865732-171865754 TAAAGTGGTTAAAGTGATCTGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967967061 3:194969995-194970017 AAATGTTCTAAAATTGATGTTGG - Intergenic
969090004 4:4686601-4686623 AATAGTGATAAAGCTGATATAGG + Intergenic
969142752 4:5093866-5093888 CAAAGTGCTAAGAGTGATGCTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969306089 4:6327074-6327096 AACAGTGCTCAAAGTGAACTGGG + Intronic
970025610 4:11621157-11621179 AAAAGTCCAACAAGTGAGATTGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970764245 4:19528122-19528144 AATAGTTCTAAAATTTATATGGG + Intergenic
972045515 4:34660923-34660945 AAAAGTGCTACAAGAAACATGGG + Intergenic
972364196 4:38358475-38358497 AAAAGTACAAAAAGTGATCAAGG - Intergenic
972939114 4:44175850-44175872 GAAAGTGCTATAAGATATATAGG + Intronic
973320581 4:48806395-48806417 AAAAATCATAAAAGTGATTTTGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974082549 4:57227729-57227751 GAAGGTGATTAAAGTGATATTGG + Intergenic
974585392 4:63868464-63868486 AAAACAGGTAAAACTGATATAGG - Intergenic
974759244 4:66254117-66254139 AAAAATGATAAAAGTAAAATTGG - Intergenic
974998242 4:69190335-69190357 AAAAATCCTAAATTTGATATGGG - Intronic
975339758 4:73226134-73226156 AAAAATACTAAAAGTTAGATGGG - Intronic
975409646 4:74035384-74035406 AAAGGAGACAAAAGTGATATGGG - Intergenic
975831045 4:78369125-78369147 AAAAGTTCTGAGAGTTATATCGG + Intronic
976979020 4:91202035-91202057 AAAAGTGCTAAAAGTGATATTGG - Intronic
977170513 4:93756263-93756285 AAAAGTGCTAAAAGGGAAAGTGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978036974 4:104007442-104007464 AAGAGTCCTAAAATTCATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979740381 4:124142789-124142811 AAGCATGCTAATAGTGATATAGG + Intergenic
980162833 4:129186457-129186479 AAAAGCCCTAAAATTTATATGGG - Intergenic
980754104 4:137135084-137135106 AAAAGAGCTAAATGTTAAATTGG - Intergenic
980942757 4:139290299-139290321 AAAAGAGGTAAAAATGAAATAGG - Intronic
981461976 4:145023688-145023710 AAAAGTGCTAACAATCATCTGGG + Intronic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981545860 4:145892501-145892523 AAAAGCACTAAAAATGATTTGGG + Intronic
981730445 4:147891514-147891536 AAATGTTCTAAAATTGATTTTGG + Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982246307 4:153355411-153355433 AAAAATACTAAGAGTGAAATTGG + Intronic
983428920 4:167622588-167622610 CAAACTGGTAAATGTGATATTGG - Intergenic
983607115 4:169600083-169600105 GAAAATGTTAAAAGTGATATTGG - Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983818420 4:172161953-172161975 ATAAGTGGTAAAAGTGAAGTGGG + Intronic
983842775 4:172478162-172478184 AAAAATCCTAAAATTTATATGGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
986181496 5:5397182-5397204 AAAATTGAGAAAAGAGATATAGG + Intergenic
986594574 5:9407951-9407973 AATAGTGGTAAAAGTCATAGTGG - Intronic
987163073 5:15165278-15165300 AAATGTGAGAAAAGTGTTATTGG + Intergenic
988262044 5:28899551-28899573 AAAACTGCTCAAAGTGCTAAAGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988703481 5:33699616-33699638 AAAAGCTCTAAAATTGATTTTGG + Intronic
989501003 5:42167748-42167770 AAAAGTTTTAAAAATGATAAAGG - Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991203829 5:64025915-64025937 AAAAGTTCTAAAATTGATTGTGG + Intergenic
992272219 5:75076778-75076800 CCAAGTGATAAGAGTGATATAGG - Intronic
992368988 5:76123020-76123042 AAAAATGATAAAGGGGATATGGG + Intronic
992567600 5:78014502-78014524 AAAAATGCTACAGGTGATTTGGG - Intronic
992603246 5:78426656-78426678 AAAAGTTCTAAAACTGATTGTGG - Intronic
993567853 5:89497428-89497450 AAAATTGCTAAAAGATAGATTGG + Intergenic
993683765 5:90912619-90912641 CAATGTGGTATAAGTGATATTGG + Intronic
993722058 5:91331284-91331306 AAAAACTCTAAAAGTGAAATAGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995050055 5:107693153-107693175 AAAAATCCTAAAATTTATATGGG + Intergenic
995653046 5:114392935-114392957 AAATGTCCTAAAAATGATATTGG + Intronic
995971520 5:117976786-117976808 AAAAACACTAAAATTGATATGGG - Intergenic
996337595 5:122401702-122401724 CAAAGTGCCACAAGTGATTTAGG + Intronic
996644417 5:125796752-125796774 AAAAGGGGAACAAGTGATATAGG - Intergenic
998550312 5:143070963-143070985 AAAAGTCCTAAAACTTATATGGG + Intronic
1000509362 5:162163291-162163313 ATAAGTGCTCAAAGTGTTACTGG - Intergenic
1000521141 5:162296113-162296135 AGAATTGCTAAAAGTTAGATAGG - Intergenic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1001552528 5:172614072-172614094 AACAGTTCTAAAATTCATATGGG + Intergenic
1002886630 6:1302463-1302485 AAAAATGCTAAAATTCATATGGG + Intergenic
1003541422 6:7021446-7021468 AAATGTTCTAAAAGTGATTGTGG + Intergenic
1004112005 6:12727813-12727835 AAAAATATTAAAAATGATATTGG - Intronic
1004304263 6:14486403-14486425 AACAGGGCTAAAAGGGATTTTGG - Intergenic
1006721124 6:36152259-36152281 ATAAGTAATAATAGTGATATGGG + Intergenic
1006870549 6:37247330-37247352 GAAAGAGGTAGAAGTGATATAGG + Intronic
1007560215 6:42801535-42801557 AAAAGTGGAAAAAATCATATTGG + Intronic
1007792018 6:44315227-44315249 AAATGTTCTAAAAGTGATTGTGG - Intronic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008193422 6:48488108-48488130 AAATCTGCTAAAAGTTATATTGG - Intergenic
1009540291 6:64946049-64946071 AAATGTGGTAAAAGTCATTTGGG - Intronic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012189546 6:96262313-96262335 AAAAATCCTAAAATTTATATGGG + Intergenic
1012199697 6:96390676-96390698 AAAACTGCTAAAATGGATAATGG - Intergenic
1012411111 6:98958269-98958291 AAAAGTAATAAAAGTCCTATAGG + Intergenic
1012604016 6:101134170-101134192 TAAAGTGTTAAAAGTGATGGTGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013096185 6:106947180-106947202 AACAATGGTAAGAGTGATATTGG + Intergenic
1013994609 6:116293892-116293914 AAAAGAGCTAGAAGTGACCTTGG + Intronic
1014152098 6:118068976-118068998 ATATGTGCCAAAAGTCATATAGG + Intronic
1014496850 6:122135502-122135524 AAAAGTGTCTAAAGTGATTTTGG - Intergenic
1015105192 6:129528293-129528315 AAAAGTTAGAAAAGTAATATAGG - Intergenic
1015709273 6:136121584-136121606 ATAAGTGCTAAAAGAAATAAAGG + Intronic
1015965958 6:138695011-138695033 AAATGTTCTAAAAGTGATTATGG - Intergenic
1016348866 6:143145915-143145937 GAATGTACTAAAAATGATATTGG - Intronic
1016554485 6:145320563-145320585 AAAAGTACTTAAAGAAATATGGG - Intergenic
1017086316 6:150716363-150716385 AAAGGTGCTAGAAGTGAGAAGGG - Intronic
1017544123 6:155432990-155433012 AAATGGGCTAAAAGAGATACTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020538555 7:9431608-9431630 AAAAGTTCTAAAATTCCTATTGG + Intergenic
1020659752 7:10967669-10967691 AAAATTTCTAAATGTGACATGGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022686152 7:32598779-32598801 ACAAGTTCTTAAAGTGTTATTGG + Intergenic
1022774366 7:33509995-33510017 AAAAGTGCTCAAAGTTATATGGG + Intronic
1022875940 7:34529811-34529833 TAAAGTCCTAAAAGTGTAATTGG - Intergenic
1023392723 7:39725751-39725773 AAAAGTCCTAAAATTGATTGTGG + Intergenic
1024157894 7:46644755-46644777 AAAAGTGCTCAAAGAAATAATGG - Intergenic
1024310181 7:47961944-47961966 AAATGTTCTAAAATTGATAGTGG + Intronic
1026057779 7:66999695-66999717 AATAGTGCTAAAAGTGTTAAAGG + Intronic
1026720326 7:72825333-72825355 AATAGTGCTAAAAGTGTTAAAGG - Intronic
1027502560 7:78971485-78971507 AAAGGTGCTAAATGAAATATAGG + Intronic
1027745955 7:82074213-82074235 AAAAGTAATAAAAGTGATGTGGG - Intronic
1028318137 7:89429779-89429801 AAAAGGGTTAAAAGTAATTTAGG + Intergenic
1028700086 7:93767439-93767461 AAAAGTTGTAAAGGTGACATGGG + Intronic
1029209686 7:98896708-98896730 AAAAGTTTTTAAATTGATATAGG + Intronic
1030405244 7:109102214-109102236 AAAAATCCTAAATCTGATATTGG - Intergenic
1030796534 7:113795085-113795107 AAAAATGTTAAAAGTGGTTTTGG + Intergenic
1031146960 7:118007155-118007177 AAATGTGTTAAAGGTGATACTGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032318752 7:130865721-130865743 AGATGTGCTAGAAGTGATATGGG + Intergenic
1032936055 7:136732963-136732985 AAAAATGCTAAAATTCATATAGG + Intergenic
1033568604 7:142604672-142604694 ATAAGTAATAAAAGTGAAATAGG + Intergenic
1034119431 7:148613715-148613737 AAAAGTTCTAAAATTGACAGTGG + Intronic
1035100440 7:156391860-156391882 AACAGTGATAAAAGTAAAATGGG + Intergenic
1037350955 8:17954903-17954925 AAAAGTGTTAAAAGTGACTGTGG - Intronic
1039013506 8:33121828-33121850 AACAGTGATGAAAATGATATTGG - Intergenic
1042631118 8:70817620-70817642 AAAAATTCTAAAATTCATATGGG + Intergenic
1043276631 8:78404576-78404598 AAAAGTGGTAAAAGTTGTTTGGG - Intergenic
1043912127 8:85875380-85875402 AGCTGTGCTAAAAGTGAAATAGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044717025 8:95109666-95109688 AGAAGAGGTCAAAGTGATATGGG - Intronic
1044880386 8:96717562-96717584 AAAAATCCTAAAATTTATATGGG - Intronic
1045439587 8:102196469-102196491 GAAATTGTTAAAGGTGATATAGG + Intergenic
1045523862 8:102926936-102926958 AAAAGTACTAAAAAAGAGATGGG - Intronic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050786655 9:9412116-9412138 AAAAGTGCTATATATGATTTGGG - Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1051992485 9:23169111-23169133 AGAATTGCTAAAAGTAACATTGG + Intergenic
1051995108 9:23205933-23205955 AAAAGTGATAAGATCGATATTGG + Intergenic
1052355588 9:27501779-27501801 AAAAGTGCTATTTGTGAGATAGG + Intronic
1052445135 9:28552081-28552103 AAAAGTGATATATGGGATATGGG - Intronic
1052778589 9:32757496-32757518 AAAAATGCCAAAAATCATATTGG - Intergenic
1055041849 9:71882789-71882811 AAATGTTCTAAAATTGATTTGGG + Intronic
1055199007 9:73634240-73634262 AAAAGACCTTAAAATGATATTGG + Intergenic
1055758911 9:79585582-79585604 AAAAGAGCTAAAAGAGATCTGGG - Intronic
1056732286 9:89177306-89177328 AAATGTGCTAAAAGGGAACTAGG - Intronic
1057095796 9:92308030-92308052 AAAAAGGCTCAAGGTGATATAGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058030846 9:100195894-100195916 AACAGTGTTAAAAGGAATATTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1187183918 X:16966832-16966854 AAATGTTCTAAAAGTAGTATTGG - Intronic
1187284251 X:17887847-17887869 AAAAGTGCTCAAAGAAATAATGG + Intergenic
1187702305 X:21974450-21974472 AAATGTCCAAAAAGTGGTATGGG - Intronic
1188064580 X:25642935-25642957 AAAAATCCTAAAATTTATATGGG - Intergenic
1188206918 X:27371737-27371759 TAAAGTGCTAGAAGAGAGATAGG + Intergenic
1188503549 X:30855572-30855594 AAAAATGGTAAAAGTAACATTGG + Intronic
1189827682 X:44936393-44936415 AAAACTGTTAAAAAAGATATTGG - Intronic
1190772018 X:53522959-53522981 AAAAGTGCCAATAGTGATGCTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191673182 X:63768154-63768176 CAAAGTGGTATAATTGATATTGG - Intronic
1191830496 X:65409955-65409977 AAAAATGCTAAAATTTATATAGG + Intronic
1192388419 X:70698185-70698207 AAAACAACTAAAAGTGAAATTGG - Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193313003 X:80029923-80029945 AGTAGTGCTAAAAGTAATAGTGG + Intronic
1193744579 X:85260542-85260564 AAAAGTTCTAAAATTGATTGTGG - Intronic
1194063142 X:89229209-89229231 AAAAATCCTAAAACTTATATGGG + Intergenic
1194307631 X:92268164-92268186 AATAGTCCAAAAAGTAATATAGG - Intronic
1194426934 X:93750260-93750282 ATAACTTCTAAAACTGATATTGG - Intergenic
1194551293 X:95303215-95303237 AAATATACTAAAAGTGAAATAGG + Intergenic
1194924171 X:99804755-99804777 AAAAGTGCTAAAAGTGACAGAGG + Intergenic
1195059399 X:101179102-101179124 AAAAGTTCTGAAACTAATATTGG - Intergenic
1195620204 X:106945368-106945390 AAGAGTGCTTGAAGTGCTATAGG - Intronic
1196281435 X:113828081-113828103 AAATGTTCTAAAATTGATTTTGG + Intergenic
1196916041 X:120535983-120536005 AAAAATGGTAAATGTGGTATTGG - Intronic
1197042208 X:121950677-121950699 AAAAATTCTAAAATTTATATGGG + Intergenic
1197429840 X:126348048-126348070 AAAAGTCCTAAAATTTATATAGG + Intergenic
1197740336 X:129887053-129887075 AAATGTTCTAAAATTGATTTTGG + Intergenic
1198000953 X:132434999-132435021 AAAAGTTACAAAAGTGATACAGG - Intronic
1198495561 X:137188816-137188838 AAAAGGGCTATAAATGCTATTGG + Intergenic
1199116143 X:143995493-143995515 AAAAATTCTAAAATTCATATGGG + Intergenic
1199417148 X:147598564-147598586 AAAATTGTTAAAAGTTATGTAGG - Intergenic
1199659420 X:150033277-150033299 AAAAGTGCTTACTGAGATATTGG + Intergenic
1199986022 X:152951546-152951568 TAAACTGCTAAAAGTAATAATGG - Intronic
1200717321 Y:6563314-6563336 AAAAATCCTAAAACTTATATGGG + Intergenic
1201334412 Y:12864721-12864743 AACAGTCCTAGAAGTCATATTGG - Intergenic
1201384736 Y:13426615-13426637 AAATTTGCTTAAAGTTATATTGG - Intronic