ID: 976979681

View in Genome Browser
Species Human (GRCh38)
Location 4:91211853-91211875
Sequence AGTTTGTTAGAGATCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976979681_976979683 11 Left 976979681 4:91211853-91211875 CCTCCAAAGATCTCTAACAAACT 0: 1
1: 0
2: 0
3: 13
4: 204
Right 976979683 4:91211887-91211909 TATTAGTTTAAAAAAATTTGTGG 0: 1
1: 0
2: 10
3: 140
4: 1413
976979681_976979684 22 Left 976979681 4:91211853-91211875 CCTCCAAAGATCTCTAACAAACT 0: 1
1: 0
2: 0
3: 13
4: 204
Right 976979684 4:91211898-91211920 AAAAATTTGTGGAAGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976979681 Original CRISPR AGTTTGTTAGAGATCTTTGG AGG (reversed) Intronic
900500076 1:3000030-3000052 AGTTTGTAAGAGAACTTTCTGGG + Intergenic
902306641 1:15545369-15545391 AGTTTGTCAGAGAATATTGGAGG + Intronic
903189635 1:21649575-21649597 ACTTTTTTAGAGAGCCTTGGAGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
906813845 1:48857220-48857242 AAATTGTTATAGATATTTGGTGG - Intronic
907003525 1:50887241-50887263 AATTTGTTTGAGTTCTTTGTAGG + Intronic
907254243 1:53166382-53166404 AGTTTGTAAGTGTTGTTTGGTGG + Intergenic
909401760 1:75240683-75240705 AGTATGTAAGACATGTTTGGTGG + Intronic
911318008 1:96377705-96377727 AGTTTGGAAAACATCTTTGGGGG + Intergenic
911605652 1:99901744-99901766 AGTTTGTTATATATGATTGGGGG + Intronic
912271802 1:108218350-108218372 AATTTGTGAAAGATGTTTGGTGG - Intergenic
913183043 1:116341290-116341312 AGCCTGTTGGAGACCTTTGGAGG - Intergenic
915862516 1:159461210-159461232 ATTTTGGTATAGATTTTTGGTGG + Intergenic
916837882 1:168567289-168567311 AATTTTTTTGAGATTTTTGGTGG + Intergenic
918461362 1:184780225-184780247 AGCATGTTAGAGAATTTTGGGGG - Intergenic
918857348 1:189774986-189775008 ATATTTTTAGAGATTTTTGGAGG + Intergenic
919433415 1:197526254-197526276 AGTTTGTCAGAGATCAATGCTGG - Intronic
921063368 1:211605510-211605532 AGCATGTGAGACATCTTTGGAGG - Intergenic
923458886 1:234189628-234189650 AGTTTGGAAGACATATTTGGGGG + Intronic
923856038 1:237846672-237846694 AGGTGGTTAGAGTTCTATGGGGG + Intergenic
1066256372 10:33683046-33683068 ATTTTTTTAGAGATCTATGAAGG + Intergenic
1066669208 10:37818938-37818960 ATTTTATTTGAGATCTTTGGTGG + Intronic
1067679896 10:48427083-48427105 TGCTTGTCAGGGATCTTTGGTGG - Exonic
1068101358 10:52558239-52558261 AGTATGTTAGAGCTGTTTGGTGG + Intergenic
1068182819 10:53544884-53544906 AGTTTGTTAAAAAGCTTTAGAGG + Intergenic
1069298894 10:66882166-66882188 AGGTTCTTAGGGGTCTTTGGTGG + Intronic
1071665294 10:87549646-87549668 AGTTTATTAGAGTTCTTCTGTGG + Intronic
1071846045 10:89522244-89522266 AGGGTGTTGGAGATGTTTGGAGG - Intronic
1074457564 10:113608789-113608811 GGTTTGTTCCAGATCTTTGCTGG + Intronic
1074878612 10:117633906-117633928 AGTCTTGTAGAGACCTTTGGTGG + Intergenic
1076201652 10:128563727-128563749 TGTTTGACAGAGATCTTTCGAGG + Intergenic
1079827277 11:25212952-25212974 TTTTTGTTAGAGATCTTTGCTGG + Intergenic
1080332851 11:31160440-31160462 ATTGTGTAAGAGTTCTTTGGAGG + Intronic
1080568178 11:33531538-33531560 AGTTTGTTGGTAATCTTTTGTGG - Intergenic
1081499715 11:43654260-43654282 AATTTGTTTGAGTTCTTTGTAGG + Intronic
1082120722 11:48377326-48377348 AGTTTGAAAAAGATATTTGGGGG - Intergenic
1082298891 11:50480212-50480234 AGTTTCTCAGAAATCTTTGCAGG + Intergenic
1083062018 11:59883508-59883530 AGGTTTTTAGATTTCTTTGGAGG - Intergenic
1083500464 11:63102546-63102568 TGTTTTTGAGAAATCTTTGGTGG + Intronic
1084915187 11:72423583-72423605 AGATTGGTAGAGATCTGTGTTGG - Intronic
1086222545 11:84466343-84466365 AGTTTGTTATTCATCTTTAGGGG - Intronic
1087695874 11:101375304-101375326 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1092943146 12:13429088-13429110 ACTATGATAGAGATCTTTGTGGG - Intergenic
1093650516 12:21639024-21639046 TGTTTCTTGGAGACCTTTGGAGG + Intronic
1093760295 12:22902403-22902425 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1097219627 12:57440744-57440766 ACTTTGTTAGATATCTTTCCTGG + Intronic
1099346540 12:81507573-81507595 AGTTTGTTAGAAAAGTTTGTTGG + Intronic
1099823983 12:87751319-87751341 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1101643723 12:106608260-106608282 AGTCTGTGAGAGCTCTTTGAGGG + Intronic
1102125091 12:110473870-110473892 AATTAGTGAGAGACCTTTGGGGG - Intronic
1105659441 13:22477455-22477477 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1106554893 13:30800941-30800963 AATTTATTAGAGAACTTAGGTGG - Intergenic
1108017494 13:46091183-46091205 ATTTTGGTATAGATATTTGGGGG + Intronic
1108551153 13:51546183-51546205 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1110996464 13:82115822-82115844 ATTTTCTAGGAGATCTTTGGTGG + Intergenic
1111436832 13:88221948-88221970 AGGTTGTTTAAGATCCTTGGAGG - Intergenic
1112231124 13:97590143-97590165 GGTTTGTTACTGGTCTTTGGTGG - Intergenic
1117760714 14:59025481-59025503 AGAGTCTTAAAGATCTTTGGAGG + Intergenic
1118039347 14:61900528-61900550 AGGATGTAAGGGATCTTTGGTGG + Intergenic
1119352686 14:73979171-73979193 AGTTGATCAGAGATCTTAGGGGG - Intronic
1120586459 14:86317492-86317514 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1121204135 14:92147565-92147587 ACTTTGTTAAAGATTATTGGTGG + Intronic
1121543192 14:94743857-94743879 AGTTTGATAAAGAGCTTAGGAGG - Intergenic
1123164442 14:106313225-106313247 AAATTGTTAGAAATATTTGGTGG - Intergenic
1126597005 15:50392987-50393009 AGTTTATTAAAAATCTTTAGAGG - Intergenic
1128475287 15:67992039-67992061 AGATTGATAGACATCTGTGGAGG + Intergenic
1133636854 16:7674911-7674933 ATGTTGCTAGACATCTTTGGTGG + Intronic
1135463792 16:22668005-22668027 TGTTTTTTAGAGATCTTTTTAGG + Intergenic
1135600341 16:23777727-23777749 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1136018832 16:27426827-27426849 ACTGTGTCAGGGATCTTTGGTGG + Intronic
1137715882 16:50598080-50598102 AGTTTCTTAGAGCTATTTTGGGG + Intronic
1140060593 16:71566041-71566063 TTCTGGTTAGAGATCTTTGGGGG + Exonic
1140625186 16:76785031-76785053 AGTTTCCTAGAGATGTTTGGAGG + Intergenic
1145194777 17:20882302-20882324 AATTTGTTTGAGTTCTTTGTAGG - Intronic
1146580919 17:34037955-34037977 ACTTTATTTGAGATCTTTGGTGG + Intronic
1146733022 17:35212163-35212185 AGTGTGTTGGAAATCTTTGTAGG + Intergenic
1146802359 17:35836565-35836587 AAGTTGTTAGAGCTCTTGGGAGG + Intronic
1149726719 17:58902309-58902331 AGTTTGTTATAGATCTTCGTGGG + Intronic
1149781478 17:59399881-59399903 AGTTTGTTGGTGAAGTTTGGGGG + Exonic
1150121400 17:62606167-62606189 ACTTTATTTGAGATCTTTGGTGG - Exonic
1150241011 17:63632614-63632636 AGTTTGTGAAAGAGCTTTGCTGG + Intronic
1151766579 17:76136192-76136214 AGTTGGTTAGTGCTCTTTGCAGG + Intergenic
1154184241 18:12167999-12168021 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1154399411 18:14021512-14021534 AGTTTGTCAAAGAGCTCTGGGGG + Intergenic
1156160600 18:34353690-34353712 AGTTCTTTAGGGAACTTTGGTGG + Intergenic
1158140970 18:54255264-54255286 TGTTTATTAGAGAACTTTGAGGG + Intergenic
1159969198 18:74628025-74628047 AGTTTGTTAGCCAGCTGTGGTGG - Intronic
1160284907 18:77533009-77533031 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1160348375 18:78153252-78153274 AGTTTCTCAGAAATATTTGGTGG - Intergenic
1166156674 19:40917933-40917955 ATTTTGTTTGAGTTCTTTGTAGG - Intergenic
1168242769 19:55095668-55095690 AGTTTGTTGCAGTCCTTTGGGGG - Intronic
925859057 2:8157372-8157394 AGTTTGCTGGTCATCTTTGGTGG + Intergenic
926468437 2:13221240-13221262 ATTTAGTTACAGATATTTGGAGG + Intergenic
927982587 2:27383698-27383720 TGTTTGTTAAAGCTCTTTTGGGG - Intronic
928897424 2:36281298-36281320 TGTTGGTTACAGATCTGTGGGGG - Intergenic
931119607 2:59201399-59201421 AATTTGTAATAGATCTTTTGTGG - Intergenic
932871430 2:75403248-75403270 TGGTTATTCGAGATCTTTGGTGG - Intergenic
932871540 2:75404625-75404647 TGGTTATTCGAGATCTTTGGTGG - Intergenic
936555053 2:113488927-113488949 CGTTTGTTAAACATATTTGGGGG + Intronic
939705456 2:145447085-145447107 GGTTTGTCAGATATTTTTGGGGG - Intergenic
941425578 2:165340909-165340931 AGTTTGTTAAAGCCATTTGGTGG + Intronic
941937613 2:170997764-170997786 ACCTTGTTGGAAATCTTTGGTGG + Exonic
943766844 2:191672331-191672353 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
945167809 2:206964813-206964835 AGGTAATTAGAGATCTTTGATGG + Intronic
945656245 2:212627501-212627523 AGTGTGGTAGAGAGCATTGGAGG + Intergenic
1170179403 20:13512467-13512489 AATTTGTTGGAGTTCTTTGTAGG + Intronic
1173131617 20:40399373-40399395 AGTTTCTTAAAGAGATTTGGAGG + Intergenic
1174185078 20:48700819-48700841 ACTTTGTTAAAGATCTCTGCGGG - Exonic
1179267318 21:39815446-39815468 GGTTTGTTTGAGTTTTTTGGAGG - Intergenic
1179335608 21:40449297-40449319 AGGATGTTAGGCATCTTTGGTGG + Intronic
1181524779 22:23474984-23475006 AGTTTGTTGTAGATTTTTGGGGG - Intergenic
1182786279 22:32910355-32910377 AGTTTCTTTGAGCTTTTTGGGGG - Intronic
949807475 3:7971776-7971798 AATTTGGTAGACATCTTTTGAGG + Intergenic
951074466 3:18372935-18372957 AGTTTAACACAGATCTTTGGAGG - Intronic
951878127 3:27451319-27451341 ATTTTGATAGACATTTTTGGGGG - Intronic
953477788 3:43220802-43220824 ACTTTGTCAGAGATCTTTATGGG - Intergenic
957785721 3:84879693-84879715 AATTTGGTAGAGCTTTTTGGAGG - Intergenic
958043996 3:88260776-88260798 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
958757040 3:98261481-98261503 GGTTTTTGAGGGATCTTTGGGGG - Intergenic
958763472 3:98336258-98336280 AGTCTGTTAGTGTACTTTGGTGG - Intergenic
959874840 3:111370887-111370909 GGTTTGTTAGAGTCTTTTGGTGG - Intronic
962950316 3:140212687-140212709 AGTTTGTTAGAGCTAGTGGGAGG - Intronic
963396084 3:144736197-144736219 TGTTGCTTAGAGAACTTTGGTGG + Intergenic
964419558 3:156486834-156486856 AGTTTGATTGAGATTGTTGGAGG + Intronic
964970926 3:162559831-162559853 AGTTTCTTAGAGATAGTGGGAGG + Intergenic
965993008 3:174844046-174844068 AGTTTGTTGCAGAGCTTTTGAGG + Intronic
966584110 3:181602336-181602358 GGTTTGCTAGAGATCTTTTAAGG - Intergenic
967461473 3:189751685-189751707 AATTTGTTTGAGTTCTTTGTGGG + Intronic
969830392 4:9791506-9791528 AGATTTTTAGGGATCTTGGGAGG + Intronic
969998659 4:11341558-11341580 TATTTGTAAGAGATCTTTTGAGG + Intergenic
972365231 4:38368268-38368290 ACTTTATTAGAGGTCTTTGTAGG + Intergenic
972633204 4:40859532-40859554 AGCTTGTTAGAGATGAGTGGAGG - Intronic
972689644 4:41384077-41384099 AGGTTGTTAGAGATCTAGGCTGG + Intronic
973201191 4:47504363-47504385 AGATGGTTTGATATCTTTGGTGG - Intronic
973727354 4:53789696-53789718 TGTGTGTTAGAGCTCTTTAGGGG - Intronic
976979681 4:91211853-91211875 AGTTTGTTAGAGATCTTTGGAGG - Intronic
978275228 4:106941174-106941196 AGTTAGGTAGAGTTCTGTGGTGG - Intronic
980607275 4:135109492-135109514 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
981333160 4:143536339-143536361 AGTTTCTTACAGATATTTGGGGG + Intronic
983430306 4:167641543-167641565 AGTTTAGTAGAGATCTCAGGAGG - Intergenic
986459576 5:7956617-7956639 AAATTTTTAGACATCTTTGGGGG + Intergenic
989010788 5:36870061-36870083 GTTTTGTGAGAGATGTTTGGAGG - Intergenic
990467180 5:56081459-56081481 AGGTTGTTAGTGATCTTGGCTGG - Intergenic
992891055 5:81204619-81204641 AGCTAGTTAGACAACTTTGGAGG - Intronic
993308738 5:86301651-86301673 AGTTTGTGAAAGATGTTTGGTGG + Intergenic
993329589 5:86581370-86581392 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
993705908 5:91170189-91170211 AGTTTTTCATAGATCTTTAGTGG - Intergenic
994418412 5:99502901-99502923 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
994461556 5:100072245-100072267 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
994942825 5:106346716-106346738 GGTTTGCTAGCAATCTTTGGTGG + Intergenic
995208357 5:109508378-109508400 AGTTTGTAAGAGGTCCTTTGGGG + Intergenic
996268151 5:121568862-121568884 ATTTTGTTAGTGATGTTAGGTGG - Intergenic
998831713 5:146166817-146166839 ATTTTGGGAGAGATCTTTTGAGG - Intronic
1000928749 5:167227269-167227291 AGTTTGTTATAGTAGTTTGGTGG + Intergenic
1001896603 5:175387593-175387615 AGTCAGTTAGAGTTCTTTGTTGG - Intergenic
1003064080 6:2887949-2887971 AGTTTGTTAAAAAGCTTTAGAGG - Exonic
1010333411 6:74651528-74651550 TGTTTGTTTGAGGTCTTTTGTGG + Intergenic
1010675552 6:78738736-78738758 AGTTTGTTTGAGTTCATTGTAGG + Intergenic
1010734534 6:79428899-79428921 AGGTTCTTATAGATCTTTAGAGG + Intergenic
1012855804 6:104499849-104499871 AGTATGTTAGAGACCAGTGGGGG + Intergenic
1013751120 6:113407570-113407592 GGCTTTTTAGAGATCTTTAGTGG - Intergenic
1014731901 6:125042082-125042104 TGTTTGCTAGTGATCTTTTGAGG + Intronic
1016073516 6:139769672-139769694 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1017691038 6:156964796-156964818 GTTTTGTTTGAGATATTTGGGGG + Intronic
1019757489 7:2783536-2783558 AGTTTCTGACAGATCTTTTGGGG - Intronic
1021350558 7:19588626-19588648 AGCTTGTTAGACATATTGGGAGG + Intergenic
1021361763 7:19723272-19723294 ATTTTGTTGAAGATCATTGGGGG - Intronic
1022608907 7:31848775-31848797 AACTTGTTAGAGCCCTTTGGTGG + Intronic
1023429191 7:40071908-40071930 AGTTTGTTAGTTTTCTTTGCCGG + Intronic
1025820748 7:64960557-64960579 AGTTTGTAAAACATATTTGGAGG + Intergenic
1027788102 7:82605520-82605542 ATTTTCTCACAGATCTTTGGAGG - Intergenic
1030468320 7:109930804-109930826 ATTTTGACAGAGGTCTTTGGAGG + Intergenic
1031730015 7:125288541-125288563 AGATTGTTCAAGATCTTTGTAGG - Intergenic
1032649845 7:133866381-133866403 AGTTGGTATGAGATGTTTGGGGG + Intronic
1033330808 7:140415423-140415445 AGTTTGGCTGAGATCTTTAGAGG - Intronic
1033486737 7:141797296-141797318 AGCTTATTATAGATCTTTGAGGG - Intergenic
1033897701 7:146095061-146095083 AGTTTGTGAGACATCTGTGTAGG - Intergenic
1034305823 7:150044166-150044188 AGTTTTTTAAAGGGCTTTGGAGG - Intergenic
1034801016 7:154056487-154056509 AGTTTTTTAAAGGGCTTTGGAGG + Intronic
1035635801 8:1143391-1143413 AGTTTGATAGAGATATTAAGGGG - Intergenic
1037266579 8:17069023-17069045 ACAGTGTTTGAGATCTTTGGGGG + Intronic
1039259934 8:35760493-35760515 AGTTTCTAAGAGATCTTTTAAGG - Intronic
1040130418 8:43789372-43789394 AGTTTCTTTGAGTTTTTTGGGGG - Intergenic
1040726760 8:50389948-50389970 AATTTGTTTGAGTTCTTTGTAGG + Intronic
1041070632 8:54124675-54124697 AGGTTGTTAGTGATCTTGGCTGG - Intergenic
1041422354 8:57682067-57682089 AGTTTGGAAGAGATTTTTGGTGG - Intergenic
1043059775 8:75485868-75485890 AGTTTGTTAGATAATTTTGATGG + Intronic
1043200945 8:77368777-77368799 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1043221971 8:77677509-77677531 AGTTTACTAGAGTTCTTTTGTGG - Intergenic
1043643757 8:82490603-82490625 AATTTGTTAAAGTTCTTTGTGGG - Intergenic
1045712674 8:105003491-105003513 AGTTTGCTAGGGTTCTGTGGAGG + Intronic
1046512761 8:115220229-115220251 AATCTGTAAGAGATCTTGGGAGG - Intergenic
1047089183 8:121555052-121555074 GGTTGGTTAGATATCTTTGCTGG - Intergenic
1048401878 8:134079134-134079156 GGTTTGTTATAATTCTTTGGGGG + Intergenic
1049897950 9:128259-128281 CGTTTGTTAAACATATTTGGGGG - Intronic
1052023549 9:23550981-23551003 AGATTTTAAGAGATCTTTGGGGG + Intergenic
1053741031 9:41138552-41138574 CGTTTGTTAAACATATTTGGGGG - Intronic
1054444019 9:65294695-65294717 CGTTTGTTAAACATATTTGGGGG - Intergenic
1054486253 9:65726810-65726832 CGTTTGTTAAACATATTTGGGGG + Intronic
1054687318 9:68292745-68292767 CGTTTGTTAAACATATTTGGGGG + Intronic
1055195434 9:73587095-73587117 AATTTGTATGAGCTCTTTGGAGG + Intergenic
1058102862 9:100936760-100936782 TTTTTGTTAGAGATCATTGCAGG + Intergenic
1058159589 9:101553749-101553771 ACTTTGTTAGAGGACTTTGAAGG + Intronic
1059236879 9:112768523-112768545 ATTGTCTAAGAGATCTTTGGAGG - Intronic
1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG + Intergenic
1188839031 X:34992147-34992169 AGTTTTTTAAAAATCTTGGGTGG + Intergenic
1188992717 X:36842546-36842568 AGAATGTTACAGATCATTGGTGG + Intergenic
1190900286 X:54665699-54665721 AATTTGTTTGAGTTCTTTGTAGG + Intergenic
1191936315 X:66430857-66430879 AATTTGTTTGAGATATTTGTAGG + Intergenic
1194632526 X:96303016-96303038 AATTTGTTTGAGTTCTTTGTAGG - Intergenic
1196619917 X:117809577-117809599 AGTTTGGAAGACATATTTGGGGG + Intergenic
1197406305 X:126055930-126055952 AGTTTGTTGGTGAGGTTTGGTGG - Intergenic
1199253448 X:145691434-145691456 AGTTTGCTAGAATTTTTTGGGGG + Intergenic
1199700428 X:150371451-150371473 ATTTTGGAAGAGATCATTGGAGG + Intronic
1199950405 X:152701508-152701530 AGTGTGTTAGAGGTGTTTGAGGG + Exonic
1199959276 X:152766953-152766975 AGTGTGTTAGAGGTGTTTGAGGG - Exonic
1201691231 Y:16767344-16767366 AGTTTGTTTGAGTTCTTTGTAGG - Intergenic
1201980433 Y:19902734-19902756 AGTTTTTTAAATATGTTTGGTGG - Intergenic