ID: 976983329

View in Genome Browser
Species Human (GRCh38)
Location 4:91260305-91260327
Sequence ACACATACACACCCATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1218
Summary {0: 1, 1: 0, 2: 11, 3: 162, 4: 1044}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976983323_976983329 -1 Left 976983323 4:91260283-91260305 CCATACACCACTTCCCCAATATA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983324_976983329 -8 Left 976983324 4:91260290-91260312 CCACTTCCCCAATATACACATAC 0: 1
1: 0
2: 5
3: 62
4: 512
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983322_976983329 0 Left 976983322 4:91260282-91260304 CCCATACACCACTTCCCCAATAT 0: 1
1: 0
2: 0
3: 5
4: 136
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983321_976983329 24 Left 976983321 4:91260258-91260280 CCAACAGCATAACACACTGTTCT 0: 1
1: 0
2: 0
3: 18
4: 184
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976983329 Original CRISPR ACACATACACACCCATGCAT GGG Intronic
900222848 1:1518573-1518595 ACACACACACACCCGCACATGGG + Intronic
900268541 1:1774144-1774166 ATACACACACACACATACATAGG - Intronic
900803146 1:4749947-4749969 AAACATACACACACATGAATGGG - Intronic
900898115 1:5497990-5498012 ACATCTGCACACTCATGCATGGG - Intergenic
901152675 1:7114302-7114324 ACACATACACACACACACAGAGG - Intronic
901563331 1:10090784-10090806 ACACACACACACAAATGCATAGG - Intronic
901751584 1:11413489-11413511 ACACACACACACACACGCTTTGG + Intergenic
902106961 1:14045629-14045651 ACATATACACACCCCACCATGGG - Intergenic
902244597 1:15112326-15112348 ACACACACACACACACACATTGG - Intronic
902530989 1:17090574-17090596 ACACACACACACACAAGCAAAGG - Intronic
902537204 1:17126512-17126534 ACACACACACACCCTTGTGTAGG + Intergenic
902910832 1:19596210-19596232 ACACATACACATACATACACAGG - Intergenic
903352196 1:22724229-22724251 ACACACACACACACATGCAAGGG - Intronic
904576185 1:31506455-31506477 CCCCACACACACCCATGCCTGGG - Intergenic
905180385 1:36161856-36161878 ATACACACACACACATGCAGAGG - Intronic
905181192 1:36167958-36167980 ATACTTACACACCCAGGCTTTGG + Intronic
905232689 1:36524673-36524695 TCACATACACACCCACGCGTGGG - Intergenic
905246393 1:36617374-36617396 ACACACACACACACTTGCACAGG - Intergenic
905310616 1:37046491-37046513 TCACTCACACACCCATTCATAGG - Intergenic
905812679 1:40924217-40924239 ACACACACACACACAAGCATGGG - Intergenic
907745654 1:57210845-57210867 ATACATGCATACACATGCATAGG - Intronic
907761969 1:57369508-57369530 ACACATATATATCCATGCATTGG + Intronic
908361465 1:63372476-63372498 ACACAGACACACACATATATAGG + Intronic
908531747 1:65040634-65040656 TCACATACACACACATGCCCAGG + Intergenic
908669336 1:66529398-66529420 ATACACACACACACATACATAGG + Intergenic
908912378 1:69087131-69087153 ACACACACACACACACTCATAGG - Intergenic
908928906 1:69292110-69292132 ACACACACACACACATTAATAGG - Intergenic
909022005 1:70441813-70441835 ACACACACACACACACGCACAGG - Intergenic
909027508 1:70500241-70500263 ACACACACACACACAAGCAAAGG - Intergenic
909136669 1:71809727-71809749 ACACATACACACACACACATTGG - Intronic
909432411 1:75604750-75604772 ACACATACACACACACCCCTTGG - Intronic
910011762 1:82472401-82472423 ACACACACACACACATTGATGGG - Intergenic
910769634 1:90817927-90817949 ACACATACACACATATATATAGG + Intergenic
911199110 1:95026455-95026477 ACACACACACACACATTCCTTGG - Intronic
911282950 1:95954105-95954127 ACACACACACACACAGGCAGAGG - Intergenic
911455743 1:98121058-98121080 ACACATTCACACACATGGACAGG - Intergenic
911516563 1:98874947-98874969 ACACACACACACACACACATAGG - Intergenic
912053726 1:105568059-105568081 ACACACACACACACACACATGGG + Intergenic
912435172 1:109656539-109656561 ACACACACACAGGCATGCACAGG - Intronic
914007230 1:143742998-143743020 ACACACACACACACACACATTGG - Intergenic
914426058 1:147577831-147577853 ACACACACACACACACACATTGG - Intronic
914646047 1:149653492-149653514 ACACACACACACACACACATTGG - Intergenic
915830078 1:159119773-159119795 ACACATGCACACACACACATAGG - Intronic
916178061 1:162059472-162059494 ATACATATACACACATGCATGGG + Intergenic
916292805 1:163185206-163185228 ACACACACACACACACGCAGAGG + Intronic
916556860 1:165900880-165900902 AAACAAACACACCCGTGCTTGGG - Intronic
916834417 1:168528791-168528813 ACACATACACACATATGCTTTGG - Intergenic
916855056 1:168740730-168740752 ACACACACACACACACACATAGG - Intergenic
917515635 1:175705545-175705567 ACACATACACACCATTGGTTTGG - Intronic
917515637 1:175705578-175705600 ACACACATACACACATACATAGG - Intronic
917647843 1:177046667-177046689 ATACATGCACACACATGCAGAGG + Intronic
918707899 1:187691206-187691228 ACACACACACACCCCTGCACAGG + Intergenic
918860400 1:189818190-189818212 ACACACACACACACATATATGGG - Intergenic
918884524 1:190174438-190174460 ACACATACACACATGTACATTGG + Intronic
918902496 1:190442795-190442817 ACACACACACACACACGCACAGG - Intronic
919199294 1:194332728-194332750 ACACATACACATACATACATCGG + Intergenic
919204195 1:194399352-194399374 ACACACACACACACATACATAGG + Intergenic
919317421 1:195991015-195991037 ACACACACACACACATATATAGG + Intergenic
919869097 1:201807033-201807055 ACACATACACACACACACACAGG - Intronic
920241415 1:204554385-204554407 ACACATGCACACTCATGACTGGG - Exonic
920316636 1:205080544-205080566 ACACACACACACACACACATTGG + Intergenic
920392513 1:205617958-205617980 ACACACACACACACATATATGGG - Intronic
920507165 1:206524873-206524895 TCACACACACACACATGCACAGG + Intronic
920542764 1:206791922-206791944 ACACACACACACACATGCACAGG - Intergenic
920659006 1:207899237-207899259 ACACATGCACACCCATGTTTTGG - Intronic
921570080 1:216767269-216767291 ACACACACACACACACGCAAAGG + Intronic
922218664 1:223541089-223541111 ACACACACACACACATGCTTTGG - Intronic
922332576 1:224590372-224590394 ATACATACACATCCATGCTCAGG - Intronic
922441723 1:225661224-225661246 ACACACACACACACACGCACAGG - Intergenic
922724562 1:227916571-227916593 ACACACAGACACAGATGCATAGG + Intergenic
922743777 1:228031591-228031613 ACACATGCACACACATGCACAGG - Intronic
923043312 1:230335125-230335147 ACACATACACATACATACACAGG + Intronic
923043314 1:230335311-230335333 ACACATACACATACATACACAGG + Intronic
923043316 1:230335497-230335519 ACACATACACATACATACACAGG + Intronic
923043318 1:230335691-230335713 ACACATACACATACATACACAGG + Intronic
923262796 1:232283582-232283604 ACACAGACACTCCCATGAACTGG + Intergenic
923945075 1:238876347-238876369 ACACATTCACACACATACAACGG - Intergenic
924367996 1:243317198-243317220 ACACATACAAACTAATGCCTGGG - Intronic
1062794840 10:336887-336909 ACACACACACACACCTGCCTAGG - Intronic
1063291323 10:4752703-4752725 ACACACACATACACATGTATTGG + Intergenic
1063626396 10:7693856-7693878 ACACACACACTCACATGCACAGG + Intergenic
1063672786 10:8112895-8112917 ACACAGACACACACATACAGAGG + Intergenic
1064658608 10:17582493-17582515 ACACACACACACCCCTTCTTAGG - Intergenic
1064820910 10:19331769-19331791 ACACACACACAGCCATCAATTGG - Intronic
1065059436 10:21883383-21883405 ACACATACACACGTACACATGGG - Intronic
1065481138 10:26194911-26194933 ACACATACACATCCATACATGGG + Intronic
1065501617 10:26388524-26388546 ACACACACACAACCACTCATGGG - Intergenic
1065883918 10:30060072-30060094 ACACATATACATACATACATGGG + Intronic
1066374239 10:34843216-34843238 ACACATACACACACACACAGAGG - Intergenic
1066686849 10:37989814-37989836 ACACATGCACAGCCAGACATTGG - Intergenic
1067012247 10:42725218-42725240 ACACATACACACACACACAAAGG - Intergenic
1067279449 10:44860175-44860197 ACACATACACACACACACACGGG - Intergenic
1067491768 10:46714758-46714780 ACACTGACACACCAATGCTTGGG + Intergenic
1067602891 10:47625618-47625640 ACACTGACACACCAATGCTTGGG - Intergenic
1067975534 10:51021015-51021037 ACAGACACACACCCCTACATAGG - Intronic
1068362388 10:55994640-55994662 ACACATACACACACACACACAGG - Intergenic
1068464779 10:57375749-57375771 ATACATACACACACACACATAGG + Intergenic
1070129327 10:73646204-73646226 ACACACACACACACAGGCCTAGG + Exonic
1070384955 10:75916161-75916183 ACACACACACACACACACATAGG - Intronic
1071144580 10:82553049-82553071 ACACACACACACCCCTTTATGGG + Intronic
1071251465 10:83823849-83823871 ACACAGAGACGCGCATGCATGGG + Intergenic
1071321788 10:84467455-84467477 ACACATACACACACATATGTGGG - Intronic
1071337109 10:84609592-84609614 ACACATACACATCCATACACAGG + Intergenic
1071337122 10:84609828-84609850 ACACAAGCACACACATGCATAGG + Intergenic
1071442118 10:85708697-85708719 ACACATACACAACACTGAATTGG - Intronic
1071479439 10:86053814-86053836 ACACACACTTACACATGCATGGG + Intronic
1071677623 10:87670590-87670612 ACACACACACACTCATGCTGAGG + Intronic
1071756920 10:88552737-88552759 ACATATACACACACATATATAGG + Intronic
1071978920 10:90983864-90983886 ACACACACACACACATCCACAGG - Intergenic
1072229476 10:93401786-93401808 ACACACACACACACACGCACAGG - Intronic
1072317867 10:94221289-94221311 ACACACACACACCCTTGCAGAGG - Intronic
1072362355 10:94672025-94672047 ACACACACACACACACGGATTGG + Intergenic
1073031010 10:100525609-100525631 ACACACACACACACACGCTTTGG - Intronic
1073093435 10:100965082-100965104 ACACACACACACACATTCATAGG - Intronic
1073152005 10:101318399-101318421 ACACGTTCACACCCCTGCACTGG + Intergenic
1073617684 10:105013995-105014017 ACACACACACACACAGGCATGGG + Intronic
1074340603 10:112625179-112625201 ACACATAAACACACAAACATAGG - Intronic
1074420648 10:113305989-113306011 AGACAGACACACACATACATAGG + Intergenic
1074659093 10:115630856-115630878 ACACACACACACACACACATTGG + Intronic
1074722369 10:116273710-116273732 ACACACACACACACATACACGGG + Intergenic
1075241520 10:120783338-120783360 ACACATACACACACACACACAGG - Intergenic
1075563921 10:123489655-123489677 ACACATATACACTCATGCAATGG - Intergenic
1075947668 10:126451710-126451732 ACACATACATACACATGCAACGG + Intronic
1076218534 10:128715208-128715230 ACACACACACACATATACATCGG - Intergenic
1076278683 10:129226497-129226519 ACACATGCACACCCATAAATGGG - Intergenic
1076278703 10:129226689-129226711 ACACACACACACCTGTACATGGG - Intergenic
1076278711 10:129226767-129226789 ACACACACACACCTGTACATGGG - Intergenic
1076278724 10:129226882-129226904 ACACACACACACCTGTACATGGG - Intergenic
1076278753 10:129227140-129227162 ACACACACACACCTGTACATGGG - Intergenic
1076278757 10:129227191-129227213 ACACACACACACCCGTACACGGG - Intergenic
1076278769 10:129227319-129227341 ACACACACACACCTGTACATGGG - Intergenic
1076438446 10:130462721-130462743 GCACACACACACACATGCATGGG - Intergenic
1076530191 10:131139727-131139749 ACACATACAGACACATACACAGG - Intronic
1076552314 10:131289586-131289608 ACACATACACTCACATTGATAGG - Intronic
1076935016 10:133562258-133562280 ACACACACACACACACACATTGG - Intronic
1077144574 11:1039036-1039058 ACACATACACACGCACACACAGG - Intergenic
1077219396 11:1408754-1408776 ACACACACACACCCCTGCACAGG - Intronic
1077219409 11:1408864-1408886 AGACATACACACCCCTGTACAGG - Intronic
1077219415 11:1408913-1408935 ACACACACACACCCTTGCACAGG - Intronic
1077219418 11:1408959-1408981 ACACACACACACACCTGCACAGG - Intronic
1077219424 11:1409019-1409041 ACACACATACATCCCTGCATAGG - Intronic
1077370302 11:2178728-2178750 ACACATGCACATGCATACATAGG - Intergenic
1077600006 11:3568050-3568072 ACACATACACACTCAGGCTCAGG + Intergenic
1077832268 11:5886172-5886194 ACACATACACACACACACAAAGG - Intronic
1077935040 11:6774907-6774929 ACACACACACACACACACATTGG - Intergenic
1078249003 11:9601907-9601929 ACACACACACACACACACATTGG + Intergenic
1078648763 11:13167641-13167663 ACCCATACACACATATGCAAAGG + Intergenic
1078656841 11:13248729-13248751 AAACATACACACATTTGCATAGG - Intergenic
1078718712 11:13863768-13863790 CCACATACACACCCAGGAAAGGG - Intergenic
1078752490 11:14178060-14178082 ACACACACACACACACGCTTTGG + Intronic
1078948818 11:16104597-16104619 ACACACACACACACATACACAGG + Intronic
1078948823 11:16104650-16104672 ACACACACACACACATACACAGG + Intronic
1078968854 11:16381806-16381828 ACACATACACACACAGGCAGAGG + Intronic
1079671909 11:23181311-23181333 ACACACACACACCCAGGAAAAGG - Intergenic
1079704737 11:23600154-23600176 ACACATCCATACTCATGGATGGG - Intergenic
1079835938 11:25332910-25332932 ACACACACACACACACACATTGG + Intergenic
1079909918 11:26297178-26297200 ACACACACACACACACGCAATGG - Intergenic
1080055071 11:27898507-27898529 ACACACACACACACATACGTTGG + Intergenic
1080305313 11:30828714-30828736 ACATACACACACACATGCAAAGG + Intergenic
1080402772 11:31952818-31952840 ACACACACACACACATACAATGG + Intronic
1080539245 11:33250750-33250772 ACACACACACACACAAGAATTGG + Intergenic
1081299437 11:41432648-41432670 AAACATACACACACATGCACAGG + Intronic
1081585121 11:44378982-44379004 ACACAGACACACACAGGCACGGG + Intergenic
1083454230 11:62767764-62767786 ACAGATACACACCACTGCACTGG - Intergenic
1083723513 11:64615823-64615845 ACACACACACACACACGCTTGGG - Intronic
1084183895 11:67460529-67460551 ACACACACACACACAGCCATTGG + Intergenic
1084531053 11:69727971-69727993 ACACACACACACACATGCCCAGG - Intergenic
1084680001 11:70661541-70661563 ACACACACACACACAAACATGGG + Intronic
1084882351 11:72180720-72180742 ACACAGACACAGCCCTGCTTTGG - Intergenic
1084937514 11:72595050-72595072 ACACACACACACACACACATTGG + Intronic
1085011269 11:73142805-73142827 ACACACACACACACACGCAAAGG - Intergenic
1085456663 11:76669338-76669360 ACACACACACACACATTCTTTGG - Intronic
1085640741 11:78191161-78191183 ACACATACACACACACACACAGG + Intronic
1085890711 11:80575176-80575198 ACACACACACACACAGTCATAGG - Intergenic
1086457172 11:86970686-86970708 ACACATACACACACACACACAGG - Intergenic
1086461972 11:87014971-87014993 ATACACACACACACACGCATTGG - Intergenic
1086678599 11:89640642-89640664 ACACACACACACACACACATAGG + Intergenic
1087026540 11:93655348-93655370 ACACAAACACACCCACACACAGG + Intergenic
1087216750 11:95503198-95503220 ACACATACACACACACACACTGG + Intergenic
1087238526 11:95749238-95749260 ACACACACACACACACGGATAGG - Intergenic
1087358311 11:97123409-97123431 ACACAGACACACACATACAAAGG + Intergenic
1087923293 11:103891646-103891668 ACACACACACACACATGCAAAGG + Intergenic
1088409346 11:109516284-109516306 AGACATACACACCAATGGAACGG + Intergenic
1088597669 11:111452055-111452077 ACACAGATAAAACCATGCATAGG - Intronic
1089139569 11:116274959-116274981 ACACACACACACCCCTGCTCTGG - Intergenic
1089340062 11:117751082-117751104 ACACACAAACATGCATGCATAGG - Intronic
1089753555 11:120669142-120669164 ACACACACACACCCACGCTTTGG - Intronic
1089881557 11:121778433-121778455 ACACGTACACACACATGCTGTGG - Intergenic
1090064733 11:123492880-123492902 ACACACACACACACACGCATAGG + Intergenic
1090110215 11:123899476-123899498 ACATATACACACACACACATGGG - Intergenic
1090155184 11:124429880-124429902 ACACACACACACACACACATTGG - Intergenic
1090302556 11:125657180-125657202 ACACACACACACACAAGCATAGG - Intronic
1091025952 11:132141559-132141581 GCACATGCTCACTCATGCATGGG - Intronic
1091057998 11:132436789-132436811 ACACACACACACACATGCACAGG + Intronic
1091839893 12:3613417-3613439 ACACACACACACACACACATTGG + Intronic
1091859983 12:3772406-3772428 AAACACACACACTCATGCCTAGG - Intergenic
1091975189 12:4819056-4819078 ACATATACACACGTATGCACAGG + Intronic
1092039765 12:5373834-5373856 ACACATAAACACACAAGCAAAGG - Intergenic
1092071672 12:5636638-5636660 ACACACACACACGCATGCACAGG + Intronic
1092153113 12:6264751-6264773 ACCCAAACACACACATGTATCGG + Intergenic
1093266590 12:17010941-17010963 ACACAGACACACACATACAATGG - Intergenic
1093301039 12:17455446-17455468 ACTCATACTCACCCATGTAATGG - Intergenic
1093776950 12:23086797-23086819 ACACACACACACACACCCATAGG + Intergenic
1093884527 12:24444263-24444285 ACACACACACACACATTCAGTGG - Intergenic
1094341239 12:29413672-29413694 ACACACACACACACACACATTGG + Intronic
1094740305 12:33281238-33281260 ACAGACACACACACATGGATTGG - Intergenic
1095207598 12:39456526-39456548 ACACATACACACACAAGTGTAGG + Intergenic
1095331128 12:40966028-40966050 ACACACACACACGCACGCATTGG + Intronic
1095639460 12:44470493-44470515 ACACACACACATATATGCATAGG + Intergenic
1095750326 12:45703650-45703672 ACACACACACACACAAGCTTAGG - Intergenic
1096087188 12:48873613-48873635 ATGCATACACACACATGCACTGG - Intergenic
1096234627 12:49917808-49917830 ACACACACACACACACGCCTGGG + Intergenic
1096480677 12:51938865-51938887 ACACACATGCACGCATGCATGGG + Intergenic
1096834390 12:54339974-54339996 ACACACACACACACACGCACAGG - Intronic
1097409478 12:59233829-59233851 ACACATACAAACACATTCACTGG + Intergenic
1098229767 12:68361480-68361502 ACACACACACACAAATACATAGG + Intergenic
1098407992 12:70147164-70147186 ACACACACACACACAGGCATAGG + Intergenic
1098677698 12:73311493-73311515 ACACACACACACACAACCATAGG - Intergenic
1098799429 12:74935194-74935216 ACACATACACACTGAAACATGGG - Intergenic
1098844173 12:75515267-75515289 ACACACACACACACACACATTGG + Intergenic
1099914570 12:88876121-88876143 ACACACACACACACACACATCGG - Intergenic
1100147018 12:91690743-91690765 ACACATGCAGAGCCACGCATGGG + Intergenic
1100234551 12:92647253-92647275 ACACACACACACACATACAATGG + Intergenic
1100324711 12:93530111-93530133 ACACACACACACCCATCCTATGG + Intergenic
1100841233 12:98613305-98613327 ACACACACACACACACACATAGG - Intergenic
1101158333 12:101948787-101948809 ACACACACACACACACACATTGG + Intronic
1101414118 12:104493965-104493987 ACACACACACCACCATGCCTGGG + Intronic
1101807729 12:108079389-108079411 ACACACACACACACACGTATGGG + Intergenic
1102483678 12:113241755-113241777 ACACACACACACACACGCAGAGG - Intronic
1102561196 12:113763447-113763469 ATACATGCATACACATGCATGGG - Intergenic
1102773275 12:115497206-115497228 AAACACACACACACATACATAGG + Intergenic
1102902062 12:116646685-116646707 ACACACACACACACACGGATAGG - Intergenic
1103205082 12:119122638-119122660 GCACAGACACACAAATGCATTGG - Intronic
1103522943 12:121548582-121548604 AGACACACACACCGATGCAGAGG + Intronic
1104158311 12:126154357-126154379 ACACACACACACACAGGCATGGG + Intergenic
1104728322 12:131091594-131091616 ACAGAAACACACCCACGCATAGG - Intronic
1104877936 12:132049521-132049543 GCACAGACACACCCATACCTGGG + Intronic
1105283099 13:18981155-18981177 ACACACACACACACACGCTTGGG + Intergenic
1106040925 13:26092498-26092520 ACACACACACACACATACACAGG - Intergenic
1106229937 13:27813975-27813997 ACACACACACACACATGCACAGG + Intergenic
1106311564 13:28559172-28559194 ACATATATACACACATACATAGG - Intergenic
1106403190 13:29449337-29449359 ACACATACACACACATACAGTGG + Intronic
1106703369 13:32253941-32253963 ACACATACACACACACACACAGG + Intronic
1106921357 13:34567486-34567508 ACACACACACACACACACATAGG + Intergenic
1106924152 13:34595588-34595610 ACACACACACACACACGCAGAGG + Intergenic
1106931784 13:34674308-34674330 ACACATACATTCCCGGGCATAGG + Intergenic
1106982063 13:35298170-35298192 ACACATACACACACACACACTGG - Intronic
1106984230 13:35325998-35326020 ACACATACAAACCAATGGAAGGG - Intronic
1107040381 13:35941551-35941573 ACACATGCACACACGTGCACAGG + Intronic
1107113090 13:36718800-36718822 ACACACACACACACACACATAGG + Intergenic
1107411579 13:40163039-40163061 ACACACACACACACACACATAGG - Intergenic
1107731230 13:43351001-43351023 ACACATACACACACAAGGAAAGG + Intronic
1108323579 13:49308608-49308630 ACACAGCCACACACATGCAATGG + Intergenic
1108466655 13:50723430-50723452 ACACACACACACACACGTATTGG + Intronic
1108965712 13:56298088-56298110 ACACACACACACACACACATTGG - Intergenic
1108976970 13:56457683-56457705 ACACATACACACACGTGCATAGG + Intergenic
1109178016 13:59179332-59179354 ACACATACAGACACATACAATGG - Intergenic
1109290202 13:60464586-60464608 ACACACACACACACATACACTGG + Intronic
1109433272 13:62264497-62264519 ACACACACACACACACGCATTGG + Intergenic
1109599159 13:64600449-64600471 ACACATACACACACATAAGTAGG - Intergenic
1109966124 13:69698773-69698795 ATACACACACACACATGCAATGG - Intergenic
1110093394 13:71484153-71484175 ACACATACACACACAAGAAATGG - Intronic
1110562976 13:76929104-76929126 ACACATACACACACACACACAGG - Intergenic
1110707814 13:78614825-78614847 ACACATACACACACACGCAGAGG + Exonic
1111050147 13:82872366-82872388 ACACATACACACAAATACTTAGG - Intergenic
1111297119 13:86294436-86294458 ACACATACACACACACATATAGG + Intergenic
1111391603 13:87603487-87603509 ACACACACACACACACACATAGG - Intergenic
1111416683 13:87956226-87956248 ACACATACACACACAGGCATGGG + Intergenic
1111499655 13:89100445-89100467 ACATACACTCACCCATGCACAGG + Intergenic
1111511300 13:89267002-89267024 ACACATACACACACACACAGAGG - Intergenic
1111548311 13:89774027-89774049 ACACATGCACACACACACATTGG - Intergenic
1111659987 13:91197359-91197381 ACACACACACACACATACAACGG - Intergenic
1111765666 13:92524953-92524975 ACACTTAGAAACCCAAGCATTGG - Intronic
1112977070 13:105333518-105333540 ACACACACAGACACATGCTTTGG - Intergenic
1113039037 13:106084435-106084457 ACACACACACACACACACATTGG + Intergenic
1113328393 13:109305913-109305935 ACACACACACACACAGGCACAGG - Intergenic
1113870594 13:113557419-113557441 ACACATCCACACCCACACACGGG - Intergenic
1114171433 14:20276349-20276371 ACACACACACATATATGCATAGG - Intronic
1114904950 14:27115653-27115675 ACACATACACACACACACAAAGG - Intergenic
1115016008 14:28615240-28615262 ACACACACACACACACACATTGG + Intergenic
1115115291 14:29873862-29873884 ACACATACACACAGCTGCACTGG + Intronic
1115221020 14:31058510-31058532 ACACATACACACACAGAGATGGG - Intronic
1115578500 14:34735035-34735057 ACACACACCCACACATACATGGG + Intergenic
1115887762 14:37992855-37992877 ACACACACACACACATAAATAGG - Intronic
1115947689 14:38681157-38681179 ACACATCCACACTCATGAACTGG - Intergenic
1116199137 14:41769477-41769499 ATAAATACACACACATACATAGG - Intronic
1116638053 14:47423549-47423571 ACACACACACACACAGGCGTGGG - Intronic
1116639184 14:47439322-47439344 ACACATACACACACAAACAGAGG - Intronic
1116849883 14:49897770-49897792 AAACATAAAAACCCATTCATGGG - Intergenic
1116981751 14:51178416-51178438 ATATATACACACACATACATAGG + Intergenic
1117022506 14:51585916-51585938 ACACACACACACACATGCCATGG - Intronic
1117143424 14:52812446-52812468 ACACACACACACACACACATAGG + Intergenic
1117907638 14:60606958-60606980 ACACACACACACACTAGCATAGG - Intergenic
1118001592 14:61528095-61528117 ACACACACACACACATGGACAGG - Intronic
1118159935 14:63277987-63278009 ACACACACACACACAGACATAGG + Intronic
1118733951 14:68689245-68689267 ACACATACACACACACCCAGGGG - Intronic
1119262780 14:73247513-73247535 ACACACACACACACATACACAGG - Intronic
1120034325 14:79679240-79679262 ATACACACACACCCATCAATGGG + Intronic
1120217154 14:81692411-81692433 ACACACACACACACATGCACAGG - Intergenic
1120273772 14:82347433-82347455 ACACATACACACACACATATGGG + Intergenic
1120897488 14:89546763-89546785 ACACATACACACATATACATAGG + Intronic
1120924516 14:89784349-89784371 CTACATACACACACATGCACAGG + Intergenic
1120925937 14:89797072-89797094 ATACATACACACACATATATGGG - Exonic
1121426827 14:93858319-93858341 ACACACACACACACATGCACAGG - Intergenic
1121798686 14:96755812-96755834 ACACACACACACACACCCATGGG + Intergenic
1121943095 14:98092098-98092120 ACACACACACACACACGCACAGG - Intergenic
1122047302 14:99033363-99033385 ACACACACACACATATGCATAGG + Intergenic
1122477256 14:102019096-102019118 ACACATACATACACATGCATAGG - Intronic
1122665581 14:103327196-103327218 GCACACACACACACATGGATAGG + Intergenic
1122751636 14:103938375-103938397 ACACACACACACACATATATGGG - Intronic
1122783874 14:104155088-104155110 GCACATCCACACCCGTGCAGGGG + Intronic
1202833201 14_GL000009v2_random:58435-58457 ACACATACACACACACACACAGG + Intergenic
1202870791 14_GL000225v1_random:161561-161583 ACACACACACACACATACTTGGG + Intergenic
1123587929 15:21775414-21775436 ACACATGCACACACACGCACAGG + Intergenic
1123624567 15:22217979-22218001 ACACATGCACACACACGCACAGG + Intergenic
1124080179 15:26486818-26486840 ACACACACACACACACACATGGG + Intergenic
1124098954 15:26675442-26675464 ACACACTCACACACATGCACAGG - Intronic
1124148640 15:27156414-27156436 ACTCAGACACACCAATGCATGGG - Intronic
1124219954 15:27842824-27842846 ACGCACACACACACACGCATAGG + Intronic
1125194565 15:37031412-37031434 ACACACACACACATATGCAAGGG - Intronic
1125365918 15:38915933-38915955 AAACACACAAACCCATACATAGG - Intergenic
1125383094 15:39108290-39108312 ACACACACACACATATGCACAGG - Intergenic
1125751595 15:42032948-42032970 ACACTCACACACACATGCAGTGG - Intronic
1125813714 15:42565380-42565402 ACACACACACACACATTCAATGG - Intronic
1126203641 15:46018238-46018260 ACACACACACTTACATGCATGGG - Intergenic
1126223569 15:46243235-46243257 ACACACACACACACACACATGGG - Intergenic
1126436369 15:48642664-48642686 ACACACACACACACATACACGGG - Intronic
1126813042 15:52427858-52427880 ACAAACACACACACATGCAGAGG + Intronic
1126892845 15:53224348-53224370 ACACACACACAGCAATGCTTGGG - Intergenic
1127180577 15:56412167-56412189 ACACACACACACACACGCTTGGG - Intronic
1127509361 15:59624954-59624976 ACACCCACACACCCACCCATGGG + Intronic
1127650796 15:61004628-61004650 ACACATACACACCCGTTCTAGGG + Intronic
1127746862 15:61986105-61986127 ACACATACACACACACACACCGG + Intronic
1128422285 15:67504865-67504887 ACACATACACACACACACACAGG + Intergenic
1128524920 15:68405920-68405942 ACACAGACACACACATGCACAGG + Intronic
1128957734 15:71966257-71966279 ACACACACACACACTTGCCTGGG - Intronic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1129227324 15:74177618-74177640 ACACACACACACACATGCACTGG - Intergenic
1129691870 15:77718361-77718383 TCACATGCACAGCCATGCGTGGG - Intronic
1130101907 15:80900575-80900597 ACACACACACACCCCTACCTGGG - Intronic
1130124335 15:81080390-81080412 ACACACACACACACATTCACTGG + Intronic
1130836660 15:87656470-87656492 ACACACACATGCCCATGCCTGGG - Intergenic
1130904612 15:88231479-88231501 ACACACACACACAAATGCAATGG + Intronic
1130994569 15:88896699-88896721 ACACACACACACACACTCATGGG - Intergenic
1131086119 15:89576794-89576816 ACACATACACACACACCCCTGGG - Intronic
1131562116 15:93454023-93454045 ACACACACACATACATACATAGG + Intergenic
1131755336 15:95554458-95554480 ACACACACACACACACGCACAGG - Intergenic
1131852173 15:96554987-96555009 ACAGATACACACCATTGCACAGG + Intergenic
1131995075 15:98125531-98125553 ACACACACACACACATGCCCAGG - Intergenic
1132193878 15:99895232-99895254 ACACACACACACACATACACAGG - Intergenic
1132227326 15:100152485-100152507 GCACATACACACACAAGCACAGG - Intronic
1132660877 16:1061033-1061055 ACACATCCACACCCGTCCACAGG + Intergenic
1132816505 16:1830934-1830956 ACACACACACACCCATATTTTGG + Intronic
1133351450 16:5103380-5103402 TGACATACACAGCCATTCATCGG - Intergenic
1133458466 16:5964775-5964797 ACACATATACACACACACATTGG + Intergenic
1133660696 16:7914281-7914303 TCCCATAAACACACATGCATAGG - Intergenic
1133723278 16:8514854-8514876 ATACATATACACTCATACATAGG + Intergenic
1134238716 16:12488058-12488080 ACATATATATACCTATGCATAGG - Intronic
1134372109 16:13635447-13635469 ACACACACACACACATTCCTGGG + Intergenic
1134454212 16:14382306-14382328 ACACACACACACACAGACATGGG - Intergenic
1134501002 16:14769218-14769240 ACACACACACACACATACAAAGG - Intronic
1134505073 16:14798618-14798640 ACACATACACACACACACATTGG + Intronic
1134575502 16:15330295-15330317 ACACATACACACACACACATTGG - Intergenic
1134579581 16:15359832-15359854 ACACACACACACACATACAAAGG + Intergenic
1134592375 16:15465123-15465145 ACACACACACACCAATGAATTGG + Intronic
1134665939 16:16018672-16018694 ACACGTACACACAGATGCACAGG - Intronic
1134715124 16:16354366-16354388 ACACACACACACACATACAAAGG - Intergenic
1134723002 16:16397727-16397749 ACACACACACACACATACAAAGG - Intergenic
1134726943 16:16426201-16426223 ACACATACACACACACACATTGG + Intergenic
1134913922 16:18053275-18053297 ACACACACACACACACGCAGAGG - Intergenic
1134940494 16:18285654-18285676 ACACATACACACACACACATTGG - Intergenic
1134944426 16:18314144-18314166 ACACACACACACACATACAAAGG + Intergenic
1134951691 16:18354294-18354316 ACACACACACACACATACAAAGG + Intergenic
1135091225 16:19519427-19519449 GCACATACACACACATATATAGG - Intronic
1135229432 16:20691748-20691770 ACACACACACACACACACATTGG - Intronic
1135261426 16:20984158-20984180 ACACACACACACACACACATTGG - Intronic
1135620974 16:23955242-23955264 ACACACACACAGCCAGGCAAAGG + Intronic
1135626761 16:24002288-24002310 ACACACACACACCTGTGCTTTGG - Intronic
1135965827 16:27034232-27034254 CCTCAGACACACCCATGCATGGG - Intergenic
1136524499 16:30820455-30820477 ACACACACACACACACACATGGG + Intergenic
1137620698 16:49874781-49874803 ACACAGCCACACCCATGCATGGG - Intergenic
1137869757 16:51938646-51938668 ACACACACACACACATACATAGG + Intergenic
1137911788 16:52385019-52385041 ACACATACACGCACATACACGGG - Intergenic
1138532868 16:57644246-57644268 ACACATGCACAGTCATGCACGGG + Intronic
1138532877 16:57644388-57644410 ACATATGCACACTAATGCATGGG + Intronic
1138532884 16:57644490-57644512 ACATATGCACACTCATGCATGGG + Intronic
1138532892 16:57644624-57644646 ACACATGCACACTCATGCATGGG + Intronic
1138532902 16:57644774-57644796 ACATATGCACACTCATGCATGGG + Intronic
1138532909 16:57644870-57644892 ACACATGTACACTCATGCATGGG + Intronic
1138532911 16:57644921-57644943 GCACACACACACTCATGCACGGG + Intronic
1138532921 16:57644992-57645014 ACACATGCACACTCATGCATGGG + Intronic
1138709891 16:58959818-58959840 ACACACACACACCCCTACACGGG - Intergenic
1138767369 16:59620423-59620445 ACACATGCACACCCATATAAAGG - Intergenic
1138810268 16:60140804-60140826 ACACACACACACACATTCATCGG + Intergenic
1138815591 16:60199673-60199695 ACACATACAAGCACATGCACGGG - Intergenic
1138840818 16:60503031-60503053 ACACATACACACACATGCTTGGG - Intergenic
1138900789 16:61267393-61267415 ACTCATACAAACTCATGCAAAGG - Intergenic
1139075213 16:63438012-63438034 ACACACACACACATATACATAGG + Intergenic
1139209081 16:65058476-65058498 ACACATACACAGTCATCCCTGGG + Intronic
1139221166 16:65183732-65183754 ATATATACACACACACGCATAGG + Intergenic
1139230721 16:65279773-65279795 ACACACCCACACTCATTCATTGG + Intergenic
1139331408 16:66194801-66194823 ACACACACACACACACACATTGG + Intergenic
1140060564 16:71565713-71565735 ACACACACACACACTTACATAGG + Exonic
1140461919 16:75146794-75146816 AGGCATACACAGCCATGCCTGGG - Intergenic
1140569047 16:76080406-76080428 ACACACACACACACACACATAGG - Intergenic
1140760469 16:78104363-78104385 ACACACACACACACACCCATAGG + Intronic
1140934026 16:79653981-79654003 AAACACACACACACATGCAGAGG - Intergenic
1140955263 16:79858394-79858416 ACACACACACACACATACACTGG - Intergenic
1141344968 16:83236245-83236267 ACACACACACACACACACATAGG + Intronic
1142259105 16:89034145-89034167 GCACACACACACTCAAGCATGGG + Intergenic
1142875335 17:2849056-2849078 ACACATACACACACCTGCTCTGG - Intronic
1142887619 17:2922556-2922578 TCACACACACACCCTTGCAGTGG - Intronic
1143964171 17:10744857-10744879 ACACACACACACGCACACATAGG + Intergenic
1144092384 17:11869702-11869724 ACACATATACACACATGCTCCGG + Intronic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1144273361 17:13641497-13641519 ACACACACACACACAAACATGGG - Intergenic
1144701394 17:17343234-17343256 ACACACACACACATATGCACAGG - Intronic
1144709257 17:17389655-17389677 ACACACACACACACACGCATAGG - Intergenic
1145253675 17:21311053-21311075 ACACATGCACACACACGCAGTGG + Intronic
1145322911 17:21776908-21776930 ACACATGCACACACACGCAGTGG - Intergenic
1145903146 17:28500899-28500921 ATACGTACACACTCATGCAGAGG + Intronic
1146001159 17:29131339-29131361 GCACACACACACGCATGCCTCGG + Intronic
1146544268 17:33724848-33724870 ACACATACACACTCACACATTGG + Intronic
1146548548 17:33760627-33760649 ACACATACACAAATATGTATGGG + Intronic
1147163376 17:38580300-38580322 ACACATACACACCCCTCCCTGGG + Intronic
1147266386 17:39237261-39237283 ACACATACGCACACATGCACTGG - Intergenic
1147306633 17:39568728-39568750 ACACACACATGCCCCTGCATGGG + Intergenic
1147313666 17:39608606-39608628 ACACACACACGCCCATGCAGAGG - Intronic
1147702957 17:42407390-42407412 ACACACACACCCCTATACATAGG + Intronic
1147868298 17:43568910-43568932 ACACAATCATACCCATGCACAGG - Intronic
1147875785 17:43619482-43619504 ACACACACACACGTATGCACAGG + Intergenic
1148261271 17:46185719-46185741 ACACACACACACACACGGATAGG + Intronic
1148787477 17:50152307-50152329 ACCCACACACACCCCTGCAGTGG - Intergenic
1149056246 17:52369904-52369926 ACACATACACACACATTGTTAGG + Intergenic
1149286282 17:55168252-55168274 ACACACACACACACACGTATTGG + Intergenic
1149439357 17:56662113-56662135 ACACACACACACACACGCAGAGG + Intergenic
1149524542 17:57344648-57344670 ACATATACACACAGATACATGGG + Intronic
1149536954 17:57440701-57440723 TCACATCCACACCCATGCACAGG - Intronic
1149554510 17:57563766-57563788 ACACACACACACACACACATAGG + Intronic
1149630422 17:58117245-58117267 ACACACACACATGCATGCACAGG + Intergenic
1149791057 17:59477845-59477867 ATACACACACACACATTCATAGG - Intergenic
1149926877 17:60710225-60710247 ACACATACACACATACTCATGGG - Intronic
1150450399 17:65261957-65261979 ACACACACACACGCACGCACCGG - Intergenic
1150549951 17:66201017-66201039 CCACATACACACCCACACACAGG + Intergenic
1151023925 17:70655100-70655122 ACACACACACACACCTGCAAAGG - Intergenic
1151480062 17:74365101-74365123 ACACACACACACACATATATTGG + Intergenic
1151598566 17:75092816-75092838 ACACACACACACACACGCAGTGG - Intronic
1151907051 17:77055549-77055571 ACGCAGACACAGACATGCATAGG - Intergenic
1151991508 17:77577891-77577913 ACACACACACACACATGCGGAGG - Intergenic
1152999395 18:440387-440409 ACACACACACACACATACACAGG + Intronic
1153274746 18:3357316-3357338 ACACACACACACACATACAGAGG + Intergenic
1153302606 18:3604468-3604490 ACACATACACACAAAAGAATCGG + Intronic
1154012293 18:10585547-10585569 ACACACACACACACATGAAATGG - Intergenic
1155018862 18:21875743-21875765 ACACATACACACACACAAATGGG + Intergenic
1155088726 18:22484961-22484983 ACACATACACATACATGAAGGGG - Intergenic
1155206921 18:23566707-23566729 ACAAGTACACAAACATGCATGGG - Intronic
1155478274 18:26257832-26257854 ACACACACACACGCACGCAGAGG - Intronic
1155502058 18:26496752-26496774 ACACACACACACACACGCATTGG + Intronic
1155602094 18:27561583-27561605 ACACACACACACCTATGAAGTGG - Intergenic
1155605285 18:27598434-27598456 ACACACACACACACATACACAGG + Intergenic
1155605564 18:27601804-27601826 ACACACACACACATATGTATAGG - Intergenic
1155867667 18:30985871-30985893 ACACACACACAGACATGCACAGG - Intergenic
1155881961 18:31160865-31160887 ACACATACACATACATATATAGG - Intronic
1156068091 18:33170047-33170069 ACACACACACACAAATGCCTGGG - Intronic
1156799932 18:41098087-41098109 ATACATTCACACACATGTATGGG + Intergenic
1156812115 18:41265217-41265239 ACACACACACACACACACATTGG + Intergenic
1156840273 18:41602840-41602862 ACACACACACACACATGCACAGG + Intergenic
1157105033 18:44766087-44766109 ACACACACACACCCCAGAATGGG - Intronic
1157287257 18:46385375-46385397 ACACTCACACACACATGCACAGG - Intronic
1157954267 18:52078863-52078885 ACACATACACACACACACTTGGG - Intergenic
1158219800 18:55138875-55138897 ACACACACACACACATTCTTAGG - Intergenic
1158248849 18:55463939-55463961 ACACACACACACAGAGGCATGGG - Intronic
1158545771 18:58395234-58395256 ACACATACACACACACACAGAGG + Intronic
1158558177 18:58492214-58492236 ACACATGCACACACATACACAGG + Intronic
1158969765 18:62655695-62655717 ACACACACACACACAGGAATGGG + Intergenic
1159027535 18:63199109-63199131 ACACACACAGACCCATGTACAGG + Intronic
1159136565 18:64343675-64343697 ACACACACACACACATATATAGG + Intergenic
1159202394 18:65204258-65204280 ACACACACACACGCATGCACCGG - Intergenic
1160109151 18:76008439-76008461 ACACAAACACACTCAGGCACTGG + Intergenic
1160233131 18:77063887-77063909 ACACACACACACATATGTATAGG - Intronic
1160284377 18:77527009-77527031 ACAGAGACACACACATGCACAGG - Intergenic
1160389577 18:78519868-78519890 ACACAGAAACACACATGCATAGG + Intergenic
1160390205 18:78524181-78524203 ACACAGAAACACACATGCACAGG + Intergenic
1160392559 18:78546104-78546126 ACACATAGAGACACATGCACTGG - Intergenic
1160542326 18:79630983-79631005 ACACAAGCACACACATGCACAGG - Intergenic
1160621960 18:80177991-80178013 ACACACACACACAGAGGCATGGG + Intronic
1160738527 19:675695-675717 ACACACACACACACACGCAGTGG + Intergenic
1161198078 19:2998234-2998256 ACACACACACACACACACATTGG - Intronic
1161249805 19:3274494-3274516 AAACACACACACCCATGCGCGGG - Intronic
1161701745 19:5799692-5799714 ACACATACAGAGTCATACATAGG - Intergenic
1161972807 19:7592246-7592268 ACACACACACACACATACATAGG - Intergenic
1162171209 19:8790513-8790535 ACACACACACACGCTTTCATAGG + Intergenic
1162701574 19:12519202-12519224 ACAACTACACACCAATGAATTGG + Intronic
1162711973 19:12602114-12602136 ACACACACACACACATATATGGG + Intronic
1162957946 19:14110002-14110024 ACACACACACACACACACATAGG + Intronic
1162969320 19:14170583-14170605 ACACATGTGCACACATGCATGGG - Intronic
1163736871 19:18987047-18987069 ACAGACATACACACATGCATAGG - Intergenic
1164187398 19:22882442-22882464 ACACAAACACACACAAGCAGTGG - Intergenic
1164398817 19:27888875-27888897 ACACAAACATGCACATGCATAGG - Intergenic
1164438656 19:28254480-28254502 ACACACACACACACATTAATTGG + Intergenic
1164483640 19:28636115-28636137 ACACACACACACACACGCAGAGG + Intergenic
1164709192 19:30343328-30343350 ACAAATATACACACATGCAGAGG - Intronic
1164913939 19:32034804-32034826 ACACACACACACACAGGCACAGG + Intergenic
1165156186 19:33789967-33789989 ACACAGATACACACATGCAGTGG - Intergenic
1165573244 19:36792726-36792748 ACACACATACACACATGCAGTGG - Intergenic
1165941718 19:39417825-39417847 ACACATACACACCAAAACAGGGG - Intronic
1166199873 19:41230696-41230718 ACACAGACACACACAGGCACAGG - Intronic
1166458122 19:42961379-42961401 ACACATAAACACCCAGGAACAGG + Intronic
1166872551 19:45879552-45879574 ACACATGCACACACAGTCATCGG + Intergenic
1167094714 19:47368605-47368627 ACACACACACACACATTCAATGG - Intronic
1167189253 19:47972814-47972836 ACACACACACACGCATATATAGG - Intronic
1167762993 19:51461084-51461106 ACACACACACACCCAAGCATTGG - Intergenic
1167936916 19:52916519-52916541 ACATATACACACACATATATAGG - Intergenic
1168317006 19:55488869-55488891 ACACACACACACACACACATGGG - Intronic
1168323845 19:55527161-55527183 ACTCACACACACTCATGCACAGG + Intergenic
1168477583 19:56688122-56688144 ACACACACACACACATGCACAGG - Intergenic
925088055 2:1127684-1127706 ACACATACACACACACCCCTTGG - Intronic
925197111 2:1934756-1934778 ACACACACACACACAGGCACAGG + Intronic
925223074 2:2158633-2158655 ACACACACACACACACGCGTAGG + Intronic
925424959 2:3741689-3741711 ACACATACACACACACACATAGG + Intronic
925465036 2:4099560-4099582 ACACATACACACACATACAGAGG + Intergenic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
925707406 2:6699767-6699789 TCACATACACACACATACACAGG - Intergenic
925821639 2:7804914-7804936 ACACACACACACACATGCGTGGG + Intergenic
926357629 2:12056083-12056105 ACACAGACACAGACATGCAGAGG - Intergenic
926397465 2:12458705-12458727 ACACACACACACACATTGATGGG - Intergenic
926418256 2:12672126-12672148 ACACACACACACTCATGCTGTGG - Intergenic
926757458 2:16247740-16247762 CCACATCTCCACCCATGCATTGG - Intergenic
927009403 2:18887287-18887309 ACACACACACACACACGCAGAGG + Intergenic
927056299 2:19368619-19368641 AGACAGATACACCCATGCCTGGG + Intergenic
927516297 2:23673705-23673727 ACACACACACACCCCTACACAGG + Intronic
927635443 2:24812524-24812546 AAACAAAAACACCCATACATGGG - Intronic
928236806 2:29549170-29549192 ACACGGACACACACATGCACAGG + Intronic
928327478 2:30331075-30331097 ACACACACACATGCTTGCATGGG - Intergenic
928327563 2:30332274-30332296 ACACACACAGACACATGCACAGG - Intergenic
928359140 2:30648832-30648854 ACATATACACACGTGTGCATAGG - Intergenic
928392554 2:30920645-30920667 ACACACACACACACACACATAGG + Intronic
928736180 2:34292454-34292476 ACACATACACACACACACACTGG + Intergenic
928739331 2:34331634-34331656 ACACACACACATGCATGCACGGG - Intergenic
928776281 2:34767696-34767718 ACACACACACACGCACACATTGG + Intergenic
928966667 2:36982896-36982918 ACACACACACACACACGTATAGG + Intronic
929303143 2:40329086-40329108 ACACACACACACACACGCACTGG + Intronic
929437328 2:41938763-41938785 ACACACACACACACACGCACAGG - Intronic
929592279 2:43155071-43155093 ACACACACACACACATACAATGG + Intergenic
929768114 2:44867715-44867737 ACACACACACACACACACATTGG + Intergenic
930069517 2:47354611-47354633 ACACAAACACACCTCTGCCTGGG + Intronic
930287316 2:49447040-49447062 ACACATACACACACACACAATGG + Intergenic
930386669 2:50705066-50705088 ACACACACACACCCATCCCCAGG + Intronic
930450000 2:51523713-51523735 ACACACACACACACATACAAAGG - Intergenic
930623673 2:53671347-53671369 ACACACACACACACACGCTTTGG - Intronic
930764015 2:55065665-55065687 ACACATACACACACACGCAAAGG + Intronic
930880920 2:56269324-56269346 ACACACACACACCCTTGCCAAGG - Intronic
930988748 2:57624597-57624619 ACACACACACACACATGAAATGG + Intergenic
931200378 2:60092028-60092050 ACACATACACACACACACAGAGG + Intergenic
931263801 2:60642726-60642748 ACACACACACATCAATGCCTGGG + Intergenic
931823933 2:65979764-65979786 ACACACACACACACACACATGGG - Intergenic
933024656 2:77241228-77241250 ACACACACACACACACACATGGG + Intronic
933279908 2:80322330-80322352 GCACATCTACACCCATTCATGGG - Intronic
933417627 2:82006690-82006712 ACACACACACACACACACATAGG - Intergenic
933421854 2:82057890-82057912 ATACACACACATACATGCATAGG + Intergenic
933489570 2:82968344-82968366 ACACATACACACACACACACAGG + Intergenic
933498913 2:83087441-83087463 ACACACACACACACACACATTGG + Intergenic
933813768 2:86049731-86049753 ACACAGACACACCCGAGCCTGGG + Intronic
933814618 2:86055643-86055665 ACAGAAACACACCCATCCAAGGG + Intronic
934559967 2:95308049-95308071 ACACACAAGCACACATGCATAGG - Intronic
934791689 2:97067677-97067699 ACACAAACAGACTAATGCATTGG + Intergenic
935152890 2:100454191-100454213 ACACATACACACACACACCTTGG - Intergenic
935255387 2:101305673-101305695 ACACACACAGACACATACATGGG + Intronic
935440130 2:103083707-103083729 ACACATACACACACATACACAGG + Intergenic
935571464 2:104665423-104665445 ACACACACACACACATACACAGG + Intergenic
936247152 2:110838102-110838124 ACACATGCACACTCATATATAGG - Intronic
936249147 2:110854088-110854110 AGACATGCACACACATGCCTTGG - Intronic
936451582 2:112637599-112637621 ACACACACACACACACACATAGG - Intergenic
936495982 2:113021417-113021439 ACACATACATACAGATGCACAGG + Intergenic
936706821 2:115085299-115085321 ACACATACACATACACACATTGG - Intronic
937840108 2:126516440-126516462 ACACATTCACACACATGCAATGG - Intergenic
938381747 2:130840113-130840135 ACACACACACAGGCATACATAGG + Intronic
939210694 2:139171628-139171650 ACACACACACACACATCCAGTGG - Intergenic
939230610 2:139421069-139421091 ACACAAACACACACACACATAGG + Intergenic
939592512 2:144082896-144082918 ACACACACACACACATGCACAGG + Intronic
939896163 2:147793561-147793583 ACACACACACACACATACACAGG + Intergenic
940064673 2:149613985-149614007 ACACACACACACACATACAAGGG - Intergenic
940173503 2:150853544-150853566 ACACATACACACACACACAGTGG - Intergenic
940332509 2:152490566-152490588 ACACACACACACACACACATTGG - Intronic
940431619 2:153598088-153598110 TTACATACACACACATGCACGGG - Intergenic
940474343 2:154142813-154142835 ACACACACACACATATGCACAGG - Intronic
940859767 2:158759679-158759701 ACACATCCACCCCCGTGGATAGG - Intergenic
940974209 2:159925290-159925312 ACACATACGCACCCCTACAATGG - Intergenic
941380719 2:164789053-164789075 ACACACACACACAGATGCAGTGG + Intronic
941440566 2:165529613-165529635 ATACATATACACACATGCATAGG + Intronic
942573687 2:177339761-177339783 ACACATACACACACATACACTGG - Intronic
943398606 2:187374854-187374876 ACACACACACACACATCCCTGGG + Intronic
943524192 2:188996239-188996261 ACACACACACACTCAAGGATAGG - Intronic
943698788 2:190966594-190966616 ACACACACACATCCATGGATAGG + Intronic
943757848 2:191575744-191575766 ACACACACACACCCCTGGATGGG + Intergenic
943766287 2:191665880-191665902 ACACACACACACACATAAATTGG + Intergenic
944085808 2:195846942-195846964 ACACACACACACACATATATGGG - Intronic
944380195 2:199100334-199100356 ACACATACACACAGGTCCATAGG - Intergenic
944932821 2:204537298-204537320 ACTCAAAGACAGCCATGCATAGG - Intergenic
944980472 2:205113383-205113405 ACACACACACACCCCTGCTCAGG - Intronic
945543245 2:211115641-211115663 ACACACACACACACATATATAGG + Intergenic
945648793 2:212536185-212536207 ACACAGCCACACACATACATAGG + Intronic
945681086 2:212915490-212915512 ACACATATACACCCCTACCTTGG + Intergenic
945854507 2:215052619-215052641 ACACACACACACAAATGCACAGG + Intronic
946477899 2:220026308-220026330 ACACATACACACTCACACATCGG - Intergenic
946624797 2:221599845-221599867 ACATATACACACACATACACAGG - Intergenic
946686850 2:222279298-222279320 ACACACACACACACACGCACAGG - Intronic
947101921 2:226630299-226630321 ACACAGACACATCCGTGCTTGGG - Intergenic
947165688 2:227259473-227259495 ATACATATACACACATACATAGG + Intronic
947238063 2:227964611-227964633 CCACATACACACCTATGCCTAGG - Intergenic
947522050 2:230853886-230853908 ACACACACACACACACGCACAGG + Intergenic
947543941 2:230997444-230997466 ACAAATACAGGCCCATGGATAGG + Intronic
947641886 2:231711494-231711516 ACACATACACACACATATATAGG - Intronic
947711063 2:232316099-232316121 ACACAGACACACCAATGCCAGGG - Intronic
947939803 2:234042057-234042079 ACAATTACACGCCAATGCATTGG + Intergenic
948097128 2:235344133-235344155 ACACATGCACACTCATACACAGG + Intergenic
948188324 2:236038812-236038834 ACACACACACACACATACAAAGG - Intronic
948617109 2:239206400-239206422 ACACACACACACACACACATGGG + Intronic
948639432 2:239365582-239365604 ACACACACACACACTTGCACAGG + Intronic
948833923 2:240615110-240615132 ACACACACACACACAAGCACAGG - Intronic
949029533 2:241785864-241785886 ACACACACACACACATCCCTTGG + Intronic
1168741537 20:195739-195761 ACACACACACACACACGAATGGG - Intergenic
1169581245 20:7025829-7025851 ACACACACACACACACGAATAGG - Intergenic
1169603293 20:7286781-7286803 ACACATACACACACACAGATAGG - Intergenic
1169644787 20:7798067-7798089 ACACATAGACATACATGCAAGGG + Intergenic
1170048759 20:12115957-12115979 AAACATGCAAACACATGCATAGG - Intergenic
1170210777 20:13844403-13844425 ACACACACACACCCTCACATTGG - Intergenic
1170385862 20:15816019-15816041 ACACAAACACACACACGCAGAGG - Intronic
1170433522 20:16299213-16299235 ACACACACACACGCACACATGGG - Intronic
1170489844 20:16861894-16861916 ATGCATACACACCCAGCCATGGG - Intergenic
1170906787 20:20523272-20523294 ACACATACACACTGATGACTAGG - Intronic
1170967587 20:21089087-21089109 ACACATGCACACACATACACGGG - Intergenic
1171139128 20:22725587-22725609 GCACATACACACACATGAACAGG - Intergenic
1171281239 20:23900735-23900757 CCACATACAGAGACATGCATAGG - Intergenic
1171349740 20:24493451-24493473 ACAGGTACACACACATACATGGG + Intronic
1171528102 20:25831511-25831533 ACACACACACACACAGGCAATGG - Intronic
1171545344 20:25996683-25996705 ACACACACACACACACGCAATGG + Intergenic
1171548724 20:26024369-26024391 ACACACACACACACAGGCAATGG + Intergenic
1172434523 20:34919568-34919590 ACACACACACACACTTGCCTTGG - Exonic
1172846532 20:37932863-37932885 ACACATTCACAAACACGCATTGG + Intronic
1172931746 20:38591333-38591355 ACACATGCACACTCATACAGAGG + Intergenic
1173124359 20:40322989-40323011 ACACAGCCACACTCATTCATAGG + Intergenic
1173130947 20:40392786-40392808 ACACATACACACACATAGGTAGG - Intergenic
1173354306 20:42272733-42272755 ACACACACACACACATACAGTGG + Intronic
1173355302 20:42281589-42281611 ACACATACACATACATACTTGGG + Intronic
1173368206 20:42408379-42408401 ACACATACACACACACGCACGGG - Intronic
1174080564 20:47968402-47968424 ACACAGACCCACACAGGCATGGG + Intergenic
1174941967 20:54939240-54939262 ACACATACACACATATTCAGAGG - Intergenic
1175066464 20:56293056-56293078 ACACACACACACACACACATTGG - Intergenic
1175438263 20:58971074-58971096 ACACATTCTCACTCATACATGGG + Intergenic
1175601100 20:60273889-60273911 ACACATACACACACAGACACAGG + Intergenic
1176228996 20:64021283-64021305 ACACACACACACACACGCACGGG - Intronic
1176229010 20:64021453-64021475 ATACATGCACACACATGCACGGG - Intronic
1176896871 21:14389989-14390011 ACACACACACACACATCAATTGG - Intergenic
1177173969 21:17683817-17683839 ACACACACACACACACACATTGG - Intergenic
1177302527 21:19267495-19267517 ACACACACACACACACACATAGG - Intergenic
1177338232 21:19761600-19761622 ACATACACACACACATCCATTGG - Intergenic
1177613026 21:23477794-23477816 ACACACACACACACATGCAGGGG - Intergenic
1177676158 21:24302670-24302692 ACACAGACACACACATACATGGG - Intergenic
1177876583 21:26639687-26639709 ACACATAGACACCCACACACTGG - Intergenic
1178212520 21:30552721-30552743 ACACACACACACACATTCAAAGG - Intronic
1178716075 21:34965727-34965749 ACACACACACACCCAGGCAGGGG + Intronic
1178837875 21:36113683-36113705 ACACACACACACACACGCAGAGG + Intergenic
1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG + Intronic
1179174360 21:38996594-38996616 ACACATGCACACACATTCATGGG - Intergenic
1179326937 21:40356022-40356044 ATACATATACACACATGCATAGG - Intronic
1179581303 21:42346242-42346264 ATATACACACACCCATACATGGG + Intergenic
1179651133 21:42809636-42809658 ACACATGCACATGCACGCATAGG + Intergenic
1179836218 21:44035408-44035430 ACACACACACATCCATGTCTTGG - Intronic
1180172852 21:46069207-46069229 ACACATGCACACACATGGACTGG - Intergenic
1180195818 21:46193354-46193376 ACACATACATACGCATGCACAGG - Intronic
1180195825 21:46193475-46193497 ACACATACATACGCATGCACAGG - Intronic
1180195846 21:46193715-46193737 ACACATACATACGCATGCACAGG - Intronic
1180704372 22:17799968-17799990 ACACACACACACACACGCGTTGG + Intronic
1180917964 22:19502502-19502524 CCACATACACACACATACAAAGG + Intronic
1181003979 22:20000979-20001001 ACACAAGCACACCCAGGCACAGG + Intronic
1181048023 22:20224804-20224826 TCACATACACACGCACACATGGG + Intergenic
1181287142 22:21761049-21761071 ATACATACGCACACATGCTTTGG - Exonic
1181608837 22:23999235-23999257 ACCCACACACACCCATTCTTGGG - Intergenic
1181916192 22:26282263-26282285 CAACATACATACCCATCCATAGG - Intronic
1182005842 22:26958934-26958956 AAACATCAACATCCATGCATAGG + Intergenic
1182118421 22:27771634-27771656 ACACAGCCACACCCATCCATTGG + Intronic
1182350181 22:29695089-29695111 ACACACACACACCGGTGCCTTGG - Exonic
1182774427 22:32820347-32820369 ACACACACACACACACGCAGTGG - Intronic
1182885184 22:33767774-33767796 ACACAAACACACACATATATGGG + Intronic
1183379751 22:37484968-37484990 ACACACACACACACACACATCGG - Intronic
1183519986 22:38291348-38291370 ACACACACACACACACGCAGGGG + Exonic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1184990631 22:48167065-48167087 ACTCATGCACACACATGCACGGG + Intergenic
1185153757 22:49181004-49181026 GTACACACACACCCATGCACAGG + Intergenic
1185285619 22:49998570-49998592 ACATACACACACCCATGCACAGG - Intronic
1185285637 22:49998688-49998710 ATGCACACACACCCATGCACAGG - Intronic
949464033 3:4325621-4325643 ACACACACACATATATGCATAGG + Intronic
949560426 3:5196470-5196492 ACACACACACACACAAGAATTGG + Intronic
949617453 3:5769897-5769919 ACACACACACACCCATAAAACGG + Intergenic
949659195 3:6258015-6258037 ACACACACACACACATACATGGG + Intergenic
949861676 3:8510946-8510968 AAATATACACATCTATGCATAGG + Intronic
949951474 3:9232539-9232561 ACACATACACACACACACTTTGG + Intronic
949953577 3:9249301-9249323 ACACACACTCACGCATGCACAGG + Exonic
950138110 3:10597109-10597131 ACACGCACACACACATGCACAGG + Intronic
950138117 3:10597187-10597209 AGACATACACACACAGGCACAGG + Intronic
950141162 3:10616684-10616706 ACACACACACACACACTCATTGG + Intronic
950448748 3:13053953-13053975 ACACATCTACACCCAGGCACAGG - Intronic
950478701 3:13231262-13231284 ACACAGACACACACACGCACGGG - Intergenic
950685304 3:14613304-14613326 ACACACACACACGCATACAATGG - Intergenic
951353760 3:21638903-21638925 AAGCATACACACATATGCATTGG + Intronic
952088852 3:29859860-29859882 ATACATACACACATATGCATGGG + Intronic
952199179 3:31108177-31108199 ACAGACACACACACATGCACCGG + Intergenic
952276528 3:31882671-31882693 ACACACACACACACACGCACTGG + Intronic
952595116 3:35008180-35008202 ACACACACACACTCATACACAGG + Intergenic
952615634 3:35269443-35269465 ACATATACACACACATACATAGG - Intergenic
953000572 3:38929159-38929181 ACACACACACACACATGTTTGGG + Intronic
953374437 3:42416975-42416997 ACACATACACCCCCATGCCCCGG + Intergenic
953448211 3:42985536-42985558 ACACACACACACGTATGCACAGG - Intronic
953849307 3:46454079-46454101 CCTCATAGACACCCATGCCTAGG - Intronic
954898551 3:53998580-53998602 ACACACACACACCCTTGAAAGGG + Intergenic
955125919 3:56112449-56112471 ACACACACACACACACACATTGG + Intronic
955393884 3:58541617-58541639 ACACACACACACACAGGCTTAGG - Intergenic
955505991 3:59633685-59633707 ACACACACACACACATGCTTAGG - Intergenic
957278621 3:78121523-78121545 ACACACACACACACATATATAGG - Intergenic
957430302 3:80096269-80096291 ACACACACACACACAGGCACAGG - Intergenic
957670816 3:83300386-83300408 ACACAGGCACACTCATGCACAGG + Intergenic
957726527 3:84073471-84073493 ACAGATAGACACCCAACCATGGG + Intergenic
957956745 3:87197171-87197193 ACAAACACACCCCCATGCACTGG + Intergenic
957979646 3:87492366-87492388 ACACACACACACACACACATAGG - Intergenic
958081800 3:88755343-88755365 ACACATACACACACACACAGTGG + Intergenic
958124855 3:89342881-89342903 ACACACACACACACAAACATTGG + Intronic
958471769 3:94530449-94530471 ACACACACACACACACGCAGAGG + Intergenic
958506161 3:94979702-94979724 ACACATACACACATATACATGGG - Intergenic
958516936 3:95128509-95128531 ACACACACACACACATGCCCAGG - Intergenic
958574702 3:95933827-95933849 ACACACACACACACATACAGAGG - Intergenic
958767291 3:98384818-98384840 ACACACACACACCCAAGTTTTGG + Intergenic
958865529 3:99497292-99497314 ACACACACACACACACGCAATGG + Intergenic
959497787 3:107071610-107071632 ACACATACACACAAATGAAATGG + Intergenic
959560852 3:107779025-107779047 ACACACACACACATATACATTGG + Intronic
959594890 3:108119072-108119094 ACACACACACACAAATGCAAAGG - Intergenic
959791085 3:110362281-110362303 TCATATACACATGCATGCATGGG + Intergenic
959793042 3:110387735-110387757 ACACACACACACACACGCAGTGG + Intergenic
959929716 3:111966498-111966520 ACACACACACACACACACATGGG - Intronic
960281869 3:115789298-115789320 ACACACACACACACACACATTGG - Intergenic
960408290 3:117289103-117289125 ACACACACACACACACGCATAGG - Intergenic
960453866 3:117845361-117845383 ACACATACACATACATACACAGG - Intergenic
961574379 3:127822962-127822984 ACACACACACACGCACACATGGG + Intronic
961683026 3:128611664-128611686 ACACAGACACACACACACATGGG + Intergenic
962429854 3:135308920-135308942 ACACATACACATCATTCCATGGG - Intergenic
963572784 3:147018255-147018277 ACACAGACACACACATACACAGG - Intergenic
963715246 3:148795703-148795725 TCAAATACACAACCATACATTGG + Intronic
963956971 3:151264760-151264782 ACACATACACACACACGCACTGG - Intronic
964329014 3:155579925-155579947 ACACATACACACACATGCAGAGG + Intronic
964812632 3:160682448-160682470 ACACACACACACACACACATAGG + Intergenic
964834910 3:160927603-160927625 ACACACACACACACACACATAGG - Intronic
964911605 3:161789495-161789517 ACACACACACACACACGGATTGG + Intergenic
965011859 3:163103770-163103792 ACACATACACATACACACATGGG - Intergenic
965132696 3:164722315-164722337 ACACACACACACACATGCCATGG - Intergenic
965284395 3:166799635-166799657 ACACATACACACACATATATAGG - Intergenic
965350412 3:167605114-167605136 ACACACACACACACATACACAGG + Intronic
965453185 3:168863795-168863817 ACCCAGTCACACACATGCATGGG - Intergenic
965477257 3:169172400-169172422 ACACACACACACACATACAAGGG - Intronic
966029555 3:175328213-175328235 CCACATACACACCCATGTGTGGG + Intronic
966207391 3:177419293-177419315 ACACACACCCACCCCTGCACGGG - Intergenic
966763158 3:183434874-183434896 ACACATACACCCCTATGCCAGGG - Intergenic
966922146 3:184619469-184619491 ACAGATACACACACATGCATGGG + Intronic
967495431 3:190138806-190138828 ACACACACACACACATGTAGTGG - Intergenic
967843396 3:194025124-194025146 ACACATACACACACACAAATAGG - Intergenic
967956382 3:194880640-194880662 ACAAACACACTCTCATGCATTGG + Intergenic
968288716 3:197522984-197523006 CCACAGACACAACCATGAATAGG + Intronic
968422204 4:495412-495434 ACACATACACACCCAATTCTTGG + Intronic
969184015 4:5462377-5462399 ACACACACACACAGATGCACAGG - Intronic
969321218 4:6414069-6414091 ACACACACACACACATACACAGG - Intronic
969411012 4:7028172-7028194 GCACATACACACCCACGTACAGG + Intronic
969739522 4:9014044-9014066 ACACATACACACTCAGGCTCAGG - Intergenic
969798699 4:9545578-9545600 ACACATACACACTCAGGCTCAGG - Intergenic
969815826 4:9686803-9686825 TGACATACACAGCCATTCATCGG + Intergenic
970211250 4:13712019-13712041 ACACACACACACTCATACACTGG - Intergenic
970919827 4:21380844-21380866 ACACACACACACACACGAATTGG + Intronic
971347801 4:25827372-25827394 ACACAGACACACCCATGGGGAGG + Intronic
971736644 4:30461651-30461673 ACACACACACACACGTGGATAGG + Intergenic
971800033 4:31277475-31277497 ACATACACACACGCACGCATGGG - Intergenic
971863656 4:32141037-32141059 ACACATACACACACAGGACTGGG - Intergenic
971917790 4:32896171-32896193 ACACACACACACACACACATTGG + Intergenic
972243497 4:37219879-37219901 ATATATACACACACATGAATGGG - Intergenic
972855679 4:43103836-43103858 ACACACTCACACACATGTATAGG - Intergenic
972955126 4:44379543-44379565 ACACATACACACACCTGCAATGG - Intronic
973184721 4:47312030-47312052 ACACACACACACACAAGCCTTGG - Intronic
973218097 4:47694452-47694474 ACACACACACACACAAGCTTTGG - Intronic
974022061 4:56700551-56700573 ACACACACACACACATCCATTGG + Intergenic
974178260 4:58352762-58352784 ACACACACACACACACACATAGG - Intergenic
974242174 4:59263866-59263888 ACACACACACACACACGCACAGG + Intergenic
974254963 4:59440181-59440203 ACACACACACACACATTCATAGG - Intergenic
974298819 4:60039081-60039103 ACACATATAGACACATACATAGG - Intergenic
974361848 4:60891172-60891194 ACACACACACACAAATGAATTGG + Intergenic
974431727 4:61806346-61806368 ACACATACACACACACACCTTGG - Intronic
974601777 4:64092558-64092580 ACACACACAAACGCAAGCATAGG - Intergenic
974715594 4:65666986-65667008 ACACATACACACACAGTCTTTGG + Intronic
975422731 4:74187817-74187839 ACACACACACACACACACATTGG + Intronic
975506183 4:75140905-75140927 AGACACACACACGCTTGCATGGG + Intergenic
975866079 4:78724844-78724866 ACACACACACACACATGAATTGG - Intergenic
975871724 4:78786402-78786424 ACACACACACACACACACATTGG - Intronic
975993289 4:80283539-80283561 GCACACACACACTCATGCACAGG - Intronic
976610526 4:87025796-87025818 ACACAAACATCCCCATGCATAGG - Intronic
976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG + Intronic
977435775 4:96992423-96992445 ACACACACACACACACGCAATGG + Intergenic
977662408 4:99605862-99605884 ACACACACACACACATACATGGG - Intronic
977857541 4:101912049-101912071 ACACATACACACACACACAGAGG + Intronic
978146118 4:105373785-105373807 ACACACACACACCCCATCATAGG + Intronic
978179673 4:105777279-105777301 ATATATACACACACATACATCGG - Intronic
978180092 4:105783567-105783589 ACACATACACACATATACAGAGG - Intronic
978279602 4:106994501-106994523 ACACACACACACACACACATAGG + Intronic
978971319 4:114810036-114810058 ACACACACACACACAAACATAGG + Intergenic
979006890 4:115310300-115310322 ACACACACACACACATATATAGG + Intergenic
979127489 4:116993363-116993385 ACACACACACACACACGCACGGG - Intergenic
979134754 4:117096219-117096241 GCATATACACACACATGCAGAGG + Intergenic
979320918 4:119324107-119324129 ACATATACACACTCATGAGTTGG + Intergenic
979664819 4:123299114-123299136 ACACACACACACACACACATTGG - Intronic
979852054 4:125584267-125584289 ACACACACACACATATACATAGG + Intergenic
980064710 4:128172934-128172956 ACACACACACACACACACATTGG - Intronic
980273366 4:130615858-130615880 ACACACACACACACACGCAGGGG - Intergenic
980274436 4:130631312-130631334 TCACACACACACACATGCAAAGG + Intergenic
980501370 4:133658634-133658656 ACACACACACACACACGGATTGG + Intergenic
980737210 4:136905692-136905714 ACACACACACACACACACATTGG + Intergenic
980829564 4:138113406-138113428 ACACATAAACACACATACATAGG - Intergenic
981004534 4:139861474-139861496 ACACACACACACACACACATCGG - Intronic
981065522 4:140480771-140480793 ACACACACACACACACGCAGTGG + Intronic
981250360 4:142593876-142593898 ACACACACACACACACGCACAGG + Intronic
981419688 4:144534916-144534938 ACACACACACACACATGCACAGG - Intergenic
981862231 4:149370581-149370603 ACACACACACACCCTTATATGGG + Intergenic
982772312 4:159408046-159408068 ACACACACACACACACACATAGG - Intergenic
982835061 4:160112989-160113011 ACATACACACACACATGTATGGG - Intergenic
982970805 4:161983224-161983246 ACACAGACACACCCCTGACTTGG - Intronic
983279358 4:165660788-165660810 ACATATACACACCAATGCTTTGG + Intergenic
983650399 4:170031294-170031316 ACACATGCACACCCCTCCAAGGG - Intronic
984451528 4:179909796-179909818 ACACACACACACCCCTACAGAGG - Intergenic
984978327 4:185251592-185251614 ACACACACACACACACGCAATGG - Intronic
1202766825 4_GL000008v2_random:155130-155152 ACACATACACACACACACACAGG - Intergenic
985848121 5:2368919-2368941 ACACATGCACATACATGCATGGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
985848140 5:2369380-2369402 ACACATGCAAACACATGCATGGG + Intergenic
985848142 5:2369419-2369441 ACACATGCAAACACATGCACGGG + Intergenic
985848144 5:2369458-2369480 ACACATGCAAACACATGCACAGG + Intergenic
985848146 5:2369497-2369519 ACACATGCAAACACATGCACGGG + Intergenic
985916933 5:2929188-2929210 ACACATATGCACACATACATAGG - Intergenic
985986367 5:3520066-3520088 ACATGCACACACACATGCATGGG + Intergenic
986053709 5:4114823-4114845 ATGCAGACACACACATGCATAGG + Intergenic
986081937 5:4403846-4403868 ACACATGCACATACATGCAAAGG - Intergenic
986188479 5:5469245-5469267 AAACATATACACCTATGCGTGGG - Intronic
986234097 5:5891886-5891908 ACACACACACACACACCCATGGG - Intergenic
986277322 5:6288206-6288228 AGACACACACACCCATTCATAGG + Intergenic
986354151 5:6907389-6907411 CCACAAACCCACCCATCCATTGG - Intergenic
986394858 5:7318798-7318820 AGACAGACACATACATGCATAGG + Intergenic
986461865 5:7980741-7980763 ACACACACACACACATGCACAGG + Intergenic
986745432 5:10739805-10739827 ACACACACACACACACGAATGGG + Intronic
986923000 5:12710568-12710590 ACATGTACACACACATGCATGGG - Intergenic
986987694 5:13517483-13517505 ACACACACACACACATATATGGG - Intergenic
987125188 5:14805367-14805389 ACACATACACACATATATATAGG - Intronic
987505126 5:18759225-18759247 ACACATACACACACACACAATGG - Intergenic
987927189 5:24357529-24357551 AAACATACACAATCATGCATTGG - Intergenic
987942258 5:24554467-24554489 ACACACACACACACACGAATAGG - Intronic
988104774 5:26730445-26730467 ACACACACACACCGATTCATGGG - Intergenic
988159374 5:27500251-27500273 ACACATACACACATATATATAGG - Intergenic
988283318 5:29177750-29177772 ACACACACACACACACACATAGG + Intergenic
989972663 5:50543319-50543341 TCACATGCAGACACATGCATAGG + Intergenic
990128233 5:52545956-52545978 ACACACACACACACATACACAGG + Intergenic
990620809 5:57556631-57556653 ACACACACACACACATAAATGGG - Intergenic
990649547 5:57882742-57882764 ATATATACACACACATACATAGG + Intergenic
990725451 5:58748587-58748609 ACACACACACACACACCCATGGG - Intronic
990793814 5:59516921-59516943 AAACATACATACACATACATAGG + Intronic
991506635 5:67331304-67331326 ACACACACACACACACGCAAAGG - Intergenic
991715729 5:69449318-69449340 ACACACACACACACAGGCTTGGG - Intergenic
991954259 5:71976689-71976711 ACACACACACACACATGCAATGG - Intergenic
992511647 5:77442430-77442452 ACACATGTACACACATACATAGG + Intronic
992768092 5:80021451-80021473 ACACATACACACATATGTATAGG + Intronic
993203809 5:84851894-84851916 ACACACACACACACGTGAATAGG + Intergenic
993395399 5:87380900-87380922 ATACATACACACACATTGATTGG + Intronic
993506900 5:88720209-88720231 ACTCATACACACACACGCACAGG - Exonic
993638863 5:90378506-90378528 ATGCACACACCCCCATGCATGGG - Intergenic
993649239 5:90498148-90498170 ACACACACACACACATACATGGG - Intronic
993749072 5:91644471-91644493 ACACATACACACACAGACAGAGG - Intergenic
994161559 5:96562195-96562217 ACACACACACACAAATCCATAGG + Intronic
994252059 5:97547440-97547462 ACACATAAACACATCTGCATAGG + Intergenic
994525610 5:100901864-100901886 ACACATACACACACACGCAAGGG + Intronic
995319457 5:110816206-110816228 ACACACACACACACACACATAGG + Intergenic
995552241 5:113293239-113293261 ACACACACACACCCCCGCAGGGG + Intronic
995744146 5:115386168-115386190 ACACACACACATCCAGACATGGG + Intergenic
996042357 5:118829720-118829742 ACACACACACACACACACATAGG - Intergenic
996124925 5:119713512-119713534 ACACACACACACACATATATAGG - Intergenic
996244212 5:121240515-121240537 ACACATACAAACACATACATAGG + Intergenic
996450257 5:123613404-123613426 ACACACACACACACATGCACTGG - Intronic
996770930 5:127084752-127084774 AGACACACACACACATGCTTGGG - Intergenic
997636023 5:135407031-135407053 ACATATACATACACATACATAGG - Intergenic
997719595 5:136066946-136066968 ATGCACACACACCCCTGCATGGG + Intergenic
997811007 5:136970105-136970127 ACACACACACACACATCCAAAGG - Intergenic
998267507 5:140677200-140677222 ATATGTACACACACATGCATGGG - Intronic
998963324 5:147510751-147510773 ACACACACACACACATTCTTAGG + Intergenic
999267125 5:150273906-150273928 ACACAGACACATGCATACATAGG - Intronic
999322276 5:150622994-150623016 TCAGACACACATCCATGCATGGG + Intronic
999333825 5:150697977-150697999 ACACACACACACACGTGCACTGG + Intronic
999374258 5:151075936-151075958 CCACACACACACCCCTGCCTGGG + Intronic
999445549 5:151635966-151635988 ACACACACGCACACATGCACAGG + Intergenic
999623955 5:153500641-153500663 ACACACACACACACATTCAGAGG + Intronic
999637969 5:153642016-153642038 ACACATACACACCTATTCTTTGG - Intronic
999689381 5:154133775-154133797 ACACACACACACCCCAGCACAGG + Intronic
999970807 5:156860305-156860327 ACACTTTCACATTCATGCATTGG - Intergenic
1000362262 5:160458694-160458716 ACACACACACACACACACATTGG - Intergenic
1000852104 5:166353130-166353152 ATACATACACACCTATACAATGG - Intergenic
1001118863 5:168962332-168962354 ACACATACACACACACACAGTGG + Intronic
1001207812 5:169780288-169780310 ACACACACACACACATTTATTGG - Intronic
1001721876 5:173863561-173863583 AAGCATACACACACATGCAGAGG + Intergenic
1002270749 5:178070456-178070478 ACACATACACATACATACACAGG - Intergenic
1002392608 5:178927660-178927682 ACACACACACACACACACATTGG - Intronic
1002609595 5:180406863-180406885 ACACATATACACACATACAGTGG + Intergenic
1002914557 6:1518602-1518624 ACACATAGACACCAATGCTATGG - Intergenic
1003052352 6:2791696-2791718 ACACACACACACACACTCATTGG - Intergenic
1003092322 6:3114657-3114679 ACACATACACACCCCTGAAATGG + Exonic
1003313486 6:4989450-4989472 ACACACACACACACACACATAGG + Intergenic
1003712312 6:8605615-8605637 ACACACACACACACATTTATTGG + Intergenic
1003832310 6:10025611-10025633 ACACACACACACACACACATTGG - Intronic
1004062963 6:12216070-12216092 ACACAGACACACACATCTATTGG - Intergenic
1004102125 6:12624178-12624200 AAACATACACACACATACAATGG + Intergenic
1004866454 6:19857614-19857636 ACACATACACAGGCACCCATGGG + Intergenic
1005171014 6:22984584-22984606 ACACACACACACACACACATAGG + Intergenic
1005240989 6:23826055-23826077 ACACACACACACACAAGCATGGG - Intergenic
1005646924 6:27848335-27848357 ACACACACACACACACACATTGG + Intronic
1005995865 6:30931150-30931172 ACACACATATACGCATGCATAGG - Intergenic
1006022883 6:31127823-31127845 ACACATACACACACACGTTTGGG + Intronic
1007424532 6:41738272-41738294 ACACACACACACACATACACAGG + Intronic
1007715169 6:43851473-43851495 CCACATACACACCCGTTCACTGG - Intergenic
1007756033 6:44100390-44100412 ACACATACACACTCAGACACAGG - Intergenic
1007912824 6:45533125-45533147 ACACACACACACCCCTTCAGAGG - Intronic
1007938724 6:45756885-45756907 ACACACACACACCCGTGTTTGGG + Intergenic
1008099271 6:47373744-47373766 ACACACACACACACACGCACAGG + Intergenic
1008408477 6:51145345-51145367 ACACACACACACATTTGCATAGG - Intergenic
1008905226 6:56670127-56670149 ACACACACACACACACGCACGGG - Intronic
1008976381 6:57431865-57431887 AAACATACACACACATACACAGG - Intronic
1009030400 6:58050390-58050412 ACACACACACACATATACATGGG - Intergenic
1009164102 6:60319885-60319907 ACACACACACACACACACATAGG - Intergenic
1009164902 6:60329016-60329038 AAACATACACACACATACACAGG - Intergenic
1009205928 6:60801560-60801582 ACACACACACACATATACATGGG - Intergenic
1009454184 6:63835353-63835375 ACACACACACACACATACAATGG + Intronic
1009739688 6:67728423-67728445 ACACATACTCACACATTCAATGG - Intergenic
1009997192 6:70909154-70909176 ACACACACACACACATGCTAGGG + Intronic
1010106212 6:72171394-72171416 ACACACACACACACCTCCATGGG + Intronic
1010651728 6:78463458-78463480 ACACACACACACACATGCACGGG - Intergenic
1010870899 6:81037065-81037087 ACACACACACACACATACACAGG - Intergenic
1011568082 6:88701405-88701427 ACACATACACATACATGCTCAGG - Intronic
1011851242 6:91631628-91631650 ACACATACACACACCTTCTTTGG + Intergenic
1012188832 6:96255637-96255659 ACACACACACACACACACATAGG - Intergenic
1012661966 6:101910857-101910879 ACACACACATACACAAGCATTGG + Intronic
1012718331 6:102705454-102705476 ACACACATACACACATACATAGG + Intergenic
1012724756 6:102796533-102796555 ACACACACACACACATATATAGG - Intergenic
1012726061 6:102811627-102811649 ACACACACACACACACACATAGG - Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1013694054 6:112679927-112679949 ACACACACACACGCACACATTGG - Intergenic
1013701327 6:112773772-112773794 ACACAAGCACACACCTGCATGGG - Intergenic
1013732934 6:113190378-113190400 ACACAAACACACACAGGCACAGG + Intergenic
1013840178 6:114382264-114382286 ACACACACACACCAATGAGTAGG - Intergenic
1013895325 6:115081162-115081184 ACACACACACACCCCTACACAGG + Intergenic
1014456252 6:121637998-121638020 ACACATACACACAGATACATAGG + Intergenic
1015469674 6:133589903-133589925 ACACACACACACACATACCTAGG + Intergenic
1015691728 6:135931965-135931987 ACACACACACACACACACATAGG + Intronic
1016096643 6:140045630-140045652 ACACAAACACACTCTTGCCTTGG + Intergenic
1016811111 6:148262104-148262126 ACACACACACACACACGCACGGG + Intergenic
1018117649 6:160603277-160603299 ACACATACTCACACATGCACAGG - Intronic
1018487017 6:164250818-164250840 ACACACACACACACATATATGGG - Intergenic
1018964845 6:168476465-168476487 ACACATACACACACACACACAGG - Intronic
1019007724 6:168815989-168816011 ACACATACACACATAAACATAGG - Intergenic
1019058798 6:169241392-169241414 ACACACACACACACCTGCAGAGG - Intronic
1019262721 7:91181-91203 ACACATACACACACACACACAGG - Intergenic
1019277994 7:186097-186119 ACACACACACACCGGTGCACAGG - Intergenic
1019601824 7:1888143-1888165 ACACATGCACACACATGCACAGG - Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1019611472 7:1939005-1939027 ACACACACACACACACACATGGG + Intronic
1019769596 7:2875374-2875396 ACACAGTCGCACCCATGCATGGG - Intergenic
1019789923 7:3004588-3004610 ACACACACACACACATATATAGG + Intronic
1020090821 7:5339538-5339560 ACACACACACACACACACATTGG - Intronic
1020649490 7:10856987-10857009 ACACATACACACACACACAGAGG + Intergenic
1020796408 7:12683016-12683038 ACACATACACACACATACACAGG + Intergenic
1020945866 7:14605381-14605403 ACACACACACACACATATATAGG - Intronic
1021079996 7:16352907-16352929 ACACACACACACACACACATTGG + Intronic
1021361293 7:19715947-19715969 ACACACACACTCTCATGCTTAGG - Intergenic
1021601390 7:22367539-22367561 ACACATACATACACATTTATTGG + Intergenic
1021639258 7:22722090-22722112 AGACATCCACACACATACATAGG + Intergenic
1021798573 7:24282853-24282875 ACACAAACACATACATGCAAAGG + Intergenic
1022038071 7:26552814-26552836 ACACACACACACACACACATAGG + Intergenic
1022486805 7:30785286-30785308 ACACACACACACACACCCATTGG + Intronic
1022575219 7:31490720-31490742 ACACATATACACACATGCTAGGG + Intergenic
1022607595 7:31831520-31831542 GCACATACACACCGCTTCATAGG + Intronic
1022864461 7:34403148-34403170 ACACACACACACACACGCACAGG - Intergenic
1023076071 7:36483661-36483683 ACACACACACACACACACATTGG - Intergenic
1023288657 7:38645847-38645869 ACACACACACACCCATCCGAAGG - Intergenic
1024413003 7:49068823-49068845 ACACATACACACACAAAGATAGG + Intergenic
1024442195 7:49433336-49433358 ACACACACACACCCCTCCAGTGG + Intergenic
1024967683 7:55038727-55038749 ACACATACACACACACACACAGG - Intronic
1025851273 7:65246657-65246679 ACACACACACACACACACATAGG - Intergenic
1026613030 7:71877804-71877826 ACAAATACATGCCCATGAATAGG + Intronic
1027208934 7:76128066-76128088 CTACATACAAACCCATGCACTGG + Intergenic
1027801017 7:82749210-82749232 ACACACACACACCCCTGAAGTGG - Intergenic
1027931570 7:84542367-84542389 ACACATACAAACACATGTACAGG - Intergenic
1028383867 7:90230494-90230516 ACACATACAAACACAAGCAGTGG + Intronic
1028409792 7:90517270-90517292 ACACACCCAAACCCATGCATAGG + Intronic
1028628215 7:92902028-92902050 ACACACACACACATATGGATTGG + Intergenic
1028747236 7:94340988-94341010 ACACACACACACACACACATTGG + Intergenic
1029257249 7:99277872-99277894 ACACACACACACACACGAATTGG - Intergenic
1029536345 7:101159994-101160016 ACACACACACACACATGCCCTGG + Intronic
1030310554 7:108064666-108064688 AAACATACCAAACCATGCATTGG + Intronic
1030448353 7:109676189-109676211 AAACATGCACACACATGCACAGG + Intergenic
1030518526 7:110567469-110567491 ACACACACACACACACGCAGAGG - Intergenic
1030589312 7:111461400-111461422 ACACATACACGCACACGCACAGG + Intronic
1030747561 7:113185937-113185959 ACACACACACACACATTTATGGG - Intergenic
1030775423 7:113529069-113529091 ATGCATACAAACACATGCATAGG - Intergenic
1031273719 7:119689734-119689756 ACACACACACACACATATATAGG + Intergenic
1031281299 7:119803815-119803837 ACACACACACACACACGCTTTGG + Intergenic
1031297754 7:120025128-120025150 ACACACACACACACATGCTAGGG - Intergenic
1031867055 7:127049223-127049245 ACACATACACACACACACAGAGG + Intronic
1031875733 7:127138685-127138707 ACACATACACACATATGCCAAGG + Intronic
1031891095 7:127294232-127294254 ACACACACACACCCATCCACTGG + Intergenic
1032350583 7:131159350-131159372 ACACAGACACACACATACAATGG + Intronic
1032613206 7:133439023-133439045 ACACATACATATACATACATAGG - Intronic
1032685245 7:134226215-134226237 ACACACACACACACACACATTGG - Intronic
1033015882 7:137671005-137671027 ACCCACACACACAGATGCATGGG + Intronic
1033223655 7:139544593-139544615 CTACACACACACACATGCATAGG + Exonic
1034150048 7:148908151-148908173 ACAAATACACACACATGGCTGGG - Intergenic
1034717594 7:153257601-153257623 ACACATGCACACACAAGCATGGG - Intergenic
1034779469 7:153864709-153864731 ACACACACACACACGTGCTTGGG + Intergenic
1035243133 7:157545093-157545115 ACACCTACACACCCACCCACGGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035720523 8:1787992-1788014 CCACATCCACACTCAGGCATGGG + Intergenic
1035758516 8:2052020-2052042 ACACAAACACACACATGCACAGG - Intronic
1036386310 8:8284929-8284951 ACCCAGCCACACCCATTCATTGG - Intergenic
1036508204 8:9375668-9375690 ACACACACACACTCCTACATTGG - Intergenic
1036742165 8:11372899-11372921 ACACACACACACACATAAATAGG - Intergenic
1037143372 8:15543901-15543923 ACACACACACACAAATCCATGGG - Intronic
1037625480 8:20602632-20602654 AGACATGGACACCGATGCATGGG + Intergenic
1037692775 8:21196662-21196684 ATACATATACACACATACATGGG + Intergenic
1037692777 8:21196690-21196712 ATACATATACACACATACATGGG + Intergenic
1037735903 8:21565966-21565988 ACACACACACACACAGCCATGGG - Intergenic
1037827095 8:22165872-22165894 ACACACACACACGCACGCACAGG - Intronic
1038058762 8:23887858-23887880 ACACATACACACACATACAGAGG - Intergenic
1038333744 8:26629981-26630003 ATACATACACACACGTCCATAGG + Intronic
1038920589 8:32079177-32079199 ACACATACACGCACATACAAGGG + Intronic
1039020056 8:33195378-33195400 ACACACACACACACACACATTGG - Intergenic
1039029327 8:33292628-33292650 TCACACACACACACATGCACAGG + Intergenic
1039517003 8:38142488-38142510 ACACACACACACACACACATTGG - Intronic
1039625373 8:39045005-39045027 ACACACACATACACATACATAGG - Intronic
1039684345 8:39781234-39781256 ACACATATATACACATGTATTGG + Intronic
1039716166 8:40111435-40111457 ACACATACACACACAAGTACAGG - Intergenic
1040688514 8:49906899-49906921 ATACATACACACACATTTATAGG + Intergenic
1040832845 8:51696741-51696763 ACACATACCCACCCACACATAGG + Intronic
1040832852 8:51696779-51696801 ACACATACCCACCCACACATAGG + Intronic
1041015884 8:53592903-53592925 ACACACACACACACATTCCTTGG + Intergenic
1041117850 8:54557722-54557744 ACACACCCACACTCATGCACTGG - Intergenic
1041124367 8:54620672-54620694 TCACATATACACCCATGCAATGG - Intronic
1041144298 8:54856423-54856445 ACATATACATACACACGCATAGG - Intergenic
1041246433 8:55892774-55892796 ATACACACACACTCCTGCATTGG - Intronic
1041412363 8:57571001-57571023 ATACCTACTCACCCATGCCTGGG + Intergenic
1041608494 8:59814891-59814913 ACACACACACACACACACATTGG + Intergenic
1042847105 8:73179287-73179309 ACACACACACACCCCTACCTGGG - Intergenic
1042861807 8:73321935-73321957 ACACAGACACACACATGTGTGGG - Intronic
1043000875 8:74758391-74758413 ACACACACACACACATACTTAGG - Intronic
1043120904 8:76322402-76322424 ACATATACATACACATGCAATGG - Intergenic
1043282712 8:78488332-78488354 ACACATATACACACATACATTGG - Intergenic
1043348937 8:79335869-79335891 ACACACACACACACATACAATGG + Intergenic
1043563682 8:81523951-81523973 TCACATCCACAGCCATGCACAGG + Intergenic
1043656200 8:82670232-82670254 ACACACACACACACACACATAGG - Intergenic
1043659451 8:82718109-82718131 ACACACACACATACATGCAATGG + Intergenic
1043661116 8:82742693-82742715 ACACACACACACACATTCCTTGG + Intergenic
1044122990 8:88420820-88420842 ACACACACACACACATACATTGG - Intergenic
1044311083 8:90693324-90693346 ACACACACACACACACTCATGGG - Intronic
1045169581 8:99649646-99649668 ACACAGACACACACACACATTGG + Intronic
1045496227 8:102711552-102711574 ACACATACATACACACGCAGTGG - Intergenic
1045612202 8:103858745-103858767 ACACACACACACACATATATGGG + Intronic
1045963053 8:107991276-107991298 ACACACACACACACACGCAATGG + Intronic
1046238218 8:111455245-111455267 ACACATACACACACATACAATGG + Intergenic
1046339476 8:112833673-112833695 ACACATACACACATATATATTGG - Intronic
1046413598 8:113881268-113881290 AAACAGACACATACATGCATGGG + Intergenic
1046714530 8:117553067-117553089 ACACACACACACCCATCCCTGGG + Intergenic
1047131187 8:122021854-122021876 ACACACACACACACATACTTAGG + Intergenic
1047135863 8:122077783-122077805 ACACATACACACACACACACAGG - Intergenic
1047382788 8:124379210-124379232 ACACATACACATGCATGTACAGG + Intergenic
1048399452 8:134050776-134050798 AAAAATACTCTCCCATGCATTGG + Intergenic
1048736516 8:137508030-137508052 ACACATACACACACACACAGAGG - Intergenic
1048945434 8:139442870-139442892 ACCCATTAACACCCTTGCATGGG + Intergenic
1049114040 8:140670521-140670543 ACACACACACACACACACATTGG + Intronic
1049164430 8:141117539-141117561 ACACACACACACACATCCCTGGG + Intronic
1049193772 8:141304269-141304291 ACACACACACACACACGCAAAGG + Intronic
1049251493 8:141591485-141591507 ACACACACACACCCAAGCTGAGG - Intergenic
1049251556 8:141591801-141591823 ACACACACACACCCAAGCTGAGG - Intergenic
1049251560 8:141591829-141591851 ACACACACACACCCAGGCTGAGG - Intergenic
1049251580 8:141591929-141591951 ACACACACACACCCAAGCTGAGG - Intergenic
1049251585 8:141591957-141591979 ACACACACACACCCAAGCCGAGG - Intergenic
1049251589 8:141591985-141592007 ACACACACACACCCAGGCTGAGG - Intergenic
1049251602 8:141592097-141592119 ACACACACACACCCAGGCTGAGG - Intergenic
1049251607 8:141592125-141592147 ACACACACACACCCAGGCTGAGG - Intergenic
1049251639 8:141592323-141592345 ACACACACACACCCAAGCCGAGG - Intergenic
1049251654 8:141592401-141592423 ACACACACACACCCAAGCTGAGG - Intergenic
1049251665 8:141592477-141592499 ACACACACACACCCAAGCAGAGG - Intergenic
1049251682 8:141592589-141592611 ACACACACACACCCAAGCCGAGG - Intergenic
1049251686 8:141592617-141592639 ACACACACACACCCAAGCTGAGG - Intergenic
1049251696 8:141592697-141592719 ACACACACACACCCAGGCTGAGG - Intergenic
1049251707 8:141592753-141592775 ACACACACACACCCAGGCTGAGG - Intergenic
1049254037 8:141604590-141604612 ACCCCCACACACCCATGCACAGG - Intergenic
1049492028 8:142910336-142910358 ACACACACACACCCATTCGCAGG + Intronic
1049641264 8:143717021-143717043 GCACATACACAACCCTGCACTGG - Intronic
1050044728 9:1531019-1531041 ACACACACACACACAGACATAGG + Intergenic
1051105370 9:13573163-13573185 ACACATACACACACACACAATGG - Intergenic
1051168235 9:14289075-14289097 ACACACACACACACACGCTTTGG - Intronic
1051431784 9:16986897-16986919 ACACATACACACTCACACAGGGG + Intergenic
1051719760 9:20024351-20024373 AAACATACACACACACACATAGG + Intergenic
1051793725 9:20839121-20839143 ACACACACACACCCCTATATAGG - Intronic
1052213845 9:25940234-25940256 ACACACACACACACACACATAGG + Intergenic
1052425890 9:28303956-28303978 ACACATACACACACATACACAGG - Intronic
1053117549 9:35518930-35518952 ACACATACACACACACAAATTGG - Intronic
1053542945 9:38993661-38993683 CCACACACACACACATGCACTGG + Intergenic
1053807388 9:41817178-41817200 CCACACACACACACATGCACTGG + Intergenic
1054623204 9:67370249-67370271 CCACACACACACACATGCACTGG - Intergenic
1054925251 9:70582175-70582197 ACACACACACACACACGCACAGG - Intronic
1054994353 9:71367934-71367956 ACACACACACACAAATGCTTAGG - Intronic
1055292643 9:74799554-74799576 ACACACACACACACACACATTGG + Intronic
1055369254 9:75579436-75579458 ACACACACACACACAGTCATTGG - Intergenic
1055494937 9:76844611-76844633 ACATACACACACATATGCATTGG + Intronic
1056232038 9:84556933-84556955 ACACACACACACACAAGCCTTGG - Intergenic
1056259173 9:84830482-84830504 ACACATACACACACACCCTTAGG - Intronic
1056507429 9:87270535-87270557 ACACACACACACACACGCGTGGG - Intergenic
1056700123 9:88896973-88896995 ACACACACACACACACACATTGG + Intergenic
1056715522 9:89025224-89025246 ACACATACACACACACACAGGGG + Intronic
1056787520 9:89603842-89603864 CAACACACACACCCTTGCATTGG - Intergenic
1057172333 9:92970260-92970282 ACCCATGCACACCCATGCCCAGG - Intronic
1057294087 9:93825362-93825384 ACACATACACACACATGGAGAGG - Intergenic
1057576943 9:96250267-96250289 ACACAGACACACACAGGCAGAGG + Intronic
1057752884 9:97806189-97806211 ACACATACACACACACACACGGG + Intergenic
1057981094 9:99664400-99664422 ACACATGTACACACATGCTTAGG - Intergenic
1058245565 9:102620351-102620373 ACACACACACACACACACATAGG - Intergenic
1058260705 9:102827163-102827185 ACACACATACACACATACATAGG - Intergenic
1058429977 9:104909640-104909662 ACACACACACACACATTCACAGG + Intronic
1058537328 9:105975561-105975583 ACACACACACACGCACGCACAGG - Intergenic
1059266776 9:113040489-113040511 ACACATGCATACACATGCACGGG - Intronic
1060474074 9:123974088-123974110 ACACTCACACACACATGCACTGG - Intergenic
1060731843 9:126043094-126043116 ACACACACACACACACTCATTGG - Intergenic
1060754788 9:126204545-126204567 ACACACACACACACACACATTGG - Intergenic
1060773882 9:126354669-126354691 ACATATATACACACATGCGTGGG + Intronic
1061206507 9:129167038-129167060 CCACAAACACACCCATCCAAGGG - Intergenic
1061427379 9:130507793-130507815 ACACACACACACACATATATGGG - Intergenic
1061444998 9:130632576-130632598 ACCCATCCCCACCCATGCATAGG - Intronic
1061780707 9:132994572-132994594 ACACATGCACACACACGGATTGG + Intergenic
1062101200 9:134729333-134729355 ACCCATACACACTCCTGCACGGG - Intronic
1203445990 Un_GL000219v1:56874-56896 AGACATGAAAACCCATGCATGGG - Intergenic
1185495519 X:552072-552094 ACACAAACACACACGTGCAGAGG + Intergenic
1186061774 X:5716143-5716165 ACACACACACACACACGTATGGG + Intergenic
1186068660 X:5793785-5793807 ACACACACACACACATATATGGG - Intergenic
1186197347 X:7122208-7122230 ACACACACACACACATATATGGG - Intronic
1186488263 X:9950735-9950757 ACACATATAAACCCATCCCTGGG - Intergenic
1186786284 X:12959064-12959086 ACACACACACACACATACACAGG + Intergenic
1186966816 X:14796376-14796398 ACACACACACACACACACATAGG + Intergenic
1186998595 X:15151075-15151097 ACACACACACACACATACAGTGG - Intergenic
1187401243 X:18962479-18962501 ACACATACACCCCCACCCCTGGG + Intronic
1187586458 X:20667991-20668013 GCACACACACACCTATCCATTGG + Intergenic
1187599374 X:20810422-20810444 ACACACACACACACATAAATTGG + Intergenic
1188250833 X:27892305-27892327 ACACACACACACACACACATCGG - Intergenic
1188699314 X:33238491-33238513 ACACATACACACACAAACAGGGG - Intronic
1188706304 X:33336246-33336268 ACACACACACACACACGCTTTGG - Intronic
1188824694 X:34817439-34817461 ACACATACATATCCATACACAGG - Intergenic
1189132949 X:38519111-38519133 ACACACACACAGCCATTCCTGGG - Intronic
1189328320 X:40126871-40126893 ACACACACACACACACACATTGG + Intronic
1189351319 X:40277942-40277964 ACACTTACACAGCCCTGCAGAGG - Intergenic
1189507398 X:41625636-41625658 ACACATGCACACCACTGCACTGG + Intronic
1189560133 X:42183778-42183800 ACACACACACACACATTAATCGG - Intergenic
1189949485 X:46214090-46214112 ACACACACACACACACACATTGG + Intergenic
1190710998 X:53070331-53070353 ACACACTCACACACATGCAATGG - Intronic
1190801205 X:53790729-53790751 ACACACACACATACTTGCATGGG + Intergenic
1190971495 X:55353351-55353373 ACACATAAACCTCCATCCATAGG - Intergenic
1192315668 X:70049609-70049631 GCATATACACACCCCTGCATAGG + Intronic
1192742721 X:73909036-73909058 ACACATATACAACAATACATAGG - Intergenic
1193356986 X:80531566-80531588 ACACACACACACACATATATAGG - Intergenic
1193728122 X:85067652-85067674 ACACACACACACACACGCACAGG + Intronic
1193820537 X:86158516-86158538 ACACACACACACACACGCACAGG - Intronic
1193904186 X:87223193-87223215 ACACACACACACACATACATGGG - Intergenic
1194037314 X:88892157-88892179 ACACACACACACACATGCCTGGG + Intergenic
1194121603 X:89970611-89970633 ATACAGACACACCCATGTTTTGG - Intergenic
1194187220 X:90787194-90787216 ACACACACACACACATGCTCTGG - Intergenic
1194548383 X:95267330-95267352 ACACACACACACACATATATAGG - Intergenic
1194748446 X:97656255-97656277 ACACACACACACCCTTTTATTGG - Intergenic
1195128099 X:101828852-101828874 ACACACACACACCCATTTCTTGG - Intergenic
1195418661 X:104648097-104648119 ACACATACACACACATTCTCAGG + Intronic
1195876564 X:109548568-109548590 ACACATACACCCACATATATAGG - Intergenic
1195930397 X:110068841-110068863 ACACATACACACACAAGTTTTGG + Intronic
1196405872 X:115362032-115362054 ACACATACACACACCTATATGGG - Intergenic
1196610148 X:117704506-117704528 ACACACACACACACATACACTGG + Intergenic
1196655479 X:118213307-118213329 ACACACACACACCCAATCTTGGG - Intergenic
1196656060 X:118218181-118218203 ACATATACACACACATACACAGG - Intergenic
1196725539 X:118891968-118891990 ACACACACACACACACACATAGG + Intergenic
1196767052 X:119256034-119256056 ACACACACACACTCATACACTGG + Intergenic
1197078702 X:122385630-122385652 ACACACACACCCCCATACAATGG + Intergenic
1197170747 X:123431038-123431060 ACACACACACACACACACATTGG + Intronic
1197568057 X:128112930-128112952 ACATATACACACACAGGCACTGG - Intergenic
1197621620 X:128756787-128756809 ACACACACACACCGATATATAGG - Intergenic
1198038855 X:132828734-132828756 ACACATACACACACAAACATAGG + Intronic
1198389209 X:136156999-136157021 ACACACACACACACACACATAGG + Intronic
1198495541 X:137188605-137188627 ACACATACACACACACACAAGGG - Intergenic
1199141461 X:144318622-144318644 ACACATACACACACACACACTGG - Intergenic
1199372116 X:147061773-147061795 ACACACACACACCCAGAAATGGG - Intergenic
1199711730 X:150474294-150474316 ACACTCATACTCCCATGCATGGG + Intronic
1200089782 X:153629061-153629083 ACACACACACACACACACATGGG - Intergenic
1200089784 X:153629119-153629141 ACACAGACACAGACATGCACAGG - Intergenic
1200325593 X:155235099-155235121 ACACATACACACACACACACTGG - Intronic
1200474458 Y:3628062-3628084 ATACAGACACACCCATGTTTTGG - Intergenic
1200798658 Y:7364574-7364596 CCTTATACACACACATGCATTGG + Intergenic
1200841692 Y:7787999-7788021 ACACATACATATCCAGGCTTAGG + Intergenic
1200921655 Y:8618644-8618666 ACACATACACAAACATACAAAGG - Intergenic
1200969614 Y:9136831-9136853 ACACACACACACCCCTCCATAGG + Intergenic
1200972729 Y:9173214-9173236 ACACAGACACACCTGTGCTTTGG + Intergenic
1200976903 Y:9221410-9221432 ACACATGCACACATGTGCATTGG - Intergenic
1201850051 Y:18470080-18470102 ACACACACACACACATTCACAGG + Intergenic
1201883267 Y:18850297-18850319 ACACACACACACACATTCACAGG - Intergenic
1201916289 Y:19184880-19184902 ATACAGACACACCCAAGAATGGG - Intergenic
1201969302 Y:19774133-19774155 ATACACACACACCCATGGAGGGG + Intergenic
1202141385 Y:21727413-21727435 ACACACACACACCCCTCCATAGG - Intergenic
1202145480 Y:21776389-21776411 ACACACACACACCCCTCCATAGG + Intergenic
1202348632 Y:23962714-23962736 ACTCATACACACCCAGGACTTGG + Intergenic
1202522142 Y:25707390-25707412 ACTCATACACACCCAGGACTTGG - Intergenic