ID: 976983329

View in Genome Browser
Species Human (GRCh38)
Location 4:91260305-91260327
Sequence ACACATACACACCCATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1218
Summary {0: 1, 1: 0, 2: 11, 3: 162, 4: 1044}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976983321_976983329 24 Left 976983321 4:91260258-91260280 CCAACAGCATAACACACTGTTCT 0: 1
1: 0
2: 0
3: 18
4: 184
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983324_976983329 -8 Left 976983324 4:91260290-91260312 CCACTTCCCCAATATACACATAC 0: 1
1: 0
2: 5
3: 62
4: 512
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983323_976983329 -1 Left 976983323 4:91260283-91260305 CCATACACCACTTCCCCAATATA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044
976983322_976983329 0 Left 976983322 4:91260282-91260304 CCCATACACCACTTCCCCAATAT 0: 1
1: 0
2: 0
3: 5
4: 136
Right 976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG 0: 1
1: 0
2: 11
3: 162
4: 1044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976983329 Original CRISPR ACACATACACACCCATGCAT GGG Intronic