ID: 976984529

View in Genome Browser
Species Human (GRCh38)
Location 4:91276747-91276769
Sequence TTGGACACAATGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976984529_976984536 21 Left 976984529 4:91276747-91276769 CCAGTTTTTCCCATTGTGTCCAA 0: 1
1: 0
2: 6
3: 66
4: 489
Right 976984536 4:91276791-91276813 ATATGGCATTTGTTATCTTAAGG No data
976984529_976984533 -10 Left 976984529 4:91276747-91276769 CCAGTTTTTCCCATTGTGTCCAA 0: 1
1: 0
2: 6
3: 66
4: 489
Right 976984533 4:91276760-91276782 TTGTGTCCAAGGTTAGCTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 237
976984529_976984535 4 Left 976984529 4:91276747-91276769 CCAGTTTTTCCCATTGTGTCCAA 0: 1
1: 0
2: 6
3: 66
4: 489
Right 976984535 4:91276774-91276796 AGCTGTAGGTTTATCATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976984529 Original CRISPR TTGGACACAATGGGAAAAAC TGG (reversed) Intronic
901298812 1:8183363-8183385 TTGGAAACCATGGGATAATCTGG + Intergenic
901904309 1:12394487-12394509 TTAAACACAATGGGGATAACTGG - Intronic
902971108 1:20051658-20051680 TAGGACACAATTGGAGAAACTGG + Intronic
903149994 1:21400375-21400397 TAGGACACAATTGGAGAAACTGG + Intergenic
904709698 1:32420510-32420532 CAGGACACAATTGGAAAACCTGG + Intergenic
906377930 1:45311717-45311739 CAGGACACAATTGGAGAAACTGG + Intergenic
906750072 1:48250913-48250935 TTGGGCAAAAAGGAAAAAACGGG - Intergenic
907035565 1:51213114-51213136 TAGGACACAATTGGAGACACTGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908533562 1:65056521-65056543 TGGGACACAATGGGGAAGAAAGG - Intergenic
909064882 1:70923883-70923905 CGGGACACAATTGGAGAAACTGG + Intronic
909313594 1:74186737-74186759 TTGTACAAAATGGAAAAAAAAGG - Intronic
910386992 1:86694531-86694553 CAGGACACAATTGGATAAACTGG - Intergenic
910626712 1:89315004-89315026 CAGGACACAATTGGAAAACCTGG - Intergenic
910790175 1:91042626-91042648 TTAAACACAATGGGAATAATTGG + Intergenic
911471658 1:98326837-98326859 TTGGAAACACTGGGAACCACTGG + Intergenic
912404289 1:109423968-109423990 CAGGAGATAATGGGAAAAACAGG - Intronic
913502671 1:119485589-119485611 CAGGACACAATTGGAGAAACTGG - Intergenic
913679133 1:121172139-121172161 CTGGGCAAAATGGCAAAAACTGG + Intronic
913992741 1:143629829-143629851 TTATTCACAATAGGAAAAACTGG + Intergenic
914030965 1:143959783-143959805 CTGGGCAAAATGGCAAAAACTGG + Intronic
914158484 1:145108177-145108199 CTGGGCAAAATGGCAAAAACTGG - Intronic
915652746 1:157330506-157330528 CAGGACACAATTGGAGAAACTGG + Intergenic
915655742 1:157358902-157358924 CAGGACACAATTAGAAAAACTGG + Intergenic
915665792 1:157443322-157443344 CAGGACACAATTGGAAAAACGGG - Intergenic
915809538 1:158892162-158892184 ATGTAGCCAATGGGAAAAACAGG + Intergenic
916192982 1:162197272-162197294 TGGGAAACAAAGGGAAAATCTGG + Intronic
916200183 1:162264078-162264100 TTGGTCACAGTATGAAAAACAGG - Intronic
916722273 1:167493341-167493363 TGGGACAAAAGGAGAAAAACTGG - Intronic
916724347 1:167509544-167509566 ATGGACACTGTGGGAAGAACTGG + Intronic
917310848 1:173676186-173676208 CAGGACACAATTGGAGAAACTGG - Intergenic
918589662 1:186226683-186226705 CAGGACACAATTGGAAAAACTGG + Intergenic
919404629 1:197163437-197163459 TTGGAATCTATGGGAAAAAAAGG + Intronic
920466431 1:206190677-206190699 CTGGGCAAAATGGCAAAAACTGG + Intronic
920640377 1:207746396-207746418 CAGGACACAATTGGGAAAACTGG + Intergenic
921474108 1:215584763-215584785 CAGGACACAATTGGAGAAACTGG - Intronic
921926692 1:220716342-220716364 GAGGACACAATTGGAGAAACTGG + Intergenic
922515984 1:226208722-226208744 TTGGAGACCATGGGAAAGCCAGG - Intergenic
922550750 1:226492409-226492431 CAGGACACAATTGGAAAAACTGG - Intergenic
922601173 1:226855279-226855301 CAGGACACAATTGGAGAAACTGG + Intergenic
923860502 1:237887919-237887941 TTTGCCACAATGGCAAAAGCCGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924775686 1:247113266-247113288 TTTGCCACAGTGGGAAAAACAGG + Intergenic
1063332165 10:5170782-5170804 CAGGACACAATTGGAAAAACTGG - Intergenic
1063341148 10:5264150-5264172 CAGGACACAATTGGAGAAACTGG - Intergenic
1064334174 10:14423423-14423445 TTGGGCAAAAAGGGAAAAAAGGG - Intronic
1064389384 10:14928500-14928522 AAGGACACTATGGGAAGAACTGG + Intronic
1064637449 10:17384038-17384060 CAGGACACAATTGGAGAAACTGG + Intronic
1064759812 10:18606463-18606485 TAGGACATTATGAGAAAAACTGG + Intronic
1065119610 10:22515742-22515764 TGGGATAAAATAGGAAAAACTGG + Intergenic
1065261155 10:23925010-23925032 TTCTGTACAATGGGAAAAACAGG - Intronic
1067326823 10:45276507-45276529 CAGAACACAATTGGAAAAACTGG - Intergenic
1067531079 10:47073920-47073942 TTGTTAACAATAGGAAAAACAGG - Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1068686482 10:59875267-59875289 TTGGACAAAATTTGGAAAACAGG - Intronic
1068907342 10:62341449-62341471 CAGGACACAATTGGAAAAACTGG - Intergenic
1071055109 10:81500678-81500700 TAGGACACAATTGGAGACACTGG - Intergenic
1071378150 10:85031616-85031638 TTGAATACAATGGGAATAATTGG + Intergenic
1071427651 10:85575481-85575503 TGGGCCGCAAAGGGAAAAACAGG - Intergenic
1071898442 10:90091213-90091235 CAGGACACAATAGGAGAAACTGG + Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1072595130 10:96864532-96864554 TAGAATATAATGGGAAAAACAGG + Intronic
1074214613 10:111372305-111372327 CAGGACACAAATGGAAAAACAGG + Intergenic
1075474311 10:122720150-122720172 TTGGTCACGATCGCAAAAACAGG - Intergenic
1077942074 11:6853741-6853763 CAGGACACAATTGGAGAAACTGG + Intergenic
1078751297 11:14166197-14166219 CAGGACACAATTGGATAAACTGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080074750 11:28135618-28135640 CAGGACACAATTGGAGAAACTGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082106353 11:48225852-48225874 TTGGAGATAATGGGAAAAAATGG + Intergenic
1082228531 11:49736970-49736992 TAAGACACAATTAGAAAAACTGG - Intergenic
1082999378 11:59277713-59277735 TTAAATACAATGGGAAAAATGGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083239397 11:61375693-61375715 CAGGACACAATTGGAGAAACTGG + Intergenic
1083358840 11:62090866-62090888 CAGGACACAATTGGAGAAACTGG + Intergenic
1083424645 11:62576924-62576946 TGGGACACAGTGGGCAACACAGG + Exonic
1083873226 11:65504998-65505020 GTGGACAAAATGAGGAAAACAGG + Intergenic
1086058692 11:82677847-82677869 GAGGACACAATTGGAAAAACTGG - Intergenic
1086329269 11:85737507-85737529 TTTGACACAATGAGGAAAAATGG + Intronic
1086621542 11:88892178-88892200 TAAGACACAATTAGAAAAACTGG + Intronic
1087146473 11:94818116-94818138 TAGGACACAATTGGAGACACTGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089488596 11:118866742-118866764 CAGGACACAATTGGAGAAACTGG + Intergenic
1090024063 11:123152807-123152829 GTGGACACAAAGGGAAAAAGTGG - Intronic
1090100393 11:123789363-123789385 CAGGACACAGTTGGAAAAACTGG - Intergenic
1090291389 11:125548243-125548265 CAGGACACAATTGGAAAAATTGG - Intergenic
1090455717 11:126847910-126847932 CAGGACACAATTGGAGAAACTGG + Intronic
1090889087 11:130907138-130907160 TGGAACACAAGGGGAAAAAATGG - Intronic
1091057346 11:132431218-132431240 TGGGAAACAATGGGAACAAAAGG - Intronic
1091511163 12:1127787-1127809 TTGGACATAAATGGAAAAAGAGG + Intronic
1092116907 12:6015825-6015847 CTGGACACAAAGGGAAAATGTGG + Intronic
1092720495 12:11435938-11435960 TTGGGCAAAAAGGGAAAAAAGGG + Intronic
1093546831 12:20358662-20358684 TTGGACACATTGGAAGTAACAGG - Intergenic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094316527 12:29141437-29141459 CAGGACACAATTGGAGAAACTGG - Intergenic
1095572986 12:43703767-43703789 CAGGACACAATTGGAAAAACTGG + Intergenic
1095602669 12:44031833-44031855 CAGGACACAATAGGAAAAACTGG + Intronic
1095799235 12:46254721-46254743 CAGGACACAATTGGAGAAACTGG - Intronic
1096564372 12:52465243-52465265 TGGGACAGAATGGGAAATGCTGG + Intergenic
1097102165 12:56597476-56597498 TTTTAAACAATGGGAAAAATGGG + Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098125918 12:67292834-67292856 TTGGCCAGAAGGGGAAAAAAGGG - Intronic
1098315732 12:69191647-69191669 CAGGACACAATTGGAGAAACTGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1098715855 12:73827987-73828009 TTAAATACAATGGGAATAACTGG + Intergenic
1099149554 12:79092306-79092328 TAGGACACAATTGGAAACATTGG - Intronic
1099816326 12:87653222-87653244 TAGGACACCATGGTAATAACAGG - Intergenic
1101383302 12:104233354-104233376 CAGGACACAATTGGAAAAACTGG - Intronic
1103480476 12:121247178-121247200 TTGGACCCACTGGGAAGAAGTGG - Intronic
1105778479 13:23684983-23685005 CAGGATACAATTGGAAAAACTGG + Intergenic
1106023684 13:25938114-25938136 TAGGGTACAATGAGAAAAACTGG + Intronic
1107952751 13:45479001-45479023 TTGCAAACCATGAGAAAAACTGG - Exonic
1107971027 13:45642500-45642522 CAGGACACAATTGGAAAAACTGG + Intergenic
1108284910 13:48897282-48897304 TAGGACACAATGGAAAACAATGG + Intergenic
1108508088 13:51131303-51131325 TAGGACACAATTGGAAAAACTGG + Intergenic
1109020415 13:57083702-57083724 CAGGACACGATTGGAAAAACTGG - Intergenic
1109293533 13:60502857-60502879 CAGGACACAATTAGAAAAACCGG - Intronic
1109388993 13:61668785-61668807 CAGGACACAATTGGAGAAACTGG - Intergenic
1109800617 13:67372837-67372859 TTGGACAAAAGGAGAAAAAAAGG - Intergenic
1110391341 13:74978268-74978290 GTGGACACAGTGTGAAAAATTGG + Intergenic
1110712692 13:78666664-78666686 CAAAACACAATGGGAAAAACTGG - Intergenic
1110952927 13:81518056-81518078 CAGAACACAATTGGAAAAACTGG - Intergenic
1111469664 13:88662061-88662083 TTTGACTCTATAGGAAAAACAGG - Intergenic
1112413331 13:99182492-99182514 TAGGACACAATTGGAGAAATTGG - Intergenic
1112842609 13:103599740-103599762 GTGAACAAAATGGGGAAAACAGG - Intergenic
1113706730 13:112439604-112439626 CTGAAAACAATGGGAAAACCTGG - Intergenic
1113898337 13:113780302-113780324 CAGGACACAATTGGAGAAACTGG - Intronic
1114583899 14:23791802-23791824 CAGGACACAATTGGAAAAATTGG - Intergenic
1115244279 14:31279205-31279227 TAGGACACAATTGGAGAAACTGG + Intergenic
1116099353 14:40412901-40412923 ATGTAAACAATGGGAAAAATCGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116419728 14:44719118-44719140 CAGGAAACAATGGGAGAAACTGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117120054 14:52557904-52557926 TTTGAAACCATGTGAAAAACGGG - Intronic
1117187527 14:53255810-53255832 CAGGACACAATTGGAGAAACTGG - Intergenic
1118589476 14:67390726-67390748 AGGGACACAAGAGGAAAAACTGG - Exonic
1118631493 14:67707995-67708017 CAGGACACAATTGGAGAAACTGG - Intronic
1118938745 14:70313066-70313088 CAGGACACAATTGGAGAAACTGG + Intergenic
1118961981 14:70542305-70542327 GAGGACACAATTGGAAAAACTGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120093571 14:80362423-80362445 TTGGCCACACTGGGAAGAAGGGG + Intronic
1120699614 14:87684411-87684433 TTAAACATAAAGGGAAAAACAGG + Intergenic
1120912976 14:89684432-89684454 TAGGACAGAATTGGAGAAACTGG + Intergenic
1122433715 14:101677138-101677160 TAGGACACAATTGGAGAAACTGG - Intergenic
1123138551 14:106053197-106053219 CAGGACACAATTGGAGAAACTGG - Intergenic
1123768478 15:23505206-23505228 CAAGACACAATTGGAAAAACTGG - Intergenic
1123770961 15:23528193-23528215 CAGGACACAATTGGAGAAACTGG - Intergenic
1123847751 15:24320636-24320658 TGGGACACAATTGGAGACACTGG - Intergenic
1123866792 15:24528013-24528035 TGGGACACAATTGGAGACACTGG - Intergenic
1126205076 15:46036188-46036210 TGGGACACAGTGCCAAAAACAGG + Intergenic
1126430631 15:48580122-48580144 TTAGAAGCAATTGGAAAAACTGG - Intronic
1126624034 15:50668857-50668879 CAGGACACAATTGGAGAAACTGG + Intronic
1127374618 15:58372105-58372127 TAGGACACAATTGGAGACACTGG - Intronic
1128289484 15:66466210-66466232 CAGGACACAATTGGAGAAACTGG - Intronic
1130832147 15:87611869-87611891 TTGGACACACTGAGAGACACAGG - Intergenic
1134856851 16:17527138-17527160 TTGCAAACAATGGGGAAAAGAGG + Intergenic
1134913580 16:18050733-18050755 TTGGGCACAATGGCAGAAAATGG - Intergenic
1135036375 16:19081303-19081325 CAGGACACAATTGGAGAAACTGG + Intergenic
1135325161 16:21521051-21521073 TGGGATACAATGGGAATTACTGG - Intergenic
1136336645 16:29614319-29614341 TGGGATACAATGGGAATTACTGG - Intergenic
1136352044 16:29716926-29716948 CAGGACACAGTTGGAAAAACTGG + Intergenic
1137330453 16:47489821-47489843 CAGGACACAATTGGAGAAACTGG - Intronic
1137379856 16:47987133-47987155 TTGGAGACAGAGGGAAAAAAAGG + Intergenic
1137453088 16:48595665-48595687 CAGGACACAATTGGAGAAACTGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138134672 16:54511488-54511510 TTCGAGACAATGGGAAGACCAGG + Intergenic
1138182336 16:54949972-54949994 TTGGAGAAAATGAGAAAAGCTGG - Intergenic
1138256495 16:55567976-55567998 TTTTACATAATGGGAAAACCAGG - Intronic
1140197462 16:72866900-72866922 CTGGAAACAATGGGATAAGCAGG + Intronic
1140630001 16:76840374-76840396 ATAGACACAAAGGGAACAACAGG - Intergenic
1141842627 16:86583893-86583915 TTGTACCTAATGGAAAAAACAGG - Intergenic
1142037373 16:87870103-87870125 TGGGATACAATGGGAATTACTGG - Intergenic
1144216693 17:13061865-13061887 TTCAACAAATTGGGAAAAACTGG - Intergenic
1145226655 17:21134622-21134644 CAGGACACAATTGGAGAAACTGG - Intronic
1148632690 17:49123916-49123938 CAGGACACAATTGGAAAAACTGG - Intergenic
1149173326 17:53839973-53839995 CAGGACACAATTGGAGAAACTGG - Intergenic
1149335638 17:55633093-55633115 TTGGACACAAAGGGAAAATGGGG - Intergenic
1149643991 17:58226030-58226052 TTGGACACTGTAGGGAAAACAGG - Intronic
1149971062 17:61218968-61218990 TTGAAAACAATGGGACATACAGG - Intronic
1150464937 17:65384653-65384675 TTGAACACTATTGGAACAACTGG - Intergenic
1150948260 17:69771834-69771856 TTGTACTGAATGGGCAAAACTGG + Intergenic
1151003123 17:70401503-70401525 TAGAACAAAATGGGAAAACCTGG - Intergenic
1152824320 17:82454609-82454631 TATGAGACAATGGGGAAAACTGG + Intergenic
1153349427 18:4062252-4062274 CAGGACACAATTGGAGAAACTGG + Intronic
1153745883 18:8179141-8179163 CAGGACACAATTGGAGAAACTGG - Intronic
1153756318 18:8287213-8287235 TTGGAGACAACAGCAAAAACTGG + Intronic
1153829468 18:8909112-8909134 CAGGACACAATTGGAGAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155063163 18:22246528-22246550 ATGCACACAGTGGGAAAAGCAGG + Intergenic
1155538842 18:26845561-26845583 TTGGAGAGACTGGGACAAACTGG - Intergenic
1155903743 18:31424118-31424140 TTGGAGACAAGGAGAGAAACAGG + Intergenic
1155944024 18:31827387-31827409 ATGGGGACAATGGGATAAACTGG - Intergenic
1157661726 18:49451301-49451323 CAGGACACAAATGGAAAAACTGG + Intronic
1158324412 18:56298563-56298585 GTGGACATGATGGGAAACACAGG + Intergenic
1158864284 18:61622964-61622986 CAGGCCACAATTGGAAAAACTGG + Intergenic
1159287542 18:66373639-66373661 TTAAACACAATGGGAATAACTGG + Intergenic
1160472538 18:79150222-79150244 TTGGAAACAATGTGAAGAAGCGG + Intronic
1161133167 19:2603731-2603753 TTGAACACGCTAGGAAAAACTGG - Intronic
1161780309 19:6287291-6287313 TTGGAGACTATAGGAAACACTGG - Intergenic
1162667491 19:12226508-12226530 CAGGACACAATTGGGAAAACTGG - Intronic
1164035890 19:21454620-21454642 CAGGACACAATTGGAGAAACTGG - Intronic
1164088373 19:21924981-21925003 CAGGACACAATGGGAGACACAGG - Intergenic
1164191450 19:22920996-22921018 CAGGACACAATGGGAGACACAGG - Intergenic
1164585244 19:29465589-29465611 TCACACACAATGGGAAAATCAGG + Intergenic
1165697107 19:37908869-37908891 TGGGACACAAAGGCAAAAGCTGG - Intronic
1165834469 19:38745689-38745711 TTGGAGGAAATGGGAGAAACAGG + Intronic
1166231295 19:41427042-41427064 TTGGACGGAGTGGGAAGAACAGG - Intronic
1166249118 19:41553839-41553861 CAGGACACAATTTGAAAAACTGG - Intronic
1166390817 19:42407866-42407888 TGGCACACAAGGGGAAAGACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166418910 19:42619087-42619109 CAGGACACAATTGGAAAAACTGG + Intronic
1166432225 19:42737464-42737486 ATGGACACTTTGGGAAACACAGG + Intronic
1166435340 19:42762653-42762675 ATGGACACTTTGGGAAACACAGG + Intronic
1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG + Intronic
1166471010 19:43079611-43079633 ATGGACACTTTGGGAAACACAGG + Intronic
1166491769 19:43266523-43266545 ATGGACACTTTGGGAAACACAGG + Intronic
1166850788 19:45759714-45759736 TTGGACAAAATGGATAAAAAAGG + Intronic
1166967850 19:46541069-46541091 TTTGTCACAATGGGAAACTCGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
924972766 2:144294-144316 CAGGACACAATTGGAAAAACTGG - Intergenic
925137427 2:1531018-1531040 TTGCACACAGTGGGAAAGATAGG - Intronic
925619589 2:5778371-5778393 TTGGAAACTAGGGGAAAAAAAGG + Intergenic
926101184 2:10119332-10119354 TTTGAAACAATTGGAAAAACAGG + Intergenic
926114133 2:10200820-10200842 CAGGACACAATTGGAAGAACTGG - Intronic
926368455 2:12155628-12155650 TTGGACAAAATGGGAAACATAGG - Intergenic
928180120 2:29062840-29062862 TGGGACACAGTGGGTGAAACTGG - Exonic
928982102 2:37146651-37146673 TAGGACACCATGGGCAAAGCTGG - Intronic
929092768 2:38235984-38236006 TTTGACAAAATGGGACAGACAGG + Intergenic
929535497 2:42781244-42781266 CAGGACACAATTGGAGAAACTGG + Intronic
930495017 2:52130481-52130503 CAGGACACAATTGGAGAAACTGG + Intergenic
931207360 2:60160825-60160847 TTTGACAAAATGGGCAAATCTGG - Intergenic
932017136 2:68041493-68041515 TTGGAGACAAAGGCAAAAAAAGG + Exonic
933427473 2:82131080-82131102 CAGGACACAATTGGAGAAACTGG + Intergenic
935377306 2:102412637-102412659 CAGGACACAATTGGAGAAACTGG + Intergenic
935941213 2:108241245-108241267 CAGGACACAATTGGAAAAACTGG - Intergenic
936156896 2:110052961-110052983 TTGGACAAAAAGGGGAAAAATGG + Intergenic
936187798 2:110318483-110318505 TTGGACAAAAAGGGGAAAAATGG - Intergenic
936806854 2:116344264-116344286 TTGGACACAATTCAAAAAACAGG - Intergenic
936879927 2:117237620-117237642 ATGCACACAATGAGAAAATCTGG + Intergenic
937112978 2:119381185-119381207 CAGGACACAATTGGAGAAACTGG - Intergenic
937579896 2:123472570-123472592 CAGGACACAATTGGAGAAACTGG + Intergenic
937713809 2:125009435-125009457 TTGGACAAAATGTCATAAACTGG - Intergenic
937743981 2:125389083-125389105 TTGAACACATTGGGAAAACTTGG - Intergenic
937900311 2:127014723-127014745 TTGCACACAATGACATAAACAGG - Intergenic
939339525 2:140876439-140876461 TAGGACACAATTGGAGAAACTGG + Intronic
940100412 2:150031312-150031334 TTGGATTCAATGGGAAAAGATGG - Intergenic
940401967 2:153257815-153257837 TAGGACACAATTGGAGGAACTGG + Intergenic
940606161 2:155926188-155926210 TTAAATACAATGGGAATAACTGG - Intergenic
941249956 2:163148854-163148876 TTGGGCAAAAAGGGAAAAAAGGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942872851 2:180756279-180756301 TTTGCCATAATGGCAAAAACCGG - Intergenic
943006331 2:182391651-182391673 TTAAACACAATGGGAATAATTGG + Intronic
943139528 2:183963271-183963293 ATGGAAACAAGGGGAAAAATAGG + Intergenic
943419883 2:187657167-187657189 GAGGACACAATTGGAAAAACTGG + Intergenic
943666158 2:190610596-190610618 GAGGACACAGTTGGAAAAACTGG - Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
944192579 2:197019478-197019500 CTGGGCAAAATGGGAATAACAGG - Intronic
944305000 2:198169221-198169243 TTGTACAGAATGGAAAAAAGGGG + Intronic
944519837 2:200554029-200554051 CAGAACACAATTGGAAAAACTGG - Intronic
944757701 2:202781089-202781111 TTAGTCACAATGGGAAATAAAGG + Intronic
945157614 2:206856105-206856127 TTGGAAACAAAAGGAAAATCTGG - Intergenic
949030109 2:241791343-241791365 CAGGACACAATTGGAGAAACTGG + Intronic
1168821974 20:780149-780171 CAGGACACAATTGGAAAAACTGG - Intergenic
1169554221 20:6732444-6732466 TAGGACACATTGGGAGAATCTGG - Intergenic
1169585334 20:7076139-7076161 TTGGAAACATTTGGAAAACCTGG + Intergenic
1170041958 20:12048575-12048597 TTGGACACAGTGGCAAAATAGGG - Intergenic
1170595356 20:17801464-17801486 GTGAAAGCAATGGGAAAAACTGG + Intergenic
1176037534 20:63047163-63047185 TATGACCCACTGGGAAAAACTGG - Intergenic
1177180840 21:17743504-17743526 CAGGACACAATTGGAAACACTGG - Intergenic
1177744098 21:25190158-25190180 TTGGTCACAAAGGTGAAAACTGG + Intergenic
1178414849 21:32395725-32395747 CTGGGAACAATAGGAAAAACAGG + Intergenic
1178557078 21:33601543-33601565 TTGAAAACAATGGGGCAAACAGG + Intronic
1178836566 21:36103437-36103459 CAGGACACAATTGAAAAAACTGG + Intergenic
1180568331 22:16694313-16694335 CTGGACACAAAGGGAAAATGTGG + Intergenic
1180992508 22:19945446-19945468 CAGGACACAATTGGAAACACTGG - Intronic
1181446590 22:22980964-22980986 CAGGACACAATTGGAAAAACTGG + Intergenic
1181837375 22:25621997-25622019 CAGGACACAGTTGGAAAAACTGG - Intronic
1182379982 22:29880090-29880112 TATCAGACAATGGGAAAAACAGG + Intergenic
1183113626 22:35672379-35672401 CAGGGCACAATTGGAAAAACTGG + Intergenic
1183325627 22:37190658-37190680 CAGGACACAATTGGAGAAACTGG - Intronic
1184677025 22:46049217-46049239 TTGCCTACAATGGGGAAAACTGG - Intergenic
949142730 3:654474-654496 CTGTTCACAATGGGAAAGACTGG + Intergenic
949812249 3:8018120-8018142 CAGGACACAATTGGAGAAACTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
949984117 3:9525764-9525786 TTTGAAAAAATGGGAAAAAATGG + Intronic
950511625 3:13432131-13432153 CAGGACACAATTGGAAAAATTGG + Intergenic
950600009 3:14025780-14025802 CAGGACACAATTGGAGAAACTGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951122356 3:18943739-18943761 TTAAACACAATGGGAATAATTGG + Intergenic
951327788 3:21325730-21325752 TTAGATACAATGGGAAATTCAGG + Intergenic
952037802 3:29224118-29224140 TTGGTCAAAATGAGAAAAAATGG + Intergenic
953441276 3:42919707-42919729 CAGGACACAATTGGAGAAACTGG - Intronic
954597974 3:51843175-51843197 TAGGACACAATTGGAAAAAATGG - Intergenic
954681005 3:52345909-52345931 TTGGAGAGAAAGGGAAAACCAGG + Intronic
954968653 3:54633497-54633519 TTGGGCAAAAAGGGAAAAAAGGG + Intronic
955381056 3:58438486-58438508 CAGGACACAATTGGAGAAACTGG - Intergenic
957128183 3:76189285-76189307 TTCAACACAATGGGAAAAAAAGG + Intronic
957284262 3:78197272-78197294 TTGGACTCAAAGGGAAACACGGG - Intergenic
957626186 3:82655169-82655191 TAGGAAACAAAGGGAAAAAAGGG + Intergenic
959177794 3:102938530-102938552 GTGGTCATAATGGGCAAAACAGG - Intergenic
959244922 3:103853611-103853633 TTAGACACAATGGTTAACACAGG + Intergenic
959291533 3:104480831-104480853 TTGGACACAAAGAGGAAAACTGG + Intergenic
959553162 3:107687245-107687267 TTGCATAAACTGGGAAAAACAGG + Intronic
959746257 3:109779085-109779107 TTAAACACAATGGGAATAATTGG - Intergenic
959822496 3:110753115-110753137 TGGGACACAATGGAAAAATAGGG - Intergenic
960029045 3:113039487-113039509 TTGAACAAGATGGGGAAAACAGG - Intergenic
960654522 3:119988464-119988486 CAGGACAGAATTGGAAAAACTGG + Intronic
961421684 3:126810841-126810863 TGGGACACAAGAGGAAGAACAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962322738 3:134405431-134405453 TTGGACAGAACTGGAAAAACGGG - Intergenic
963493214 3:146027322-146027344 TTGGACAGAGTAGGAATAACTGG + Intergenic
963630065 3:147721393-147721415 TTAAATACAATGGGAACAACTGG + Intergenic
963677863 3:148335708-148335730 CTGTTCACAATGGCAAAAACTGG - Intergenic
963757363 3:149249428-149249450 TTGTACAAAAAGAGAAAAACAGG + Intergenic
964022935 3:152036062-152036084 CAGGACACAATGGGAGAAACTGG - Intergenic
964120921 3:153182583-153182605 TTTGACAAAATGGGAGAAAGGGG - Intergenic
964201888 3:154126648-154126670 TTGTAGGCAATGGTAAAAACTGG - Intronic
965022977 3:163259058-163259080 ATACAGACAATGGGAAAAACTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965960596 3:174424285-174424307 TTGGTCACAATGGCAAAGCCTGG - Intergenic
966430492 3:179827205-179827227 TAGAACACAATGGGAATACCCGG + Intronic
966688094 3:182717504-182717526 CAGGACACAATTGGAAAAACTGG - Intergenic
966721477 3:183067047-183067069 TGGGACACAACTGGAGAAACTGG + Intronic
966990513 3:185225516-185225538 TTGGAGACAAGGACAAAAACAGG - Intronic
967695566 3:192527428-192527450 ATGGAAACAATGGCAAAATCTGG - Intronic
968043621 3:195610555-195610577 CAGGACACAATTGGAGAAACTGG + Intergenic
968294647 3:197566208-197566230 CAGGACACAATTGGAGAAACTGG + Intronic
969360649 4:6661276-6661298 TTGGACACTTTGGGACAAGCAGG + Intergenic
969634878 4:8362526-8362548 CAGGAGACAATTGGAAAAACTGG + Intergenic
970004881 4:11400756-11400778 TTGGACACAAGGTGAAGAATTGG - Intronic
970069612 4:12142707-12142729 CTGGACACACAGGGAAAAAATGG + Intergenic
970374457 4:15442558-15442580 TGGTACACAATGGGCAATACCGG + Exonic
970619616 4:17803827-17803849 GGGGACACAATGGGAACAATGGG + Exonic
971913305 4:32824713-32824735 CAGGACACAATTGGAGAAACTGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
971969016 4:33598135-33598157 TAAGACACAATAGGCAAAACTGG + Intergenic
971989137 4:33868275-33868297 TTGTACTGAATGGGAAAAGCTGG + Intergenic
972926082 4:44009103-44009125 TTCCACATAATGGGAAAAATAGG + Intergenic
973897922 4:55434710-55434732 TTGTAAACAAAAGGAAAAACAGG + Exonic
974435308 4:61849520-61849542 TTGGGCTCAATGGGAGAAAATGG - Intronic
974721369 4:65743286-65743308 GAGGACACAATTGGAAAAACTGG + Intergenic
974929017 4:68339407-68339429 TTGGACATAATTGGAAAAACTGG + Intronic
974975907 4:68890748-68890770 CTGGAAAAAATGGGAAGAACTGG + Intergenic
975528210 4:75374151-75374173 CAGGACACAATTGGAGAAACTGG + Intergenic
975614397 4:76231963-76231985 CGGGACACAATTGGAAAAACTGG - Intronic
975730341 4:77331690-77331712 CAGGACACAATTGGAAAAACTGG - Intronic
976345145 4:83992029-83992051 CAGGACACAATTGGAGAAACTGG + Intergenic
976413264 4:84741699-84741721 TTTGACACCATAGGCAAAACAGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977063625 4:92287008-92287030 CAGGAAACAATAGGAAAAACAGG - Intergenic
977204455 4:94153789-94153811 TTAAACACAATGGGAATAATCGG + Intergenic
977500117 4:97827705-97827727 CAGGACACAATTGGAGAAACTGG + Intronic
977513380 4:97990452-97990474 TTGGTCACAATTTGGAAAACAGG - Intronic
977527469 4:98162706-98162728 CAGGACACAATTGGAGAAACTGG + Intergenic
977590096 4:98816815-98816837 CAGGACACAATTGGAGAAACGGG + Intergenic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
977986558 4:103389419-103389441 TTGTACTGAATGGGCAAAACTGG + Intergenic
978753662 4:112280955-112280977 TAACACACAATGGGTAAAACTGG + Intronic
979024097 4:115545586-115545608 CAGGACACAATTGGAGAAACGGG - Intergenic
980269752 4:130568726-130568748 CAGTACACAATTGGAAAAACTGG - Intergenic
981292728 4:143095417-143095439 CAGGACACAATTGGAGAAACTGG + Intergenic
981525853 4:145706606-145706628 CAGGACACAATTGGAGAAACTGG - Intronic
982166267 4:152616361-152616383 TTGGAAACTATGGGAGAATCAGG - Intergenic
982475797 4:155849065-155849087 CAGGACACAATTGGAGAAACTGG + Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983321430 4:166201122-166201144 TAGGACACAATTGGAAAAACTGG + Intergenic
983366028 4:166790532-166790554 TTGGACAGGATCGGAAAAAGTGG - Intronic
983864309 4:172745646-172745668 GTGGTCACAATGGGAAGAATGGG + Intronic
984066196 4:175050512-175050534 TAGGACACATTTGGAAACACTGG - Intergenic
984985584 4:185325965-185325987 CAGGACACAACTGGAAAAACTGG - Intronic
985226978 4:187771828-187771850 TGGGACACAATTGAAGAAACTGG - Intergenic
986213317 5:5694694-5694716 TGGGCAAAAATGGGAAAAACTGG - Intergenic
987621584 5:20343073-20343095 TTAAACACAATGGGAATAATTGG + Intronic
988351864 5:30118854-30118876 TTGTACAGAAAGAGAAAAACTGG - Intergenic
988417806 5:30968239-30968261 TAGGACACAATTGGAGACACTGG - Intergenic
988457666 5:31401112-31401134 TGGGACACAGATGGAAAAACAGG + Exonic
988561881 5:32289045-32289067 TTAAATACAATGGGAATAACTGG + Intronic
988835314 5:35026572-35026594 TTAGAAACATGGGGAAAAACAGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990203835 5:53408014-53408036 TTGAACACAATGGGAAATATTGG - Intergenic
991207329 5:64064910-64064932 GTGGAAACAAAGGGAAAAAATGG + Intergenic
991265024 5:64707536-64707558 CAGGACACAATTGGAGAAACTGG - Intronic
991520172 5:67488197-67488219 TAGGACACAATAATAAAAACTGG + Intergenic
992506669 5:77394008-77394030 CAGGACACAATTGGAAACACTGG - Intronic
993278986 5:85900330-85900352 TTGGAGCAAATGGGGAAAACTGG - Intergenic
993600613 5:89919200-89919222 GAGGACACAATTGGAGAAACTGG - Intergenic
993939652 5:94043499-94043521 CAGGACACAACTGGAAAAACTGG + Intronic
994006645 5:94845372-94845394 GAGGACACCATGGGAAAACCGGG + Intronic
995173219 5:109141976-109141998 GTGGCCACACTGGGAAGAACAGG - Intronic
995393702 5:111665365-111665387 CAGGACACAGTTGGAAAAACTGG - Intronic
996181793 5:120428499-120428521 TCATACACAATGGGCAAAACTGG - Intergenic
996476341 5:123926300-123926322 CAGGACACAATTAGAAAAACTGG - Intergenic
998345444 5:141458006-141458028 CAGAACACAATTGGAAAAACCGG - Intronic
999008036 5:148004314-148004336 CAGGACACAATTAGAAAAACTGG + Intergenic
999008351 5:148006529-148006551 TTGGGTACAAAGGGAAAAAAGGG - Intergenic
1000069690 5:157728335-157728357 CAGGACACAGTTGGAAAAACTGG - Intergenic
1002030514 5:176425431-176425453 CAGGACACAATTGGAGAAACTGG - Intergenic
1003034916 6:2633952-2633974 TTGGAGTCAAAGGGAAAATCCGG - Intronic
1003374691 6:5565006-5565028 CAGGACACAACTGGAAAAACTGG - Intronic
1003497450 6:6676913-6676935 TTGCAGAAAATGGGGAAAACGGG + Intergenic
1003725725 6:8760900-8760922 TTGTACAGAAAGGCAAAAACCGG + Intergenic
1004113446 6:12744267-12744289 CAGGACACAATTGGAGAAACTGG - Intronic
1004646135 6:17562591-17562613 TAGGACACAATTGGAGAAACTGG - Intergenic
1004849101 6:19677753-19677775 TTGGACACAATGGCAATATGTGG - Intergenic
1005119560 6:22374995-22375017 CAGGACACAATTGGAAAAACTGG + Intergenic
1005573319 6:27167960-27167982 TAGGACATAATTGGAAACACTGG + Intergenic
1006015986 6:31081186-31081208 TTGGACAAAAAGAAAAAAACAGG + Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007191513 6:40022758-40022780 TTATATACAATGGGAAATACTGG + Intergenic
1007896579 6:45367533-45367555 TGGGACAAAATGCGAAAAAAAGG + Intronic
1008144571 6:47875919-47875941 TGGCACACAATGGGAAGAAAAGG + Intergenic
1008481448 6:51990073-51990095 TTGGACTAAATGAGAAAAAAAGG - Intronic
1008650941 6:53561948-53561970 CAGGACACAATTGGAGAAACTGG + Intronic
1008662003 6:53678119-53678141 TTGGACACACTGTGATAAGCAGG + Intergenic
1008678155 6:53843742-53843764 GTGGACACACTGGAAAAAAGAGG - Intronic
1009493025 6:64315372-64315394 TTGCAAACAATGGAAAAAAAGGG + Intronic
1010066964 6:71693860-71693882 TTGAACACAATGGGAAAGCAAGG - Intergenic
1010653727 6:78486655-78486677 TTGAAAATAATGGCAAAAACTGG - Intergenic
1010810702 6:80295593-80295615 CAGGACACAATTGGAGAAACTGG - Intronic
1011030414 6:82916944-82916966 TTAGACACAATAGGAGAAAGTGG - Intronic
1011403716 6:86993169-86993191 TTTCAGACAATGGGTAAAACTGG + Intronic
1012284239 6:97369027-97369049 GTGGACACAATGAGAAAAGGGGG + Intergenic
1012594794 6:101026990-101027012 CAGGACACAATTGGAGAAACTGG + Intergenic
1012713328 6:102636708-102636730 TGGGACACAATTAGAGAAACTGG + Intergenic
1013412569 6:109894517-109894539 CTGCACAGAAGGGGAAAAACAGG + Intergenic
1014605390 6:123467488-123467510 GTGGACACAATGGGTAACAATGG + Intronic
1015209579 6:130681942-130681964 TTTGACAGAATGGCAAGAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016162208 6:140895709-140895731 CAGGACACAATTGGAAAAAATGG - Intergenic
1016205939 6:141468235-141468257 CAGGACACAATTGGAGAAACTGG - Intergenic
1016219960 6:141655784-141655806 TTAAATACAATGGGAAAAATTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019002731 6:168769080-168769102 TTAAACACAATGGGAATCACTGG + Intergenic
1020350364 7:7212387-7212409 CAGGACACAATTGGAAAAACTGG - Intronic
1021512811 7:21452614-21452636 CAGGACACAATTGGAGAAACTGG - Intronic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1024013319 7:45289254-45289276 CAGGACACAATTGGAGAAACTGG + Intergenic
1024042644 7:45567217-45567239 TTGGACAGAATGGAACAGACAGG + Intergenic
1024112607 7:46162401-46162423 TTGGGCAAAAAGGGAAAAAAGGG + Intergenic
1024906576 7:54389016-54389038 GAGGACACAATTGAAAAAACTGG - Intergenic
1024928913 7:54649025-54649047 TTGGACACTATTGGCAAAAATGG - Intergenic
1025039162 7:55624638-55624660 CAGGACACAATTGGAGAAACTGG - Intergenic
1025157635 7:56623681-56623703 CAGGACACAATTGGAGAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025769073 7:64487144-64487166 CAGGACACAATTGGAGAAACTGG + Intergenic
1028146407 7:87324453-87324475 GAGGACACAATTGGAGAAACTGG - Intergenic
1028648814 7:93127742-93127764 CAGGACACAATTGGAGAAACTGG + Intergenic
1029491226 7:100871340-100871362 TTAAACACTATGAGAAAAACAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030155718 7:106452386-106452408 CAGGACACAATTGGAGAAACTGG - Intergenic
1030277215 7:107734270-107734292 TTAAATACAATGGGAATAACTGG + Intergenic
1031061587 7:117057371-117057393 TTGAGCACCATGTGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031401928 7:121335041-121335063 TTGGACAGAAAGGGACAAAACGG + Intronic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032671628 7:134088251-134088273 CAGGACATAATTGGAAAAACTGG - Intergenic
1033161846 7:139004669-139004691 TAGGACACAATTGGAAAAATTGG + Intergenic
1033865934 7:145690690-145690712 CAGGACACAATTGGAGAAACTGG + Intergenic
1036468951 8:9032733-9032755 TTGGAGACCAGGAGAAAAACTGG + Exonic
1037596395 8:20357905-20357927 TTGGACTGAATGGGTAATACAGG - Intergenic
1037955488 8:23054529-23054551 CAGGACACAATTGGAAAAACTGG + Intronic
1039439550 8:37585210-37585232 TTGGAAACAATTGGAATAAATGG + Intergenic
1039468340 8:37798692-37798714 CTGGACACAATCGAAAAGACTGG - Intronic
1039607724 8:38896475-38896497 TTGGTCATAATGGTAAAAATTGG - Intergenic
1039849388 8:41349604-41349626 CAGGACACAATTGGAAACACTGG - Intergenic
1040374249 8:46807760-46807782 CAGGACACAATTGGAGAAACTGG - Intergenic
1040526648 8:48231570-48231592 GAGGACACAATTGTAAAAACTGG + Intergenic
1041607379 8:59798802-59798824 TTGAACACAGTTGGAAAAATTGG + Intergenic
1042343790 8:67707546-67707568 TAGGACACAATTAGAGAAACTGG + Intronic
1042623269 8:70729142-70729164 CTGGACACAATTGGAGAAACTGG - Intronic
1043151431 8:76721445-76721467 ACAGACACAAAGGGAAAAACTGG + Intronic
1044001430 8:86886149-86886171 TTGAACACCATTAGAAAAACAGG + Intronic
1044378300 8:91502111-91502133 CAGGACACAATTGGAAAAACTGG - Intergenic
1044439367 8:92205343-92205365 CAGGACACAATTGGAGAAACCGG - Intergenic
1045428470 8:102090831-102090853 GAGGACACAATTGGAGAAACTGG + Intronic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1046030780 8:108781373-108781395 TTTGTCAGATTGGGAAAAACAGG + Intronic
1047118888 8:121877628-121877650 TAGGAAACAATGGGAGAAATGGG - Intergenic
1047163009 8:122402675-122402697 TTGGAGAGAATGTGAAAAAGAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049500730 8:142963462-142963484 CAGGACACAATGGGAGAAATTGG + Intergenic
1050435649 9:5607094-5607116 TAGGTCAAATTGGGAAAAACTGG - Intergenic
1050923159 9:11231181-11231203 CAGTACACAATTGGAAAAACTGG - Intergenic
1051034628 9:12728716-12728738 TTTGAGAAAATGGCAAAAACAGG - Intergenic
1051091470 9:13414449-13414471 TTGGACACAAAGGAAATAAATGG - Intergenic
1051778468 9:20661622-20661644 TTTGTCACACTGGGAAAAAGAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053551598 9:39085331-39085353 TTGAACACAAGAGAAAAAACTGG - Intronic
1053815719 9:41905458-41905480 TTGAACACAAGAGAAAAAACTGG - Intronic
1054614877 9:67281983-67282005 TTGAACACAAGAGAAAAAACTGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056710477 9:88988891-88988913 AATGACACCATGGGAAAAACTGG - Intergenic
1056728060 9:89139778-89139800 TAGGACAGAATTGGAGAAACTGG - Intronic
1057236098 9:93362319-93362341 CAGGACACAATTGGAGAAACCGG + Intergenic
1057347849 9:94267407-94267429 CAGGACACAATTGGAAAAACTGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058384189 9:104414483-104414505 CAGGACACAATTGGAGAAACTGG + Intergenic
1058997259 9:110312318-110312340 CAGGACACAATTGGAGAAACCGG + Intronic
1059491542 9:114671686-114671708 TTGTACAGAATAGGAAAAAATGG - Intergenic
1060330305 9:122662278-122662300 TTTGACAAAATGGGAGGAACAGG - Exonic
1061830303 9:133288036-133288058 CAGGACACAATGGGAGAAACTGG - Intergenic
1186852947 X:13598166-13598188 TTGGACATAACGGGAAACCCAGG - Intronic
1186870337 X:13765245-13765267 TTGGACACAAGGGGAAAGGAAGG - Intronic
1187084714 X:16029834-16029856 TTGGACACAAAGTGGAAAAAAGG - Intergenic
1187139722 X:16581954-16581976 TCAGACACAATTGGAGAAACTGG + Intergenic
1188113775 X:26220608-26220630 TAGGACACACTAGGAAACACCGG - Intergenic
1188159236 X:26779893-26779915 TAGGACACAATTGGAGGAACTGG - Intergenic
1188167675 X:26881646-26881668 CAGGACACAATTGGAAAAATTGG - Intergenic
1188964554 X:36535460-36535482 TTGAACAGAATGGGAGAAAAAGG - Intergenic
1189632607 X:42970772-42970794 AAGGACACAATTGGAGAAACTGG - Intergenic
1190149717 X:47935077-47935099 CAGAACGCAATGGGAAAAACTGG + Intronic
1190154670 X:47979778-47979800 CAGGAAACAAAGGGAAAAACTGG + Intronic
1190723018 X:53166728-53166750 CGGGACACAATTGGAAAAACTGG + Intergenic
1191120969 X:56904697-56904719 TGGGACACAATTGGATAAAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192323296 X:70109942-70109964 TAGGACACAATTGGAGACACTGG - Intergenic
1192573534 X:72225071-72225093 TTGGGAACAATAGGATAAACAGG - Intronic
1192765510 X:74136052-74136074 CAGGACACAATTGGAAAATCTGG + Intergenic
1192775153 X:74236948-74236970 CTGGACAAAATGGGAAACAATGG - Intergenic
1192777279 X:74258444-74258466 CAGGACACAATTGGAAAAACTGG + Intergenic
1192864897 X:75120649-75120671 CAGGACACAATTGGAGAAACTGG + Intronic
1193075871 X:77355159-77355181 TTGGACGAAAAGGGAAAAAAGGG + Intergenic
1193531901 X:82664629-82664651 GAGGACACAATTGGAGAAACTGG - Intergenic
1193705352 X:84814317-84814339 CAGGACACAATTGGAAAAACTGG - Intergenic
1193833781 X:86318007-86318029 CAGGACACAATTGGAAAAACTGG - Intronic
1194044777 X:88988893-88988915 CAGGACACAATTGGAAACACTGG + Intergenic
1194045559 X:88997494-88997516 CAGGACACAATTGGAAACACTGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194158338 X:90420446-90420468 CAGGACACAATTGGATAAACTGG - Intergenic
1194166943 X:90528849-90528871 CAGGCCACAATTGGAAAAACTGG + Intergenic
1194411837 X:93566931-93566953 TAGGATACAATTGGAGAAACTGG - Intergenic
1195004767 X:100674898-100674920 TAGGAAACAATAGCAAAAACAGG + Exonic
1195910858 X:109887250-109887272 TGGGACAGAATGGGGAAAATTGG - Intergenic
1196037677 X:111164611-111164633 TTGGACATATAGGGAAAAAAGGG - Intronic
1196074227 X:111557045-111557067 CAGGACACAATTGGAAAAACTGG - Intergenic
1196162079 X:112496368-112496390 CAGGACACAATTGGAGAAACTGG - Intergenic
1196520506 X:116665528-116665550 TAGGATGCAATTGGAAAAACTGG - Intergenic
1196757156 X:119167930-119167952 TTTGACACCATGTAAAAAACTGG + Intergenic
1197043065 X:121963663-121963685 CAGGACACAATGGGAGAAACTGG + Intergenic
1197269178 X:124407492-124407514 CTGGACACAATGGTAGAGACTGG + Intronic
1197803667 X:130378385-130378407 TTGTACACAATGGGGCAGACGGG - Intergenic
1198090925 X:133329110-133329132 GAGGACACAGTGGGAAAAACAGG + Intronic
1198181690 X:134216206-134216228 CAGGACACAATTGGAGAAACTGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198662648 X:138986765-138986787 ATGGATTCAATGGGAAAATCAGG - Intronic
1198855678 X:141013393-141013415 CGGGACACGATTGGAAAAACTGG + Intergenic
1198876453 X:141232746-141232768 CGGGACACGATTGGAAAAACTGG - Intergenic
1198907016 X:141573975-141573997 CGGGACACGATTGGAAAAACTGG - Intergenic
1198909779 X:141600483-141600505 CGGGACACGATTGGAAAAACTGG + Intronic
1198910169 X:141604895-141604917 ATGGAGACAAAGGGAAAGACAGG + Intronic
1198917307 X:141687656-141687678 CGGGACACGATTGGAAAAACTGG - Intronic
1199887278 X:152032720-152032742 CAGGACACAATTGGAGAAACTGG - Intergenic
1200504660 Y:3997410-3997432 CAGGACACAATTGGATAAACTGG - Intergenic
1200513210 Y:4106625-4106647 CAGGCCACAATTGGAAAAACTGG + Intergenic
1201132665 Y:10965021-10965043 TTGAACACAATGGGATAGAGTGG - Intergenic
1201324894 Y:12745606-12745628 TTGCACACAATTTGAAAAACTGG - Intronic
1201363470 Y:13179028-13179050 CAGGACACAATTGGAAACACTGG + Intergenic
1201376025 Y:13320776-13320798 GAGGACACAATGGAAGAAACTGG + Intronic
1201636747 Y:16131635-16131657 CGGGACACAATTGGAGAAACTGG + Intergenic