ID: 976986831

View in Genome Browser
Species Human (GRCh38)
Location 4:91311112-91311134
Sequence ATGTATTTACAGAAGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976986831 Original CRISPR ATGTATTTACAGAAGAAGAT AGG Intronic
901218428 1:7567714-7567736 ATGTATTTTCACAAGATGCTGGG + Intronic
904181781 1:28670870-28670892 ATGTATTTGCTGAAGTAAATAGG - Intronic
904354431 1:29929938-29929960 ATTTATTTGCAGAAGAAACTGGG + Intergenic
904372990 1:30062374-30062396 AGTTATCTACAGAAGAGGATAGG - Intergenic
904639096 1:31908950-31908972 TTGTATTTTCAGAAAAAGAAGGG - Exonic
904851634 1:33463910-33463932 ATGAGTTTATGGAAGAAGATGGG - Intergenic
905812704 1:40924577-40924599 ATGTATATACCGAAGAATAACGG + Intergenic
906550659 1:46663812-46663834 AGGTAGTTACAGTAGAAAATTGG - Intronic
906766289 1:48437698-48437720 AAGTATTAACAGAAGAAAAAAGG - Intronic
907264248 1:53246654-53246676 CTATATTTACAGAAGATGTTTGG - Exonic
908359788 1:63357627-63357649 TTGTATTTTCAGTAGAAAATGGG - Intergenic
908565769 1:65354777-65354799 ATTTATTTACAGAATAAAAGGGG - Intronic
911356914 1:96834004-96834026 ATGTATTTACAAAAAAAGGAAGG - Intergenic
911438579 1:97896005-97896027 ATGTAATTACAGTGTAAGATTGG - Intronic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
912300876 1:108515739-108515761 GTGTATTTAAATAGGAAGATAGG - Intergenic
916078009 1:161214168-161214190 TTGTATTTGGAGAAGTAGATCGG + Exonic
916245201 1:162680821-162680843 GTGTTTTTATAGAAGAAGACTGG - Intronic
917050944 1:170922523-170922545 ATAGATATAAAGAAGAAGATAGG + Intergenic
917202202 1:172529722-172529744 ATATATATAAAGAAGATGATCGG + Intergenic
917423944 1:174893961-174893983 ATGTAATTACAGAGGAAAAAAGG - Intronic
917643976 1:177011412-177011434 TGTTATTTATAGAAGAAGATGGG - Intronic
917909195 1:179623941-179623963 ATGTATTTATAGAATGAGTTGGG - Intronic
918639744 1:186825673-186825695 ATATAGTTAGAGCAGAAGATAGG + Intergenic
920125402 1:203690394-203690416 TTTTATTTACATAATAAGATAGG + Intronic
920543460 1:206796712-206796734 GTGTATTTACACAATAAGATAGG - Intergenic
920557301 1:206913545-206913567 ATGTATGAAAAGAACAAGATAGG - Intronic
923133986 1:231101420-231101442 TTTTATTTAGAAAAGAAGATAGG - Intergenic
923913478 1:238476545-238476567 ATGTGTTAATAGAAGAAGAAAGG - Intergenic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
924764461 1:247019485-247019507 AGGTATTTAAATAGGAAGATAGG + Intergenic
1063682357 10:8201076-8201098 ATTTATTTAAAAAAGAAGGTAGG + Intergenic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1066596785 10:37059662-37059684 ATATATTTACACATGAAGATAGG + Intergenic
1068291378 10:55005644-55005666 ATGAACTTACAGAAGAATAGAGG - Intronic
1068545953 10:58345949-58345971 ATGTACTTAATGCAGAAGATTGG + Intronic
1069189993 10:65475388-65475410 TTGTATTTACAGAAAAAAACTGG - Intergenic
1069389118 10:67913849-67913871 ATGTATTTACAGCAAATGACTGG - Intronic
1070575859 10:77678293-77678315 ATCTTTTTTCAGAAGAAGGTGGG - Intergenic
1070723333 10:78771732-78771754 ATGTTTTTTCAGAAGAGGAAAGG + Intergenic
1071380255 10:85052396-85052418 ATGTTTTTACAAAGGGAGATTGG + Intergenic
1072509576 10:96106226-96106248 AGCTATTTACAGAAGATGTTTGG - Intergenic
1074155029 10:110790744-110790766 ATGAAGTTACACAATAAGATAGG - Intronic
1074329950 10:112496266-112496288 AAGTATTTACATATGAAGGTTGG + Intronic
1075192432 10:120322114-120322136 ATGTGTTCACAGAAGAGAATTGG - Intergenic
1075297328 10:121289510-121289532 ATTTATTTACATAAGAAAAGAGG - Intergenic
1077972622 11:7210997-7211019 AGGTATTTAAAAAAGAGGATGGG - Intergenic
1078499087 11:11851483-11851505 ATGTATTTACACAAGAATTGCGG + Intronic
1078853301 11:15183984-15184006 ATGTATTTAAAGAAAAAGAAAGG - Intronic
1079439774 11:20499640-20499662 ATTTTTTTAAAGAAGAAGATGGG + Intronic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1079740677 11:24055829-24055851 TTGTATTTTTAGTAGAAGATGGG + Intergenic
1080014006 11:27486174-27486196 TTGTATTTACAGAAGGCAATGGG + Intergenic
1081496687 11:43618378-43618400 ATGTATTTCAAGAAGAATTTTGG + Intronic
1081516759 11:43839494-43839516 TTGTATTATCAGAAGAAGATGGG + Intronic
1081576554 11:44322159-44322181 TTGGATTTACAGAACAAGGTTGG - Intergenic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1085368028 11:75970794-75970816 ATGTTTTAACAGAAGAAATTGGG - Intronic
1085613709 11:77977504-77977526 ATGTATTTAAAGAAAAAAAATGG + Intronic
1085676035 11:78519495-78519517 ATATATTTATAGAAAAAGATTGG - Intronic
1086346066 11:85897983-85898005 TTGTATTTTTAGTAGAAGATGGG - Intronic
1087291308 11:96323588-96323610 ATCTATTTATAGAATAAGTTTGG - Intronic
1087360993 11:97159155-97159177 ATGTCTTTACAGAAAAGGAGCGG - Intergenic
1087583680 11:100091599-100091621 TTGTATTTTCAGTAGAAAATGGG + Intronic
1088010827 11:104999018-104999040 ATGTCTCTACAGAAAAACATGGG - Exonic
1089319701 11:117617113-117617135 ATGTTTGCAGAGAAGAAGATGGG + Intronic
1089724792 11:120466587-120466609 GAGTATTTACACAAGAGGATGGG + Intronic
1090035696 11:123247636-123247658 ATGTATTTACAGAATCCCATCGG - Intergenic
1092871140 12:12806951-12806973 ATGTATGTTCAGATGAAGAAAGG - Intronic
1093771762 12:23026345-23026367 AAATATTTTCAGAAGAAAATAGG - Intergenic
1093844650 12:23954628-23954650 AGGTCTTTAAAAAAGAAGATAGG - Intergenic
1094328504 12:29267176-29267198 TTTTATTTACAAAAGAAAATGGG + Intronic
1095631520 12:44382214-44382236 ATGTATGTACAAATGAAGACAGG - Intronic
1095931567 12:47631435-47631457 ATGCAGTTGCAGAAGTAGATGGG + Intergenic
1096277897 12:50226335-50226357 AGGTATTTAAAGAAGAGGGTGGG - Intronic
1097081634 12:56435639-56435661 TTGTATTTTTAGTAGAAGATGGG - Intronic
1097442524 12:59628426-59628448 AAGAACTTAGAGAAGAAGATTGG - Intronic
1097809209 12:64000202-64000224 AAGTATTTGAAGAAGAACATTGG + Intronic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1098061452 12:66567624-66567646 ATGTCTATAATGAAGAAGATAGG - Intronic
1098822417 12:75249685-75249707 ATGTATCCACAGAAGCAAATGGG - Intergenic
1099221026 12:79914596-79914618 ATGTATTTTGAGGAGATGATGGG - Intronic
1099260649 12:80377030-80377052 ATATATTTACAGTTGAAAATTGG - Intronic
1099530885 12:83779649-83779671 ATGTAGTTACAGAAGTAGGGTGG - Intergenic
1099853042 12:88128051-88128073 TTTTATTTACAAAAGCAGATGGG - Intronic
1100331139 12:93583260-93583282 ATGTGTTCCCAGAAGATGATGGG + Intronic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1101482723 12:105116735-105116757 ATGTATTTAAATAAGAAGAGAGG + Intronic
1102271658 12:111541706-111541728 GTGTATTAACAGAAGAACTTTGG - Intronic
1102363398 12:112309371-112309393 ATGCATTAACAGAACAAGATGGG + Intronic
1102822813 12:115922931-115922953 ATGTTTCTACATAACAAGATAGG - Intergenic
1105320093 13:19311284-19311306 AGGTATTTACATATGAAGAGAGG - Intergenic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1106975378 13:35205238-35205260 ATGTAGGTGCAGAAAAAGATCGG + Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107813780 13:44225539-44225561 ATATATTTCCAGAAGAAAATGGG + Intergenic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108173091 13:47763829-47763851 ATGAACCTACAGAAGAAGAATGG + Intergenic
1108830166 13:54467921-54467943 ATGTGTTTGGAGAATAAGATAGG - Intergenic
1108898055 13:55360080-55360102 ATTACTTTACAGAAGAAGAGAGG - Intergenic
1108962918 13:56259016-56259038 ATGTATTTTCAGTAGATTATGGG + Intergenic
1108966444 13:56310202-56310224 ATCTTTTTACAGAATAAGGTAGG + Intergenic
1109847271 13:68011188-68011210 ATTTATTTACTTTAGAAGATAGG + Intergenic
1109867626 13:68286158-68286180 ATGAATTTCCTGATGAAGATGGG - Intergenic
1109901705 13:68781175-68781197 ATGTATTTGCGGAAGCAGAGTGG - Intergenic
1109955402 13:69558908-69558930 ATGTATGTATAGAAAAACATTGG - Intergenic
1110429744 13:75410499-75410521 CTGTATTTGCTGAAGAAGTTGGG + Intronic
1110664389 13:78099526-78099548 ATCTATTTCCAGAAGGAAATTGG - Intergenic
1111146472 13:84187722-84187744 ATGGATTTACAGAAGCAAAGAGG + Intergenic
1111293566 13:86199920-86199942 TTGTATTTTTAGAAGAAGTTGGG + Intergenic
1111371553 13:87325660-87325682 ATGTTTTTACATAAGGAGAGAGG + Intergenic
1112369160 13:98779695-98779717 ATGTATTTGTTGAAGAAAATGGG - Intergenic
1112380854 13:98888278-98888300 AAGTATTTATAAAAGAACATGGG + Intronic
1113008531 13:105736288-105736310 ATATAGTCACAGAATAAGATTGG - Intergenic
1113977617 13:114241267-114241289 ATCTTTTTACAGATGAGGATAGG + Intronic
1114197554 14:20492458-20492480 ATGTATTTTAAGAAGGAGATAGG + Intergenic
1114854725 14:26424545-26424567 ATTTATATTCAAAAGAAGATTGG + Intergenic
1115898089 14:38113229-38113251 ATTTATTTACTGAAGGAGCTGGG + Intergenic
1115949383 14:38702735-38702757 AAGTATTAATAGAAGAAGAATGG + Intergenic
1116418997 14:44711443-44711465 AAGAATTTACCGAAGAGGATAGG - Intergenic
1116762442 14:49031354-49031376 AGGTAATTACAAAAGATGATGGG + Intergenic
1117158377 14:52963278-52963300 ATGTATGTAGAGAAGAAAAGAGG - Intergenic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1118238380 14:64032742-64032764 TTGTATTTTTAGTAGAAGATGGG + Intronic
1118468380 14:66052581-66052603 AAGAATTTAGGGAAGAAGATGGG + Intergenic
1118930744 14:70238045-70238067 ATTTATTGAGAAAAGAAGATAGG - Intergenic
1120355379 14:83426932-83426954 TTGTATTGAAAGAAGAAGGTGGG - Intergenic
1120398252 14:83995632-83995654 ATGTATTTAAAGATGTATATAGG + Intergenic
1122381354 14:101309376-101309398 ATGTATTTTGAGGATAAGATGGG + Intergenic
1123428431 15:20192557-20192579 ATCTTTTTACATAAGAAGAAAGG - Intergenic
1123950851 15:25273113-25273135 ATATATTTGCCAAAGAAGATAGG + Intergenic
1124958139 15:34373545-34373567 AAGCATTTGCAGTAGAAGATGGG + Intergenic
1125128167 15:36249212-36249234 AAGAATATACAGAAGAAGATAGG - Intergenic
1125486560 15:40115287-40115309 TTGTATTTTTAGTAGAAGATGGG - Intergenic
1125718424 15:41833113-41833135 TTGTATTTTCAGAAGATGACTGG + Intronic
1125781907 15:42276801-42276823 ATGTATTTACAAAAAAATACTGG - Intronic
1125848136 15:42877463-42877485 ATTTATTTACTGAAGAAATTAGG - Intronic
1125884924 15:43221428-43221450 ATGTATTAAAAGTAGAAGCTGGG + Intergenic
1125929790 15:43592468-43592490 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1125942957 15:43692300-43692322 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1127566849 15:60197835-60197857 ATTTATTGACAGAAGTAGTTGGG - Intergenic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1129975815 15:79820785-79820807 ATGTATGTACTAGAGAAGATTGG - Intergenic
1130173618 15:81544498-81544520 ATTAGTTTACAGCAGAAGATAGG - Intergenic
1130394749 15:83492397-83492419 ATGTATTTACTGAAGAAATGTGG - Intronic
1131291972 15:91114347-91114369 AAGAGTTTACACAAGAAGATGGG + Intronic
1131707949 15:95019007-95019029 TTCTATTTACAAAAGGAGATTGG + Intergenic
1133660884 16:7916341-7916363 ATGTATTGTAAGAAGAATATTGG - Intergenic
1134679783 16:16116415-16116437 ATGTATGTACAGAAAAAAACAGG - Intronic
1135966126 16:27036671-27036693 ATGGATTTACAGAAGACTATTGG + Intergenic
1136706598 16:32194084-32194106 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1136761313 16:32735333-32735355 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1136806790 16:33135053-33135075 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1137507721 16:49068899-49068921 AGGTGCTTAGAGAAGAAGATGGG - Intergenic
1138197534 16:55062668-55062690 ATCTATTTTGAGAAGATGATGGG + Intergenic
1139078753 16:63487860-63487882 ATGTATTTAGTGCAGATGATTGG + Intergenic
1139300752 16:65943391-65943413 ATGTATTTAGAGAACAACCTGGG - Intergenic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1203063465 16_KI270728v1_random:995650-995672 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1203090763 16_KI270728v1_random:1212066-1212088 AGATATTTACAGAACAAAATGGG + Intergenic
1146362116 17:32185577-32185599 TTGTATTTTTAGTAGAAGATGGG + Intronic
1148003849 17:44408782-44408804 AGGTAGATACGGAAGAAGATGGG + Intronic
1150203953 17:63386561-63386583 ATGTATTTACAAAAGTAGAGAGG - Intronic
1151143239 17:72015500-72015522 ATGTATTTTAAAAAGGAGATGGG + Intergenic
1154312520 18:13278363-13278385 ATCTATTCACAGTAGAAGCTTGG + Intronic
1154376417 18:13813861-13813883 ATATATTTATTGTAGAAGATCGG + Intergenic
1156231049 18:35154141-35154163 ATTTCTTTACTGAAAAAGATGGG + Intergenic
1156418884 18:36929101-36929123 AAGTATTTAGTGAAAAAGATGGG - Intronic
1156430524 18:37068615-37068637 GAGAATTTACTGAAGAAGATAGG - Intronic
1156684853 18:39632211-39632233 ATTAAGTGACAGAAGAAGATAGG + Intergenic
1156685184 18:39636692-39636714 ATGGGTTCACAAAAGAAGATTGG - Intergenic
1156760972 18:40590014-40590036 ATCTATTTAGAAAAAAAGATGGG - Intergenic
1156984277 18:43330557-43330579 ATATATTTGCAGTAGTAGATGGG - Intergenic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1157655438 18:49383076-49383098 GTGTATTTATTGAAGAAAATGGG - Intronic
1157745880 18:50135046-50135068 GTGTATTTAAAGAGGAAGAGTGG - Intronic
1158254087 18:55526143-55526165 ATGTATTTACAGAACCACAAAGG + Intronic
1158594573 18:58804871-58804893 CTGTAGTTAGAGAAGAAGAAAGG - Intergenic
1159146638 18:64462982-64463004 ATGTATTTATATAAGAAACTAGG + Intergenic
1159848396 18:73494955-73494977 AAGAATGTACAGAAGAAGCTAGG + Intergenic
1160096865 18:75881621-75881643 ATGATTTTACAGATGAACATTGG - Intergenic
1163076532 19:14897412-14897434 TTGTATTTTTAGTAGAAGATGGG + Intergenic
1163874175 19:19852588-19852610 CTGTATTTAAAGAACAACATGGG + Intergenic
1164758640 19:30710101-30710123 AGGTATTTAGAGAACAAGACAGG - Intronic
1166869363 19:45862221-45862243 ATGTTCTTAAATAAGAAGATTGG - Intronic
1167565580 19:50254363-50254385 TAGTATTTACACAAGGAGATTGG + Intronic
1168081299 19:54012342-54012364 ACGTATTTACAGAGGGAGAAAGG - Exonic
927773877 2:25887043-25887065 ATGTAATACCAGAAGAAGAGGGG + Intergenic
928360312 2:30657239-30657261 TTGTATTTTCAGTAGAAGACGGG + Intergenic
930010703 2:46936302-46936324 AAGTTTTTAGAGAAGAAGATAGG + Intronic
931562782 2:63580848-63580870 ATATATTCACTGAAGAATATAGG + Intronic
931585351 2:63820547-63820569 ATGTGTTTAAAGAATGAGATAGG - Intronic
933909515 2:86927541-86927563 ATCTAGTTGCAGAAGCAGATTGG + Intronic
934023210 2:87975838-87975860 ATCTAGTTGCAGAAGCAGATTGG - Intergenic
935683125 2:105655608-105655630 TTGTATTTTCAAAAAAAGATTGG + Intergenic
936109011 2:109649857-109649879 ATGTGTTTAAAGAAAAACATTGG + Intergenic
936579039 2:113680095-113680117 AGGTAATTGCAGAAGGAGATAGG - Intergenic
936772301 2:115928668-115928690 ATGAATCTACAGAACAAGTTGGG + Intergenic
937007477 2:118530541-118530563 TTGTATTTTCAGGGGAAGATTGG + Intergenic
937828304 2:126391815-126391837 ATATATTTAGAAATGAAGATTGG - Intergenic
937929578 2:127193646-127193668 ATGTATTTTAAGATGAAGATGGG - Intronic
938921014 2:135994996-135995018 ATGGATTTACAAAATAAGACTGG - Intergenic
939348646 2:141002277-141002299 ATGTAATTACAGAATAGAATAGG + Intronic
939565269 2:143779714-143779736 ATGTAGTCATAGAAGAAGAGAGG + Intergenic
940085934 2:149858893-149858915 ATGCATTTAAAGAAGAGCATTGG - Intergenic
940182274 2:150947949-150947971 ATCTATTTAGAGAAGAATATAGG - Intergenic
941307256 2:163885574-163885596 AAGGATTGGCAGAAGAAGATAGG - Intergenic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
942385002 2:175433173-175433195 TTGTATTTAAAAAAGAAGCTTGG + Intergenic
943284953 2:185985904-185985926 CTGTCTTTACAGAAAAAGTTTGG - Intergenic
943764659 2:191647889-191647911 CTGTATTATTAGAAGAAGATGGG - Intergenic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944265304 2:197718183-197718205 ATGTTTTTAGAGAAGAAAGTTGG + Intronic
944617796 2:201480647-201480669 AAGTATTAACAGAAGAAAAAGGG - Exonic
944879953 2:204002601-204002623 ATGGATTTAGAAAAGAAGAAAGG + Intergenic
945701445 2:213175800-213175822 CTGTATTTACTTAAGAAGACCGG - Intergenic
946676997 2:222170869-222170891 ATGCATTTATAGAAGAAGATGGG - Intergenic
946970780 2:225088724-225088746 ATATATGTTTAGAAGAAGATTGG + Intergenic
947042238 2:225936289-225936311 AGGTATTTCCAAATGAAGATGGG + Intergenic
947167310 2:227275573-227275595 ATTTATTTATAGAAAAAAATAGG - Intronic
948546937 2:238739347-238739369 GTGTATATGCAAAAGAAGATAGG - Intergenic
948590429 2:239046173-239046195 ATGTATTTGCAGAAGAAATCCGG - Intergenic
1168919852 20:1522196-1522218 ATGTACTTTGGGAAGAAGATAGG - Intergenic
1169578182 20:6989578-6989600 ATGAATTTACAGCAGATGCTAGG - Intergenic
1169898274 20:10527257-10527279 ATGTATTTAAATAATAAGTTAGG - Intronic
1170632718 20:18079230-18079252 AGGTTTTTACAATAGAAGATGGG + Intergenic
1171383575 20:24752144-24752166 TTGTATTTTTAGTAGAAGATGGG + Intergenic
1173447830 20:43136252-43136274 ATGAATTTACAGCAGACTATGGG - Intronic
1175082800 20:56435485-56435507 ATGTATTGATATAAAAAGATTGG + Intronic
1177411585 21:20737053-20737075 ATGTAATTACAGAAGCAAAGGGG - Intergenic
1177411588 21:20737090-20737112 ATGTAATTACAGAAGCAAAGGGG - Intergenic
1177724741 21:24952331-24952353 ATGTATTTACAGAAACAATTAGG - Intergenic
1177770505 21:25509563-25509585 AGGTATTTAGAGAAAAACATAGG - Intergenic
1178130820 21:29570936-29570958 CTGTATTTACACAAGAGAATAGG - Intronic
1178463779 21:32827279-32827301 ATGTATTTTTAGTAGAAGACGGG - Intergenic
1178488830 21:33035130-33035152 CTCTATTTACATAAGAAGAGAGG - Intergenic
1178559577 21:33626128-33626150 TTGTATTTTTAGTAGAAGATGGG + Intronic
1178925578 21:36772332-36772354 ATGTATTTATAGAAAAATACAGG + Intronic
1178961243 21:37067733-37067755 ATGTAAGTATAGAAGAGGATAGG - Intronic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
949212963 3:1527576-1527598 ATGTATTTTCAAAAGAACAGTGG - Intergenic
949926347 3:9045338-9045360 ATGCATTTTCAGAAGTAGAGGGG - Intronic
950315147 3:11995455-11995477 AGGTGTTTGCAGAGGAAGATGGG + Intergenic
950830814 3:15874120-15874142 ATATATTAACAAAAGGAGATAGG - Intergenic
952032129 3:29155975-29155997 ATGTGGTTACACAAGATGATCGG - Intergenic
952524892 3:34199532-34199554 ATGTAATGACAGAATAAGCTTGG + Intergenic
952625788 3:35401687-35401709 ATGAATTAAAAGAAGAAAATGGG - Intergenic
953196845 3:40742364-40742386 TTGTTTTTTTAGAAGAAGATGGG - Intergenic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
955215382 3:56981101-56981123 ATGTATTTCCCCAGGAAGATGGG - Intronic
955248856 3:57257068-57257090 AGTTATTTAAAGAAGGAGATGGG + Intronic
955257805 3:57352075-57352097 AGTAACTTACAGAAGAAGATTGG + Intronic
955898025 3:63721511-63721533 TGGTATTTACATAAGAAGAGAGG + Intergenic
957430783 3:80103447-80103469 ATGTTTTTAAAGGAGAAGGTAGG - Intergenic
957742965 3:84298306-84298328 ATATAATTACAGAACAATATTGG - Intergenic
958118292 3:89251142-89251164 AAGTATCTCCAGAAGAACATTGG - Intronic
959235502 3:103717549-103717571 ATTTAATTACAAAAGAAGAAAGG - Intergenic
959528146 3:107400631-107400653 ATGTATTTTCATAACAAGATAGG + Intergenic
963194004 3:142506221-142506243 ATGTATCTAAAGGAGAAGGTAGG + Intronic
963390266 3:144653864-144653886 ATGTATATGTAGAAGATGATGGG + Intergenic
963456694 3:145554877-145554899 ATGTGTTTTGAGAATAAGATGGG + Intergenic
963982069 3:151549451-151549473 CTGGATATAAAGAAGAAGATAGG - Intergenic
965008103 3:163052387-163052409 ATATATATCCTGAAGAAGATTGG + Intergenic
965133025 3:164725786-164725808 ATGTATTTAAATAAGATCATTGG - Intergenic
965759743 3:172063082-172063104 ATGTATTTAACAAGGAAGATAGG - Intronic
965941048 3:174182136-174182158 ATATATTTAGAAAAAAAGATTGG - Intronic
967908620 3:194522847-194522869 ATGTATTTGTTGAAGAAGCTGGG - Intergenic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
970086977 4:12360191-12360213 AAGTATTTACACAAGATCATTGG + Intergenic
970814767 4:20141912-20141934 ATGTATTGACAATAGAAGAAAGG + Intergenic
970841151 4:20470987-20471009 ATGTTTCTACAGAAGAAAAGGGG + Intronic
970883758 4:20962912-20962934 ATATTTTGACAGAAGAATATTGG + Intronic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
971158521 4:24108867-24108889 ATGTGTTGAGAGAAAAAGATGGG + Intergenic
971521819 4:27562117-27562139 TTGTATTTACAAAACATGATGGG - Intergenic
971596477 4:28535570-28535592 ATGAATTGCCAGAAGAAGAAAGG - Intergenic
973798528 4:54452347-54452369 ATGAATTGACAGAAGTAGGTGGG + Intergenic
973861665 4:55070878-55070900 ATGTGTTTTCAGAATATGATTGG - Intergenic
974148655 4:57977454-57977476 AATTATTTACAGAATAAGGTAGG + Intergenic
974401047 4:61407295-61407317 TTGTTATTACAGAAGTAGATAGG + Intronic
974527630 4:63063592-63063614 AGGTATTTACAGAATAAAAATGG - Intergenic
974872881 4:67665137-67665159 ATTTTTTTACAGAAAAAGAAAGG - Intronic
975050729 4:69861237-69861259 ATGTATTTACTGAATAAAAGTGG + Intergenic
975099694 4:70498534-70498556 ACATATTCACAGAAGATGATTGG + Intergenic
975629932 4:76389510-76389532 AGGGAGTTAGAGAAGAAGATAGG + Intronic
976875916 4:89853353-89853375 TTGTATTTATAGTAGAAGACAGG + Intergenic
976986831 4:91311112-91311134 ATGTATTTACAGAAGAAGATAGG + Intronic
977005284 4:91561014-91561036 ATGTATTTAAAGTACAAGTTTGG - Intronic
977494637 4:97759597-97759619 ATGTATGTAGAAAAGAAGGTTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978358650 4:107904941-107904963 AAAAAATTACAGAAGAAGATGGG + Intronic
979066404 4:116140927-116140949 ATATATTTATAAAAAAAGATTGG + Intergenic
979187852 4:117821150-117821172 ATGTAATCACCAAAGAAGATAGG + Intergenic
979917989 4:126462879-126462901 ATGTATACCCAGAAGAAAATTGG - Intergenic
980021351 4:127713924-127713946 ATTAATTTACAGAAAAAGAAAGG + Exonic
980281638 4:130730800-130730822 ATCTATGTACAGATGAAAATCGG + Intergenic
980561787 4:134486810-134486832 CCGTATTTAAAGAAGAAGAGTGG - Intergenic
980732821 4:136844741-136844763 ATGTATTCAAAGAGGAAGAGAGG - Intergenic
980769451 4:137352036-137352058 ATGAATTGACAGAAGAAGGTGGG + Intergenic
981213139 4:142132240-142132262 ATGTTTGTAGAGAATAAGATTGG + Intronic
981566603 4:146108172-146108194 CTGTAATTACATTAGAAGATGGG + Intergenic
982128358 4:152204040-152204062 TTGTATTTTTAGTAGAAGATAGG - Intergenic
983158388 4:164380748-164380770 TTGTATTTCCAGAAAAAGTTAGG + Intronic
985148993 4:186927242-186927264 ATGTTTTAACAGAAGAATTTTGG - Intergenic
986129659 5:4916254-4916276 ATGTATTACCAGTAGAATATTGG + Intergenic
986398380 5:7354047-7354069 ATGTATTTGCAGATAAAGTTGGG - Intergenic
988176895 5:27739514-27739536 ATGTATGAACATAAGAAGAGAGG + Intergenic
988282056 5:29162236-29162258 ATGAATGTCCAGAAGAAGCTAGG + Intergenic
988475956 5:31586127-31586149 AATTATTTACAGAAGAAAAAAGG + Intergenic
989823244 5:45821090-45821112 ATGTATTTAAAGAAAGAGATAGG + Intergenic
990358344 5:54993562-54993584 ATATGTTTACAGAGGAAGACAGG - Intronic
990818220 5:59808837-59808859 TTGTCTTTACAGAAGAACTTGGG - Intronic
991332693 5:65509531-65509553 ATTTATTTACTGAAGAATGTCGG + Intergenic
991348049 5:65691273-65691295 ATGTATTTAGAAACCAAGATTGG - Intronic
992736264 5:79724727-79724749 ATGTATTAACAGAAGAGAAATGG - Intronic
993251442 5:85529679-85529701 ATGTATTTTCAAAAGCAGAGAGG - Intergenic
993916768 5:93753642-93753664 ATGTATTTTAAAAAGAAGAAAGG - Intronic
994012972 5:94929158-94929180 ATGTACCTACAGAGGAAGAAAGG - Intronic
994049904 5:95350600-95350622 GTATATTTAGAAAAGAAGATGGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994776467 5:104040987-104041009 ATATATTTAAAGAAGAATATAGG - Intergenic
996035892 5:118758591-118758613 AAGTATGTACAGAGGAAAATAGG - Intergenic
996216403 5:120871860-120871882 ATGGATTTATAGAGGAAGAAAGG - Intergenic
996967835 5:129326134-129326156 TTGTTTTTACAAAACAAGATTGG - Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
998959872 5:147473828-147473850 ATATATTTAAAAAAGAAAATTGG - Intronic
999011442 5:148045389-148045411 TTTAATTTACAGACGAAGATAGG - Intronic
999880648 5:155860025-155860047 CTGTATTTACAGCAGGAGAGGGG - Intergenic
1000043957 5:157506108-157506130 ATATATGTTCAGAAGAAGAATGG - Intronic
1000513753 5:162215015-162215037 TTGTTGTTACAGAAGAAGCTAGG + Intergenic
1001466690 5:171973285-171973307 ATTTATTTATTGAAGAAGCTAGG - Intronic
1005078018 6:21927539-21927561 ATATATTCACAGAAAAACATAGG + Intergenic
1005472386 6:26173925-26173947 TTGTATTATCAGAAGAAGATAGG + Intergenic
1006884371 6:37368608-37368630 ATGAAGTTACTGAAGAAGACTGG + Exonic
1008074752 6:47133976-47133998 TTGTATTTTCAGTAGAATATGGG - Intergenic
1011037504 6:82993721-82993743 AAGAATTTAAGGAAGAAGATTGG - Intronic
1011481178 6:87795625-87795647 ATGTTTGTAGAGAAGAAGAAAGG - Intergenic
1012965547 6:105669306-105669328 ATGAATTTACCTAAGCAGATCGG + Intergenic
1012988342 6:105898809-105898831 AGCTATTTTCAGAAGAAGAGTGG - Intergenic
1013859117 6:114612749-114612771 ATGAATTTCCAAAAGGAGATGGG - Intergenic
1014824881 6:126037938-126037960 ATGAATTTATAGAAGCACATGGG + Intronic
1016195310 6:141329028-141329050 ATGTCTTTTCAAAAGAAAATTGG - Intergenic
1016206199 6:141471608-141471630 AAGTATTGACTGAAGATGATTGG + Intergenic
1016297378 6:142587691-142587713 ATGAATTTACAGGAAATGATAGG + Intergenic
1016611332 6:145993175-145993197 TTGTATTTACAGAAAAAAATTGG - Intergenic
1017223182 6:151990002-151990024 ATGTATTTACATGAAAACATTGG - Intronic
1017339864 6:153308507-153308529 TTGAAATTACAGAAGAAGAGTGG - Intergenic
1018171778 6:161149335-161149357 GTGTATCTACAGAACAAAATTGG - Intronic
1019990625 7:4688025-4688047 ATGTATTTAAAAAAGCAGCTGGG - Intronic
1021335567 7:19397847-19397869 ATGTATTTAGAAAAGAGGCTGGG - Intergenic
1021748964 7:23775793-23775815 AGGTATTCACATAAGAAGACAGG - Intronic
1021918876 7:25463866-25463888 ATGTATTTGCAGTAGACGTTTGG + Intergenic
1022227346 7:28376852-28376874 ATGTATTTACATAACTAGGTTGG + Intronic
1022979031 7:35585958-35585980 ATGTATTTGTTGGAGAAGATGGG - Intergenic
1023193524 7:37609553-37609575 ATGAATGTAAAGAAGAAGTTTGG + Intergenic
1024370957 7:48583193-48583215 ATGTCTTTACAGAAGATAAGGGG - Intronic
1026407460 7:70081753-70081775 ATGTATTTGCAGAAGTTTATAGG + Intronic
1027483730 7:78732530-78732552 ATGGATTGAAAGAAGAATATAGG + Intronic
1028212851 7:88096391-88096413 ATGCATATAGAAAAGAAGATTGG - Intronic
1030794887 7:113775798-113775820 ATGAATTTGCAGAAGCAGGTAGG - Intergenic
1032602328 7:133310993-133311015 ATGTTTTTGAAGTAGAAGATAGG + Intronic
1032625078 7:133583158-133583180 ATGTAAATAAAGAAGAAGAGAGG - Intronic
1032632790 7:133671823-133671845 ATGTAATTTCAGAAGACCATAGG + Intronic
1034362403 7:150512053-150512075 AAGTATTAACAGAAGAAAAAGGG + Intergenic
1034953724 7:155319233-155319255 TTGTATTTTTAGCAGAAGATGGG - Intergenic
1035322046 7:158037257-158037279 ATGTAAGTACAGAAGTGGATGGG + Intronic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038549997 8:28459211-28459233 AAGTATATACAAAAGAAAATTGG + Intronic
1039124714 8:34188382-34188404 ATATATTTAGAGAAGATGCTTGG + Intergenic
1039781122 8:40786807-40786829 CTGTGCTTACAGAAGAAAATTGG + Intronic
1040525549 8:48220815-48220837 ATGTCTTTAAAAAAGAACATTGG + Intergenic
1040761888 8:50856839-50856861 ATGTCTTCACAAAAGAAGATAGG + Intergenic
1041311395 8:56520635-56520657 ATGTATTTTACAAAGAAGATAGG - Intergenic
1042231828 8:66564454-66564476 TTGTTTTTAAAGAACAAGATGGG - Exonic
1042791603 8:72613796-72613818 CTGAATTTACAGCAGAAGAAAGG - Intronic
1042967961 8:74376232-74376254 ATTTATTTTTAAAAGAAGATGGG - Intronic
1045515743 8:102859661-102859683 TTGTATTTTTAGTAGAAGATGGG - Intronic
1048489770 8:134881807-134881829 ATCAATATACAGAAGAATATTGG - Intergenic
1048548609 8:135411602-135411624 ATGAATTTATAGAACAAGTTGGG + Intergenic
1048730526 8:137435265-137435287 ATGTATGTACATAAGAATTTAGG - Intergenic
1049371574 8:142270506-142270528 ATGTATTTATAACAGAAAATTGG + Intronic
1050468365 9:5957756-5957778 ATGTTTTTACTGAAGAATACAGG - Intronic
1051217142 9:14810307-14810329 ATATATTTACAGAAATAGCTGGG + Intronic
1051315490 9:15825691-15825713 ATTTTTTTAAAGAAGAAAATTGG + Intronic
1051523625 9:18018160-18018182 AGCTATTTACAGAATAAGTTTGG + Intergenic
1051973962 9:22926166-22926188 ATGGATTAAAAGAAGAACATGGG - Intergenic
1052080991 9:24204947-24204969 ATGTTTTCAAAGAAGAAGTTGGG + Intergenic
1052090839 9:24325209-24325231 ATGTATTTTAACAATAAGATGGG - Intergenic
1052521830 9:29557940-29557962 ATATATTTAAAGAACAAGGTAGG - Intergenic
1052926682 9:34022739-34022761 ATGTATTTATTTAAGGAGATAGG - Intronic
1053292534 9:36890796-36890818 AGGCACTTACAGAAGGAGATGGG + Intronic
1053326455 9:37156840-37156862 ATGTTTTAACATAAGAACATTGG - Intronic
1053613646 9:39741764-39741786 ATGTATTTGCAGAAAAAACTAGG - Intergenic
1053871687 9:42499720-42499742 ATGTATTTGCAGAAAAAACTAGG - Intergenic
1054239868 9:62600633-62600655 ATGTATTTGCAGAAAAAACTAGG + Intergenic
1054554001 9:66635160-66635182 ATGTATTTGCAGAAAAAACTAGG + Intergenic
1056094403 9:83237472-83237494 ATATATTTACACAAAAAAATGGG - Intergenic
1058632545 9:107003975-107003997 ATGTATTTACAGAATACACTGGG + Intronic
1059953030 9:119487570-119487592 ATTTTATTACAGAAGAAGAAAGG - Intergenic
1060685354 9:125606138-125606160 ATGTATTTCCTGAAGGAAATTGG - Intronic
1062552159 9:137093862-137093884 ATGGATTTACAGATGAATTTAGG - Intronic
1186234679 X:7494814-7494836 ATTTATTAACAGAAAAATATGGG - Intergenic
1186361457 X:8846299-8846321 ATGTATCTACAGAAAAAAAGGGG - Intergenic
1186683395 X:11899281-11899303 TTGTTATTACAGAAGAAAATGGG + Intergenic
1186792613 X:13013612-13013634 AAATATTTAGAGAAAAAGATGGG + Intergenic
1186973653 X:14876036-14876058 AAATATATACATAAGAAGATTGG + Intronic
1187202907 X:17153327-17153349 ATGTATTTAATGAAAATGATGGG + Intergenic
1187600792 X:20827519-20827541 ATTTATTTACAGAATAACGTAGG - Intergenic
1188362798 X:29277033-29277055 ATGTATTAACTAAAGAACATAGG + Intronic
1188667900 X:32847044-32847066 CTATATATACACAAGAAGATTGG - Intronic
1189490159 X:41465100-41465122 AGGAATTTACAGGAAAAGATAGG - Intronic
1190019168 X:46856787-46856809 CTGTACTTTCAGAATAAGATAGG - Intronic
1190526878 X:51337074-51337096 AGTTATTTACAGAAGAAACTAGG - Exonic
1190969776 X:55337252-55337274 ATGTATCCACAGAAGTAGTTTGG - Intergenic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192463723 X:71340244-71340266 ATATAGTTTCAAAAGAAGATAGG - Intergenic
1193392284 X:80942880-80942902 ATGTATTTATTGAAGAAACTAGG + Intergenic
1193678390 X:84484890-84484912 TTGTATTTAGAAAAGAAGAAAGG - Intronic
1193929823 X:87539920-87539942 GTGTATTTACAAACCAAGATGGG + Intronic
1194625163 X:96218698-96218720 AGGTATTTAAATAGGAAGATAGG + Intergenic
1194700153 X:97104268-97104290 ATATAGATACAGAATAAGATGGG - Intronic
1194847418 X:98827498-98827520 ATGTATGTACAGTAGCAGTTGGG + Intergenic
1195699612 X:107693580-107693602 GTGTATTTAGAAAAGAAGAAAGG - Intergenic
1195804466 X:108748014-108748036 ATGTGTGTACACAAAAAGATGGG - Intergenic
1195909812 X:109877640-109877662 ATGTATGTATACAAGAAGCTAGG + Intergenic
1196666386 X:118321583-118321605 ATTTGTTTAAAAAAGAAGATGGG + Intergenic
1197500985 X:127242451-127242473 ATGCATTTACAGAACCAGCTAGG + Intergenic
1198330270 X:135616483-135616505 ATGTCTATAAAGAAGATGATGGG + Intergenic
1198336657 X:135672516-135672538 ATGTCTATAAAGAAGATGATGGG - Intergenic
1202015231 Y:20399076-20399098 ATGTATTAAAATAAGAAAATGGG + Intergenic