ID: 976987543

View in Genome Browser
Species Human (GRCh38)
Location 4:91320839-91320861
Sequence GAACCTATTATCTTTCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976987543_976987546 22 Left 976987543 4:91320839-91320861 CCCTCTTGAAAGATAATAGGTTC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 976987546 4:91320884-91320906 AATTTTCCATTTTTAGTAATAGG 0: 1
1: 0
2: 3
3: 82
4: 968
976987543_976987545 -3 Left 976987543 4:91320839-91320861 CCCTCTTGAAAGATAATAGGTTC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 976987545 4:91320859-91320881 TTCAGTCTATACTATAATCAAGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976987543 Original CRISPR GAACCTATTATCTTTCAAGA GGG (reversed) Intronic
902688389 1:18094049-18094071 AACCCTATTATCTTGCAAAACGG - Intergenic
902877829 1:19351582-19351604 GGAACTATTATCTTTCAAAATGG + Intronic
905104248 1:35554036-35554058 TTACCTATTATCTTTGAGGAAGG - Intronic
906572877 1:46859671-46859693 AAACCCATTACCTTTCCAGATGG - Intergenic
908957656 1:69653426-69653448 TCACCTCTTATCTGTCAAGATGG + Intronic
910792600 1:91066641-91066663 AAACCTATTTTTTTTCAAGATGG - Intergenic
912214796 1:107596751-107596773 GCACTTATTTTCTTTCAAAATGG + Intronic
913479923 1:119278189-119278211 GAATCTATTCTTTTTCAAAATGG + Intergenic
918031651 1:180819263-180819285 GAACTTATTTACTTTCAAAATGG - Intronic
918298092 1:183176733-183176755 CAGCCTATTATCTTTTAAAAGGG - Intergenic
919527518 1:198672372-198672394 GAATTTATTATCTTACAAAACGG - Intronic
924702177 1:246465158-246465180 GATGCTACTATCCTTCAAGATGG + Intronic
1063072124 10:2677332-2677354 TAATTTATTATCTTTCAAGTAGG - Intergenic
1064289729 10:14022772-14022794 GACCCCATTCTCTTTCAAGGTGG + Intronic
1064710985 10:18124400-18124422 GAAACTATTTCCTTTGAAGAAGG + Intergenic
1068168495 10:53361878-53361900 GAATCTATTATCTTTGTATATGG - Intergenic
1068873001 10:61965287-61965309 TTTCCTATTATCTTTAAAGAGGG - Intronic
1070917938 10:80166901-80166923 GATCCTACTTTCCTTCAAGACGG - Exonic
1071699065 10:87909604-87909626 CAACTTCTTATATTTCAAGATGG + Intronic
1073155004 10:101339422-101339444 GAATCTTTTTTTTTTCAAGACGG + Intergenic
1073663301 10:105501886-105501908 GAACACATGCTCTTTCAAGAAGG - Intergenic
1073855797 10:107671857-107671879 GAATCTTTTGACTTTCAAGAAGG + Intergenic
1079712673 11:23706894-23706916 GAATTTCTTATTTTTCAAGATGG + Intergenic
1080699629 11:34633569-34633591 GGACCTATTTTATTTCAAGTTGG + Intronic
1081041115 11:38214730-38214752 AAACTTATTATCTTTGGAGAGGG - Intergenic
1081089005 11:38838691-38838713 CAACCTAATATCCTTGAAGAAGG - Intergenic
1086454927 11:86951869-86951891 GAACCTGTTCTCATCCAAGAAGG - Exonic
1090131414 11:124146164-124146186 GAACCTATTCCCTTTCTTGAGGG + Exonic
1091955450 12:4637994-4638016 CAACCTCTTATTTTTCAAGGTGG - Intronic
1092278996 12:7085692-7085714 GAACCTAGTAGGTTTGAAGAAGG - Intronic
1093494847 12:19744532-19744554 GAACTCTTTATCTTTCAAAACGG - Intergenic
1093757141 12:22865480-22865502 GTACCTTTTATCTTACAAAAAGG + Intergenic
1094292122 12:28863121-28863143 GAACCTATTATATTTGAAGGGGG + Intergenic
1097684446 12:62678341-62678363 GAAATTATTATTTTTCAGGAGGG + Intronic
1098386863 12:69928938-69928960 GAATCTCTTATTTTGCAAGATGG - Intronic
1100371316 12:93971473-93971495 GAACCTATTATAGTTACAGAAGG + Intergenic
1101110886 12:101484608-101484630 GAACCTATTCTGGTTCAAGGAGG + Intronic
1101602611 12:106223773-106223795 GAGCCTATTTTCTTTCTTGATGG - Intergenic
1103890920 12:124238548-124238570 GAACCAAGCATCTTTGAAGATGG - Intronic
1106852935 13:33814789-33814811 TAACATATTACCTTTTAAGAAGG + Intergenic
1109162437 13:58992230-58992252 AAAGCTGTTATCTTTCAAGTAGG - Intergenic
1109230013 13:59745024-59745046 GAACCTTTTTTGTTCCAAGAAGG + Intronic
1109808840 13:67481240-67481262 GAACCTCTTTTCTTTCATAAAGG + Intergenic
1110460207 13:75736936-75736958 GAATCTATTATTTTTCACAATGG - Intronic
1110859765 13:80335121-80335143 AAACCTAGTATTTGTCAAGATGG + Intergenic
1112238843 13:97661093-97661115 GAAAGCATTTTCTTTCAAGACGG - Intergenic
1112923425 13:104643607-104643629 ATAACTATGATCTTTCAAGATGG + Intergenic
1113195874 13:107804710-107804732 CCACATATTATCTTTCAAAATGG - Intronic
1114354505 14:21892430-21892452 GCACCTAATATCATTGAAGATGG + Intergenic
1114797558 14:25733820-25733842 GCACATTTTTTCTTTCAAGAAGG - Intergenic
1124529983 15:30497640-30497662 GAATCTATTATCTATCTACAGGG + Intergenic
1124768676 15:32510048-32510070 GAATCTATTATCTATCTACAGGG - Intergenic
1125790642 15:42363098-42363120 GAGCCTGTTTTCTTTTAAGAGGG - Intronic
1125841854 15:42809478-42809500 GAAACTATTAGCACTCAAGATGG + Intronic
1126111284 15:45176269-45176291 GAACCAATTAGCTTTAGAGAAGG - Intronic
1126812796 15:52425082-52425104 GAAATTTTTTTCTTTCAAGATGG - Intronic
1128219088 15:65955042-65955064 GAACCTATTAACTTCTAAGATGG - Intronic
1129491785 15:75934053-75934075 GAACCTTTGATTTTTCAAGTGGG + Exonic
1129773285 15:78216546-78216568 GGACCTATAATCTTTCAGAAAGG + Intronic
1131679722 15:94708864-94708886 GAGCATCTTATCTTTCATGAGGG - Intergenic
1131810173 15:96165087-96165109 GAAATTATTGTCTTACAAGAGGG - Intergenic
1137741244 16:50777430-50777452 TAACCTATTATTTTAAAAGAAGG - Intronic
1144224609 17:13132765-13132787 GCACCTTTTGTCTTTAAAGAGGG - Intergenic
1146981489 17:37166030-37166052 GATGCTATAATCGTTCAAGATGG - Intronic
1149545626 17:57501467-57501489 GGCCCTGTTAGCTTTCAAGAAGG + Intronic
1150532751 17:66002128-66002150 GAACCTATCATTATTTAAGAAGG - Intronic
1151461652 17:74257822-74257844 AAACTTATTATCATTCAAGTTGG + Intronic
1158684500 18:59600837-59600859 GAACCAATCTTCCTTCAAGAAGG + Intronic
1161833055 19:6623849-6623871 GAACCTATTTTCTTTTATAATGG - Intergenic
925518435 2:4711099-4711121 GAAGCTATTATGTATCAGGAGGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926074952 2:9935100-9935122 GAACCTATGATCTTTAAAGGTGG - Intergenic
930901449 2:56511738-56511760 GAGCCTATTAGTTTTCTAGAGGG + Intergenic
931088429 2:58860440-58860462 GTATCTTTTATCTTTCAAGTGGG + Intergenic
932027255 2:68147904-68147926 GAAGATATTATCTTTCCAGATGG + Intronic
932982575 2:76687449-76687471 GAACCAAATAACTTTCATGAGGG - Intergenic
939215271 2:139228865-139228887 TAACATATTATGTTTGAAGAAGG + Intergenic
939870377 2:147520047-147520069 GAAACTATTATCTTACCAAATGG + Intergenic
940260292 2:151772172-151772194 CAACCTCTTTTCTTTCCAGAGGG + Intergenic
941545253 2:166842134-166842156 TAGCCTAATATTTTTCAAGAGGG + Intergenic
943084145 2:183292229-183292251 GCACCTCTTATCAATCAAGAAGG - Intergenic
1168751219 20:282942-282964 TAACCTTTTATCTTGCAAAATGG - Intronic
1170094095 20:12626255-12626277 AAATCTTTAATCTTTCAAGAAGG + Intergenic
1173008347 20:39158045-39158067 AATCCTATTATTTTACAAGAGGG + Intergenic
1176268794 20:64224538-64224560 GAAGCTATTAACTTCCAGGAAGG - Intronic
1177314167 21:19435167-19435189 GAACCTAATATATTTCCTGAAGG + Intergenic
1185076923 22:48688248-48688270 GAATGTATTAATTTTCAAGATGG - Intronic
1185146806 22:49141593-49141615 GAACCTATTTCCATGCAAGATGG - Intergenic
949678393 3:6484586-6484608 ACACCTATTATCTTTTAAGAAGG - Intergenic
950782683 3:15405675-15405697 GAACCAAGTCTTTTTCAAGAAGG - Intronic
952593924 3:34990914-34990936 GAATCTATTTTTTTTAAAGATGG + Intergenic
959432975 3:106277878-106277900 GAAACTATTATCACTCAAGGAGG + Intergenic
960651897 3:119960220-119960242 AAACTTTTTTTCTTTCAAGAAGG - Intronic
961199129 3:125029886-125029908 GAAGTTATTATTTTTTAAGATGG - Intronic
963463909 3:145653425-145653447 TAACCTATTATCTATAAATAAGG - Intergenic
964005191 3:151818456-151818478 GAACCTATTCTGGTTCAGGAGGG - Intronic
964041568 3:152268143-152268165 TAACATATTATTTTTAAAGAGGG + Exonic
964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG + Intronic
965875255 3:173309855-173309877 GAACATATTAACTTTTGAGATGG + Intergenic
966736367 3:183190143-183190165 GAAAATATTATCTATCAGGAAGG - Intronic
967066168 3:185918172-185918194 AATCCTATTATTTTTTAAGAAGG - Intronic
967148095 3:186623166-186623188 GAACCTAGAATGTGTCAAGAAGG - Intergenic
967910049 3:194535173-194535195 GAACTTATAATCTTACAAAAGGG + Intergenic
971329237 4:25668827-25668849 GAAACTCTTTTCTTTCAAAAAGG + Intronic
971559583 4:28059893-28059915 CAACCTATTACCTTTGAAGAAGG - Intergenic
972244415 4:37229635-37229657 AAATATATTTTCTTTCAAGAAGG - Intergenic
974002150 4:56522414-56522436 GAACCTATTTTTTTTTGAGACGG - Intronic
974623628 4:64394029-64394051 GAACATATTTTGTTTGAAGAAGG - Intronic
975499034 4:75064680-75064702 GCACCCATTCTCCTTCAAGAAGG - Intergenic
975752342 4:77536943-77536965 GAGCATATTATCTTTGAAGTAGG + Intronic
976861127 4:89667923-89667945 TAACTTATTATCTTTCAAGAAGG - Intergenic
976987543 4:91320839-91320861 GAACCTATTATCTTTCAAGAGGG - Intronic
977814961 4:101404274-101404296 TAACTTGTTAGCTTTCAAGAAGG + Intergenic
979823666 4:125205881-125205903 GAACCTTTTTTTTTTCGAGATGG + Intergenic
980955051 4:139419457-139419479 TAACCTATTAGCTTGCAAGAAGG - Intronic
982892512 4:160873422-160873444 GAGCCTAATATCTTCCAAGTAGG + Intergenic
983512796 4:168626984-168627006 GAACATTTTATCTTTCAAAATGG - Intronic
986472793 5:8092699-8092721 GAACATATGAATTTTCAAGATGG - Intergenic
987764875 5:22213023-22213045 GTACCTAATATCTTACACGAAGG - Intronic
991071537 5:62487997-62488019 AAACTTATTATCTTCCAAGGGGG + Intronic
991770531 5:70036803-70036825 GAATATATTATCTTTAGAGATGG + Intronic
991849826 5:70912221-70912243 GAATATATTATCTTTAGAGATGG + Intronic
991899612 5:71446169-71446191 GTACCTAATATCTTACACGAAGG - Intergenic
992772615 5:80062458-80062480 GAAATTATTAGCTTTGAAGAAGG + Intronic
993359376 5:86955060-86955082 GAAAATATTATCCTGCAAGATGG - Intergenic
993640523 5:90399165-90399187 AAACCAATTATACTTCAAGAAGG - Intronic
994083959 5:95738507-95738529 GATGCTATTATCTTTAAAGTGGG + Intronic
995600184 5:113787805-113787827 GAATCTATTATCCTTTAAGAAGG + Intergenic
997199933 5:132003752-132003774 GAACCCATCATCTTTGGAGACGG + Intronic
997725765 5:136118727-136118749 GAACCTCTTATCTTTATAAAGGG - Intergenic
997957381 5:138289823-138289845 AAACCAAATATCTTACAAGAAGG + Intronic
998705644 5:144756646-144756668 GATATTATTTTCTTTCAAGAAGG - Intergenic
1003384789 6:5657261-5657283 GATCCTTGTATCTTTCAAGCTGG + Intronic
1003485646 6:6575698-6575720 GTACCTATTAGCTTGCAAGTGGG + Intergenic
1004800492 6:19141547-19141569 GAACCTATTATTTTGCCAGCAGG + Intergenic
1004955666 6:20725159-20725181 GAAGTTAGTATCTTTCAACAAGG - Intronic
1006951688 6:37827399-37827421 CAACCTATCAACTTTCAAAAAGG - Intronic
1013849049 6:114491792-114491814 AAACCTATTATCTATCCAGTTGG - Intergenic
1015935353 6:138402878-138402900 TAAATAATTATCTTTCAAGAAGG - Intergenic
1016633095 6:146255077-146255099 AAAACTATGATATTTCAAGAAGG - Intronic
1018350485 6:162953921-162953943 AAATCTATTAACTATCAAGATGG + Intronic
1023578069 7:41651097-41651119 GACCCTATTGTCTTACAAGTTGG + Intergenic
1027051200 7:75022179-75022201 CAACATATTAAATTTCAAGAGGG - Intronic
1028956939 7:96704034-96704056 AACCCTAATATCTATCAAGAAGG + Intronic
1029820777 7:103144594-103144616 TAACATGTTATCTTTCAAGCTGG + Intronic
1030542875 7:110854748-110854770 CAAACTATTTTATTTCAAGATGG - Intronic
1031334839 7:120515538-120515560 GAACCTACAATCTCTGAAGAAGG + Intronic
1031349432 7:120711488-120711510 GAATATATTATCTTTCAACGTGG - Intronic
1034392294 7:150796132-150796154 AAACCTATGATCTTTCATGAAGG + Intronic
1038972466 8:32651538-32651560 GAAAACATTTTCTTTCAAGATGG - Intronic
1040037573 8:42885605-42885627 AAACCTTTTATCTTTTAGGATGG - Intronic
1040535606 8:48306745-48306767 TAACCTATTAGCTTACAAGGAGG + Intergenic
1042263092 8:66880096-66880118 GAACCTAGTATAATGCAAGAGGG + Intronic
1042691147 8:71500219-71500241 GATCTTTTTTTCTTTCAAGATGG - Intronic
1043204718 8:77423017-77423039 AATACTATTATCTTTCAAGTAGG - Intergenic
1044197965 8:89401471-89401493 CAACCTGTTATCTTCCAAGAAGG + Intergenic
1044608957 8:94073212-94073234 AAACAAATTATCTTTCAAGAGGG - Intergenic
1046226511 8:111287013-111287035 GCACCTAATATCATTCATGAGGG - Intergenic
1052742957 9:32411537-32411559 GGACCTATTATTTTTCTAAATGG - Intronic
1054781825 9:69173247-69173269 AAAACTATTCTCTTACAAGATGG + Intronic
1055307772 9:74948517-74948539 AAATTTTTTATCTTTCAAGAAGG + Intronic
1055559364 9:77507359-77507381 GAACCAAGTATCTTTCAAGTTGG - Intronic
1055982613 9:82019510-82019532 ATAGCTATTATCTTTCAAGAAGG - Intergenic
1185748649 X:2592685-2592707 GAACATGTTCTCTTTCCAGAAGG + Intergenic
1187207166 X:17193780-17193802 GAAACAATTATTTATCAAGATGG + Intergenic
1190336164 X:49263546-49263568 GAACACATGATCTTTCATGATGG - Intronic
1190886222 X:54532539-54532561 GAACCTATCTGCTTTCAAGCTGG + Exonic
1191085088 X:56558000-56558022 GAAATTTTTATCTTTGAAGAAGG - Intergenic
1194057857 X:89160080-89160102 GATCATATTATCTGTAAAGAGGG + Intergenic
1197461288 X:126744740-126744762 GAAAATAGTATCTTTCAAAATGG + Intergenic
1199229651 X:145422696-145422718 GAACCCTTTTTCTCTCAAGATGG + Intergenic
1200801655 Y:7392720-7392742 GATCCCATTCTCTTTCAGGAAGG + Intergenic