ID: 976989959

View in Genome Browser
Species Human (GRCh38)
Location 4:91353856-91353878
Sequence CTGTAGCCATGTTTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 0, 2: 15, 3: 106, 4: 797}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976989959_976989962 4 Left 976989959 4:91353856-91353878 CCAATTTCCAAACATGGCTACAG 0: 1
1: 0
2: 15
3: 106
4: 797
Right 976989962 4:91353883-91353905 GCATCTGTGCCACACTTGCATGG 0: 1
1: 0
2: 7
3: 40
4: 164
976989959_976989963 5 Left 976989959 4:91353856-91353878 CCAATTTCCAAACATGGCTACAG 0: 1
1: 0
2: 15
3: 106
4: 797
Right 976989963 4:91353884-91353906 CATCTGTGCCACACTTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976989959 Original CRISPR CTGTAGCCATGTTTGGAAAT TGG (reversed) Intronic
900425260 1:2575444-2575466 GTGTGACTATGTTTGGAAATGGG - Intergenic
900491325 1:2950543-2950565 GTGTAACCTTATTTGGAAATTGG + Intergenic
900902321 1:5525590-5525612 CTGCAGCCATCTTTTGAGATAGG + Intergenic
902416251 1:16241490-16241512 ATGTGACCATATTTGGAAATAGG - Intergenic
902705378 1:18200671-18200693 CTGTGGCCTCATTTGGAAATAGG - Intronic
902726755 1:18341355-18341377 ATGTAACCTTATTTGGAAATAGG - Intronic
903000819 1:20264373-20264395 ATGTGACCTTGTTTGGAAATAGG - Intergenic
904170339 1:28587646-28587668 CTGAAGCCATGTTTAGAAGGTGG - Intergenic
904489358 1:30848772-30848794 ATGTGGCCTTATTTGGAAATAGG - Intergenic
907545629 1:55257542-55257564 CTGTGGCCTTGTTTGTAAAATGG + Intergenic
908259675 1:62329996-62330018 CTCTAACCATTTTTGTAAATAGG + Intergenic
908498412 1:64718535-64718557 TTGTGACCTTGTTTGGAAATAGG - Intergenic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
910286584 1:85562476-85562498 ATGTGGCCTTGTTTGGAAATAGG + Intronic
910436077 1:87207517-87207539 ATGTGACCATATTTGGAAATAGG + Intergenic
910852561 1:91663165-91663187 CTGGGGCCATGTTTAGAAAATGG - Intergenic
911117335 1:94259438-94259460 ATGTAAGCTTGTTTGGAAATAGG + Intronic
911517453 1:98884700-98884722 ATGTAACTTTGTTTGGAAATTGG + Intergenic
911827069 1:102499964-102499986 ATTTAACCATATTTGGAAATAGG - Intergenic
912060618 1:105663981-105664003 ATGTAGCCATGTTGGCAGATAGG + Intergenic
912138872 1:106696814-106696836 ATTTGGCCATATTTGGAAATAGG + Intergenic
912321838 1:108720847-108720869 ATGTAGCCTTATTTGGAAATAGG - Intronic
912526681 1:110288621-110288643 CTATGGCCTTGTTTGGAAATGGG - Intergenic
912582253 1:110731043-110731065 ATGTAACCTTGTTTGGAAATAGG + Intergenic
912749204 1:112271661-112271683 CTGTGACCTTATTTGGAAATAGG - Intergenic
912980104 1:114363684-114363706 TTGGGGCCATGTTTGGAAAATGG - Intergenic
913485378 1:119328488-119328510 CTGTCATCATCTTTGGAAATGGG + Intergenic
913796404 1:122623062-122623084 TTGTGGCCTTGGTTGGAAATGGG + Intergenic
913805854 1:122793727-122793749 TTGTAGCCTTCTTTGGAAACGGG + Intergenic
913829276 1:123213042-123213064 TTGTGGCCATCTTTGGAAACGGG + Intergenic
913834997 1:123315649-123315671 TTGTGGCCTTGTTTGGAAACCGG + Intergenic
913858952 1:123746267-123746289 TTGTGGCCTTGTTTGGAAACCGG + Intergenic
913888069 1:124267192-124267214 TTGTGGCCTTGGTTGGAAATGGG + Intergenic
913893248 1:124359679-124359701 TTGTGGCCTTGGTTGGAAATGGG + Intergenic
916066243 1:161138079-161138101 CTGTCCCAATGTTTGGAATTTGG - Intergenic
916766838 1:167869148-167869170 CTGAAGCCATGTTTAGAAGGTGG + Intronic
916886051 1:169069444-169069466 TTTTAGCCATATTTGGAAGTGGG - Intergenic
916953822 1:169810637-169810659 ATGTGGCCTTATTTGGAAATAGG - Intronic
917480957 1:175411773-175411795 ATGTAACCTTATTTGGAAATAGG - Intronic
917505434 1:175623014-175623036 ATGTAACCTTATTTGGAAATAGG - Intronic
917962615 1:180156383-180156405 CTGTGGGCATCTTTGGAAATAGG + Intronic
918060874 1:181060317-181060339 ATGTGGCCTTCTTTGGAAATAGG - Exonic
918173964 1:182026921-182026943 ATGTGGCCTTATTTGGAAATAGG + Intergenic
918646763 1:186915091-186915113 CTGGGGCCATGTTTGGAAAATGG - Intronic
918948728 1:191106751-191106773 CTGTAGCTTTGTTTGAAATTGGG + Intergenic
919412684 1:197265867-197265889 ATGTAGCAATGTTTGGAAAAGGG - Intergenic
920450563 1:206058148-206058170 TGGGAGCCATGTTTGGAAATTGG + Intronic
920671631 1:208008032-208008054 GTCTAGCCTTGGTTGGAAATTGG + Intergenic
920991120 1:210941018-210941040 CTATAGGCATGTTTGGCACTGGG + Intronic
921075034 1:211693844-211693866 CTGGGGCCATGTTTGGAAAATGG + Intergenic
921152111 1:212411079-212411101 TTGTGACCTTGTTTGGAAATGGG - Intronic
921456064 1:215373786-215373808 ATGTAACCTTATTTGGAAATAGG - Intergenic
922112643 1:222576820-222576842 CTGTAGCCTTTCTTAGAAATTGG + Intronic
922332133 1:224586675-224586697 ATGTAACCTTATTTGGAAATAGG + Intronic
923360249 1:233204075-233204097 ATGTGACCTTGTTTGGAAATAGG + Intronic
924143389 1:241049116-241049138 GTGTGGCCTTGCTTGGAAATAGG - Intronic
924665470 1:246067242-246067264 ATGTAGACAAATTTGGAAATAGG - Intronic
924858657 1:247899036-247899058 CTGGGGCCATGTTTAGAAAATGG - Intergenic
924910996 1:248513143-248513165 ATGTACCCTTATTTGGAAATAGG - Intergenic
924913105 1:248534897-248534919 ATGTACCCTTATTTGGAAATAGG + Intergenic
1063082553 10:2782363-2782385 CTTTAGCCATGTCTGGCAACAGG - Intergenic
1063243173 10:4192262-4192284 CTGTAGCCATCTTTATAGATGGG - Intergenic
1063754473 10:8991602-8991624 CTGTGGTCATATTTGGAAATAGG + Intergenic
1064224578 10:13471626-13471648 CTGTAGCCATGTCTGAAACCAGG + Intronic
1064969009 10:21044534-21044556 CTGTAGCCAAGTATTTAAATAGG + Intronic
1065519193 10:26554960-26554982 ATGTAACCTTATTTGGAAATAGG - Intronic
1065802041 10:29361158-29361180 CTGAAGCCATGTTTAGAAGGTGG - Intergenic
1066823537 10:39529692-39529714 TTGAAGCCATTGTTGGAAATGGG + Intergenic
1067072813 10:43148298-43148320 CTGTAGTAATTTTTGGAATTGGG + Intronic
1068939432 10:62666360-62666382 ATGTGGCCATCTTTGGAAATAGG + Intronic
1069886130 10:71624907-71624929 AGGAAGCCATGTTTGCAAATGGG - Intronic
1070085943 10:73237151-73237173 ATGTGACCAAGTTTGGAAATAGG - Intronic
1070410576 10:76135856-76135878 GTGTAACCTTATTTGGAAATAGG - Intronic
1070704723 10:78629330-78629352 GTGTAGCCACGTTTCGAACTTGG - Intergenic
1071150947 10:82633739-82633761 CTGTAGCCAAGTTTGGGAGATGG + Intronic
1071282636 10:84116452-84116474 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1071288163 10:84167927-84167949 CGGGAGCCATGTTTGCAAATTGG - Intergenic
1072335223 10:94391869-94391891 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1072554746 10:96506324-96506346 CTGTACCCATGCTTTGGAATTGG - Intronic
1072688806 10:97556200-97556222 TGGGAGCCATGTTTGGAAATTGG - Intronic
1072689225 10:97560538-97560560 CTGTAACTATGTATGGAAACTGG + Intronic
1073673076 10:105614177-105614199 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1073712487 10:106060183-106060205 CTGTATCCATGTTTAGAATTGGG - Intergenic
1074352508 10:112751624-112751646 TTGTAGCCACTTTTGTAAATAGG + Intronic
1074426155 10:113353315-113353337 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1075158815 10:120004752-120004774 ATGTAACCTTGTTTGGAAATAGG - Intergenic
1075526520 10:123191523-123191545 ATGTAACCTTATTTGGAAATAGG + Intergenic
1075637182 10:124037199-124037221 CTGTGACCTTATTTGGAAATAGG - Intronic
1076046562 10:127299025-127299047 TTGTAACCTTATTTGGAAATAGG + Intronic
1076782740 10:132733231-132733253 TTGGGGCCTTGTTTGGAAATGGG - Intronic
1077438479 11:2556278-2556300 GTGTGACCTTGTTTGGAAATAGG - Intronic
1078522715 11:12076193-12076215 ATGTAACCTTATTTGGAAATAGG - Intergenic
1078784933 11:14480773-14480795 TTGCAGCCATATCTGGAAATCGG + Exonic
1078876924 11:15408526-15408548 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1081678861 11:44987864-44987886 CTGAACCCATTTTTGGAGATTGG - Intergenic
1082163539 11:48912613-48912635 CTGGTGCCTTCTTTGGAAATCGG - Intergenic
1083090301 11:60192460-60192482 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1083197591 11:61098116-61098138 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1083493834 11:63033330-63033352 ATGTGACCATGTTTGGAAATAGG - Intergenic
1084510059 11:69597719-69597741 ATGTGACCTTGTTTGGAAATAGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087420075 11:97911600-97911622 ATGTGGCCATATTTGGAAATAGG - Intergenic
1088053145 11:105543028-105543050 CTCTGGCCATGTTTAGAAAATGG + Intergenic
1088392853 11:109334600-109334622 GTGTAGCCTTATGTGGAAATAGG + Intergenic
1089134329 11:116237301-116237323 CTGTAGCCATGGTCTGAGATTGG - Intergenic
1089799383 11:121012760-121012782 CTGTGGCTATATTTGGACATGGG - Intergenic
1089857284 11:121557237-121557259 GAGTAGCCATCTTTGGCAATGGG + Intronic
1090882931 11:130850077-130850099 ATGTGGCTATGTTTGGAGATAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091511897 12:1135524-1135546 ATGTGACCATATTTGGAAATAGG + Intronic
1091814091 12:3423094-3423116 CTGGGGCCATGTTTGAAAAATGG - Intronic
1092019341 12:5187801-5187823 GTGTAGCTATACTTGGAAATGGG - Intergenic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1092536788 12:9396210-9396232 ATGTGACCTTGTTTGGAAATAGG - Intergenic
1092557888 12:9577097-9577119 ATGTGACCTTGTTTGGAAATAGG + Intergenic
1092570265 12:9713856-9713878 CAAGAGCCATGTTTGGAAATTGG - Intergenic
1092896660 12:13018316-13018338 ATGTAGCCTTATTTAGAAATAGG - Intergenic
1092941079 12:13407781-13407803 CAGTGACCATATTTGGAAATAGG - Intergenic
1093593690 12:20937753-20937775 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1094452273 12:30594976-30594998 ATGTGACCTTGTTTGGAAATAGG - Intergenic
1094513407 12:31110828-31110850 ATGTGACCTTGTTTGGAAATTGG - Intergenic
1094634323 12:32209950-32209972 CAGTAGCCATGTGTGGCAACTGG + Intronic
1094971202 12:36252721-36252743 CTGAGGCCATCGTTGGAAATGGG + Intergenic
1095000972 12:36733935-36733957 CTGAGGCCATCGTTGGAAATGGG + Intergenic
1095676265 12:44922422-44922444 ATGTAACCTTATTTGGAAATAGG + Intergenic
1096244160 12:49975077-49975099 CTTTATCCAAGTTTGAAAATTGG - Intronic
1098248800 12:68547236-68547258 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1098818453 12:75199198-75199220 CTGTAGACATCTTTAAAAATTGG - Intronic
1098880057 12:75907919-75907941 CTGTGGCTTTATTTGGAAATAGG - Intergenic
1099669021 12:85667256-85667278 ATGTAACCTTATTTGGAAATGGG + Intergenic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100609031 12:96175731-96175753 CTGTGGCCAGCCTTGGAAATAGG + Intergenic
1101028110 12:100633758-100633780 CTGAGGCCATGTTTGGAAAATGG - Intergenic
1101712863 12:107284698-107284720 CTGTGGCTATATTTGGACATTGG + Intergenic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1101823374 12:108201444-108201466 ATGTGGCCTTATTTGGAAATAGG - Intronic
1101998584 12:109542530-109542552 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG + Intronic
1104004565 12:124882942-124882964 TTGCAGCCTTATTTGGAAATAGG + Intergenic
1104004758 12:124884213-124884235 TTGCAGCCCTATTTGGAAATAGG + Intergenic
1104217079 12:126744364-126744386 CTGTAGCCATGTTCCTGAATTGG - Intergenic
1106454892 13:29918574-29918596 CTGAAGTCAGGTTTGGAGATGGG - Intergenic
1109803404 13:67405175-67405197 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1110255912 13:73433897-73433919 CTGTACCCAGATTTGAAAATGGG + Intergenic
1110785690 13:79523028-79523050 CTGAAGCCATTTATTGAAATAGG - Intronic
1111906162 13:94258656-94258678 CCTTTGCCATGTTTGGAAAAAGG - Intronic
1111924368 13:94446950-94446972 ATGTCACCTTGTTTGGAAATAGG - Intronic
1112251565 13:97785270-97785292 ATGTAGCCTTATTAGGAAATAGG + Intergenic
1112378042 13:98862287-98862309 ATGTACCCTTATTTGGAAATAGG + Intronic
1112664509 13:101554168-101554190 ATGTAACCTTATTTGGAAATAGG - Intronic
1112817552 13:103290903-103290925 GTGTGGCCTTATTTGGAAATAGG - Intergenic
1113148826 13:107239513-107239535 ATGTGACCGTGTTTGGAAATAGG - Intronic
1113476176 13:110582847-110582869 ATGTGGCCTTGTTTGGAGATTGG - Intergenic
1113518215 13:110919337-110919359 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1114848376 14:26351691-26351713 CTGTAGCAATGTTTGTAATAGGG + Intergenic
1115515030 14:34176464-34176486 CTGTAGCCATGTTTGGGTTTTGG - Intronic
1115584352 14:34795346-34795368 CTTTGGCCATTTCTGGAAATAGG + Intronic
1116240646 14:42338464-42338486 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1116599225 14:46897867-46897889 CTTTATCTATTTTTGGAAATCGG + Intronic
1116674381 14:47886962-47886984 CTGTGGCTATATTTGGACATGGG - Intergenic
1116853535 14:49931713-49931735 ATGTGACCATATTTGGAAATAGG - Intergenic
1117212010 14:53510271-53510293 CTGTAGCCATGTGTTGACTTTGG - Intergenic
1117447660 14:55820267-55820289 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1117480135 14:56134870-56134892 CTGAAGTCAGGTTGGGAAATTGG - Intronic
1117846023 14:59912761-59912783 ATGTTACCATATTTGGAAATAGG - Intergenic
1117954885 14:61115095-61115117 CTGAGTCCATGTTTGGAAAATGG - Intergenic
1119945915 14:78694009-78694031 CATTAGCCAGGTTTTGAAATAGG - Intronic
1120318956 14:82934436-82934458 TTGTAACCATATTTGGAAAGAGG - Intergenic
1120458411 14:84761531-84761553 CTTCATCCATATTTGGAAATGGG - Intergenic
1120487954 14:85138411-85138433 ATGTAACTATATTTGGAAATAGG - Intergenic
1121316560 14:92964440-92964462 CTGGGGCCTTGTTTGGAAAATGG - Intronic
1121585659 14:95061378-95061400 ATGTGGCCACATTTGGAAATAGG - Intergenic
1121754845 14:96393721-96393743 ATGTGGCCTTATTTGGAAATAGG - Intronic
1121798300 14:96753737-96753759 CTGTGACCAAATTTGGAAATAGG - Intergenic
1121879474 14:97487183-97487205 GTGTGACCATATTTGGAAATAGG - Intergenic
1121932016 14:97980711-97980733 GTATGGCCATATTTGGAAATGGG - Intergenic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1122909800 14:104821934-104821956 ATGTGACCTTGTTTGGAAATAGG - Intergenic
1125226043 15:37397308-37397330 TTATAGCAATGTTTTGAAATAGG + Intergenic
1126160186 15:45604740-45604762 CTGTAACCTTGTCTGAAAATAGG + Intronic
1126166716 15:45659780-45659802 ATGTAACCTTATTTGGAAATAGG - Intronic
1126973030 15:54139354-54139376 ATGTGGCCTTGTTTAGAAATAGG - Intronic
1127095809 15:55511414-55511436 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1127803115 15:62494445-62494467 GTGTAGCCATTTTTCTAAATAGG - Intronic
1128832461 15:70781930-70781952 ATGTGACCTTGTTTGGAAATAGG - Intergenic
1130057340 15:80537851-80537873 ATGTGACCATATTTGGAAATAGG + Intronic
1130836235 15:87652899-87652921 CTGTAGCCATGTTTCTGAAGAGG - Intergenic
1130859639 15:87874981-87875003 TTGTAGCCATGGTTGGGATTTGG - Intronic
1131266768 15:90920096-90920118 CTATATCCCTGTTTGGAAAAAGG - Exonic
1131740288 15:95382940-95382962 CTTTTGCCCAGTTTGGAAATTGG - Intergenic
1132524981 16:409985-410007 CTGTGGCCTTGTTTGGAAATGGG - Intronic
1133133810 16:3695156-3695178 ATGTGACCATATTTGGAAATAGG - Intronic
1133189308 16:4121761-4121783 ATGTGGCCTTATTTGGAAATGGG + Intergenic
1133451324 16:5906193-5906215 CTGTGTCCTTATTTGGAAATAGG + Intergenic
1134819704 16:17236896-17236918 ATGTGGCCTTATTTGGAAATAGG - Intronic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1136055411 16:27684883-27684905 CTGTGACCTTATTTGGAAATAGG - Intronic
1137619675 16:49868147-49868169 CTGTAACCATGTTTCTAAGTGGG + Intergenic
1137823584 16:51468627-51468649 GTGTAGCGATGTTAGGAAACTGG + Intergenic
1139947204 16:70649568-70649590 GTGTGACCTTGTTTGGAAATGGG - Intronic
1140614983 16:76651251-76651273 CTGTGACCTTATTTGGAAATTGG + Intergenic
1141192701 16:81835996-81836018 ATGTGGCCTTCTTTGGAAATAGG - Intronic
1141385557 16:83619780-83619802 CTGTAACCTTATTTGGAAAGAGG - Intronic
1141616767 16:85214281-85214303 GTGTGACCTTGTTTGGAAATAGG + Intergenic
1141909182 16:87046914-87046936 ATGTCACCATGTTTGGAGATAGG - Intergenic
1143388557 17:6546512-6546534 CTGTGGCCATGGTTGTAACTCGG - Intronic
1143685007 17:8506805-8506827 CTGTACCCAGGTTTGCAAAGTGG + Intronic
1145405765 17:22590720-22590742 ATGTAACCTTATTTGGAAATAGG - Intergenic
1146764573 17:35507631-35507653 CTGGGGCCATGTTTGAAAAATGG + Intronic
1146841905 17:36162106-36162128 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1146854216 17:36250066-36250088 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146870119 17:36373958-36373980 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146877476 17:36425039-36425061 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147073000 17:37974582-37974604 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147084522 17:38054120-38054142 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147100469 17:38178086-38178108 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147755283 17:42763229-42763251 CTGGAGCCGAGTTTGGATATAGG - Intergenic
1147809909 17:43160971-43160993 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1148655813 17:49282565-49282587 ATGTAACCTTATTTGGAAATGGG + Intergenic
1148828556 17:50413405-50413427 CTGACGCCATGTTTGGAAAATGG - Intergenic
1149324409 17:55515462-55515484 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1149445760 17:56712120-56712142 ATGTTGCCATATTTGGAAAAAGG + Intergenic
1149987768 17:61360733-61360755 ATGTGGCCTTATTTGGAAATGGG - Intronic
1150083410 17:62261132-62261154 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1150721503 17:67617905-67617927 ATGTGACCTTGTTTGGAAATAGG - Intronic
1151218482 17:72593509-72593531 ATGTAACCTTATTTGGAAATAGG - Intergenic
1151488112 17:74414805-74414827 ATGTTACCTTGTTTGGAAATAGG + Intergenic
1152157121 17:78641761-78641783 CTGCAGCCTTGTTTGAAACTGGG + Intergenic
1152455365 17:80412788-80412810 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1153367378 18:4272779-4272801 ATGTGACCTTGTTTGGAAATGGG + Intronic
1153663731 18:7349689-7349711 CTGTGTCTATATTTGGAAATAGG - Intergenic
1153830782 18:8920626-8920648 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1155810037 18:30220869-30220891 ATGTAACTATATTTGGAAATAGG + Intergenic
1156570257 18:38244513-38244535 CTGTAGAGATATGTGGAAATGGG - Intergenic
1156834013 18:41530703-41530725 TTGTAACCATATTTGGAGATAGG + Intergenic
1157243484 18:46033299-46033321 CTGTGACCTTATTTGGAAATAGG + Intronic
1157552186 18:48589498-48589520 ATGTGGCCTTATTTGGAAATAGG - Intronic
1158847727 18:61462448-61462470 CTGTGGCCTTATTTGGAAATAGG - Intronic
1158869419 18:61670236-61670258 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1158889531 18:61859931-61859953 ATGTAGCCTTATTTGGAAAACGG + Intronic
1159030913 18:63230439-63230461 CTTTAACCATGTGTGGAAAAAGG - Intronic
1159898806 18:74022754-74022776 ATGCAGCCGTATTTGGAAATAGG + Intergenic
1161757358 19:6143911-6143933 ATGTAACCTTGTTTGGGAATAGG + Intronic
1161899048 19:7104188-7104210 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1162936785 19:13985497-13985519 CTGTTGCCTTGTCTGAAAATGGG - Intronic
1162984017 19:14257833-14257855 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1163585190 19:18160141-18160163 CTGTGACCTTATTTGGAAATAGG - Intronic
1163878484 19:19897080-19897102 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1163992296 19:21009851-21009873 CTGGGGCCATGTTTGAAAAATGG + Intergenic
1164216497 19:23155245-23155267 CTGGGGCCATGTTTGGAAAGTGG - Intergenic
1164345669 19:27253222-27253244 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1166107175 19:40603059-40603081 CTGTTGCCATGGTTGGAGAGCGG - Intronic
1167219122 19:48186039-48186061 CTGTAGCCATGTGTGGCCAGTGG - Intronic
1167376073 19:49112792-49112814 CTGCAGGCATGTTTGAATATTGG - Intergenic
1167581657 19:50347738-50347760 CTGAGGCCATGTTTGGAAATTGG - Intronic
1167735329 19:51291125-51291147 ATGTAACCATGTTTGGAGATAGG - Intergenic
1167827481 19:51986970-51986992 CGGCAGCCATGTTTGAAAATTGG + Intergenic
1167857675 19:52255989-52256011 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1168329889 19:55561806-55561828 ATGTGGCCTTATTTGGAAATCGG + Intergenic
925450840 2:3968239-3968261 CTCTTGCCACGTTTGGAATTTGG + Intergenic
925719008 2:6810384-6810406 ATGTGGCCTTATTTGGAAATAGG - Intergenic
926411028 2:12602960-12602982 TTGAATACATGTTTGGAAATAGG - Intergenic
926592793 2:14757716-14757738 ATGTGACCTTGTTTGGAAATAGG - Intergenic
927870622 2:26620558-26620580 CTAGAGCCATGTTAGGAAAGAGG - Intronic
927943471 2:27120306-27120328 CTGTGACCTTATTTGGAAATAGG + Intergenic
929686292 2:44038190-44038212 AAGTACACATGTTTGGAAATTGG - Intergenic
930132869 2:47870387-47870409 ACGTGGCCATATTTGGAAATAGG + Intronic
931187597 2:59968590-59968612 CTGGAACCATTTTTGGAAGTTGG - Intergenic
932529694 2:72515795-72515817 ATGCAACCATATTTGGAAATAGG + Intronic
933424948 2:82098902-82098924 GTTTTGCCAAGTTTGGAAATGGG - Intergenic
933848330 2:86345062-86345084 CTGGAGGCATTTTTGGAAGTTGG + Intergenic
934049495 2:88198483-88198505 CTGTGACCTTATTTGGAAATAGG + Intergenic
934885481 2:98020933-98020955 CTGTAACCTTATTTGGAAATGGG - Intergenic
935275032 2:101468690-101468712 ATGTAACCTTATTTGGAAATAGG - Intronic
935721075 2:105979822-105979844 CTGGGGCCATGTTTGGAAAATGG - Intergenic
935874951 2:107496346-107496368 CTATGACCATATTTGGAAATAGG - Intergenic
935970979 2:108530725-108530747 CTGAGGCCATGTTTAGAAAATGG + Intergenic
936602800 2:113915455-113915477 ATGTAACTGTGTTTGGAAATAGG - Intronic
937123403 2:119456704-119456726 CTGTAACCTTACTTGGAAATAGG + Intronic
937201252 2:120205779-120205801 TTGTAACCTTGTTTGGAAATGGG + Intergenic
938028416 2:127970797-127970819 ATGCAGCCTTATTTGGAAATAGG - Intronic
939218955 2:139277671-139277693 CTGCAGAATTGTTTGGAAATAGG + Intergenic
939897235 2:147806895-147806917 ATGTGACCTTGTTTGGAAATAGG - Intergenic
940179370 2:150914767-150914789 ATGTGGCCTTATTTGGAAATAGG - Intergenic
940459013 2:153938840-153938862 ATGGAACCATATTTGGAAATAGG - Intronic
940510319 2:154605687-154605709 ATGTGGCCATGCTTGGAAATCGG + Intergenic
940858859 2:158751790-158751812 ATGTAGTCTTATTTGGAAATAGG - Intergenic
941018449 2:160383405-160383427 ATGTAACCTTATTTGGAAATAGG - Intronic
942513847 2:176730653-176730675 ATGTAGCCTTCATTGGAAATAGG + Intergenic
942602278 2:177653501-177653523 ATGTGGCCATGTTTGGAAATAGG + Intronic
944977019 2:205065546-205065568 GTGTAGCCGTGTTGGGAAGTGGG + Intronic
945289961 2:208117135-208117157 CTGGGGCCATGTTTGAAAAATGG + Intergenic
946108603 2:217393905-217393927 CTCTATCCATATTTGGAAGTTGG - Intronic
946493240 2:220170547-220170569 ATGTGGCCTTATTTGGAAATAGG + Intergenic
946745067 2:222837345-222837367 CTGAAGCCATGTTTGCGGATGGG - Intergenic
947937733 2:234022440-234022462 CTGAAGTCAAGTTTGTAAATAGG - Intergenic
948025322 2:234771817-234771839 ATGTGGCCTTGTTTGGAAATAGG + Intergenic
948265859 2:236634932-236634954 CTGTGGCCTTATTTGGAAATAGG + Intergenic
948844729 2:240677586-240677608 CCGTAGCCAGGTGTGGACATGGG - Intronic
948849131 2:240697293-240697315 CCGTAGCCAGGTGTGGACATGGG + Intronic
1169460812 20:5793175-5793197 CTGTAGCTATGTTTTGAATCAGG + Intronic
1169575803 20:6959620-6959642 CTTTAGACATGCTTGGCAATTGG - Intergenic
1169839549 20:9919989-9920011 ATGTAACCATATTTGGAAATAGG - Intergenic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1173274829 20:41571040-41571062 CTGTAGACTTGTTTGGGAACTGG - Intronic
1173402406 20:42737106-42737128 ATGTGGCCTTATTTGGAAATAGG + Intronic
1173582064 20:44154454-44154476 CAGTAGCCATGTATGGCAAGTGG + Intronic
1173598335 20:44274737-44274759 GTGTAGCCAGACTTGGAAATAGG - Intronic
1173942694 20:46925211-46925233 CTCTGGCCTTATTTGGAAATAGG - Intronic
1174104450 20:48152433-48152455 ATGTGGCCTTATTTGGAAATGGG + Intergenic
1174392624 20:50227150-50227172 CTGGAGCCAGGTTTGTAGATGGG + Intergenic
1175849959 20:62084933-62084955 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1177017168 21:15806516-15806538 CTGGAGCCATGTATGTACATAGG + Intronic
1177354906 21:19995901-19995923 CTGGGGCTATGTTTGGAAAATGG - Intergenic
1177877525 21:26651935-26651957 ATGTAACCTTATTTGGAAATAGG + Intergenic
1178326668 21:31652019-31652041 AGGTGACCATGTTTGGAAATGGG - Intergenic
1178466283 21:32851271-32851293 CTGGAGCCATTTTGGGCAATCGG + Intergenic
1178895023 21:36550885-36550907 ATGTGGCCTTATTTGGAAATAGG + Intronic
1179670494 21:42943468-42943490 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1179768008 21:43588458-43588480 CTGTAGCGTTGTTGGGAAACAGG + Intronic
1180184797 21:46134284-46134306 ATGTGACCTTGTTTGGAAATGGG - Intergenic
1180424922 22:15165783-15165805 TTGTAGCCTTCATTGGAAATGGG - Intergenic
1182481962 22:30614955-30614977 GTGCAGCTAAGTTTGGAAATAGG + Intronic
1184365999 22:44051760-44051782 CTGTCACCTTATTTGGAAATAGG + Intronic
1185270187 22:49926246-49926268 TTGTGACCTTGTTTGGAAATAGG - Intronic
949143504 3:665317-665339 CTGTAGCCAACTTTGTAAAATGG + Intergenic
949582077 3:5398571-5398593 ATGTGGCTATGTTTGGAGATAGG - Intergenic
950123991 3:10500421-10500443 ATGTGACCTTGTTTGGAAATAGG + Intronic
950689802 3:14646693-14646715 ATGTGGCCTTATTTGGAAATAGG + Intergenic
950810881 3:15648713-15648735 ATGTGGCCTTATTTGGAAATAGG + Intergenic
950912547 3:16609648-16609670 ATGCAGCCATATTTGAAAATCGG + Intronic
951220721 3:20066352-20066374 ATGGGGCCATATTTGGAAATAGG - Intronic
951833170 3:26952493-26952515 TTGAAGCCATGATGGGAAATGGG - Intergenic
952310625 3:32186044-32186066 TTGTAGCCATCTTTGAAAAATGG + Intergenic
955064923 3:55525941-55525963 ATGTGACCTTGTTTGGAAATAGG + Intronic
956727380 3:72167685-72167707 CTGTAGCCATGTATCCCAATTGG + Intergenic
957406624 3:79780248-79780270 CTGGGGCCATGTTTGGAAAATGG + Intergenic
957564820 3:81870760-81870782 ATGTAACCTTATTTGGAAATAGG - Intergenic
957997388 3:87707738-87707760 ATGTAACCATATTTGGAGATGGG - Intergenic
958223028 3:90720729-90720751 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958223157 3:90772919-90772941 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958223259 3:90774618-90774640 CTGAGGCCATCTTTGGAAACAGG + Intergenic
958223453 3:90778016-90778038 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958223555 3:90779715-90779737 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958223653 3:90781415-90781437 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958223756 3:90783115-90783137 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958223856 3:90784814-90784836 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958223996 3:90787362-90787384 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224097 3:90789061-90789083 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224193 3:90790759-90790781 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224297 3:90792457-90792479 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224403 3:90794157-90794179 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224508 3:90795857-90795879 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958224616 3:90797556-90797578 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224717 3:90799255-90799277 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224819 3:90800954-90800976 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958224924 3:90802653-90802675 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225022 3:90804353-90804375 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225123 3:90806050-90806072 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225227 3:90807749-90807771 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958225327 3:90809448-90809470 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225537 3:90812846-90812868 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225639 3:90814548-90814570 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225730 3:90816247-90816269 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225829 3:90817945-90817967 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958225928 3:90819643-90819665 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226036 3:90821341-90821363 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226223 3:90824739-90824761 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226325 3:90826438-90826460 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226419 3:90828138-90828160 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226517 3:90829837-90829859 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226626 3:90831536-90831558 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958226935 3:90836635-90836657 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227042 3:90838334-90838356 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227248 3:90841734-90841756 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227345 3:90843434-90843456 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227549 3:90846830-90846852 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227751 3:90850226-90850248 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227802 3:90851076-90851098 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227899 3:90852776-90852798 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958227999 3:90854474-90854496 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958228099 3:90856173-90856195 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958228203 3:90857872-90857894 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958228309 3:90859572-90859594 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958228500 3:90862970-90862992 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958228594 3:90864668-90864690 CTGAGGCCATCTTTGGAAACTGG + Intergenic
958228790 3:90868069-90868091 CTGACGCCATCTTTGGAAACGGG + Intergenic
958229094 3:90873166-90873188 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229190 3:90874865-90874887 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229497 3:90879962-90879984 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229598 3:90881661-90881683 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229695 3:90883360-90883382 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229797 3:90885059-90885081 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229894 3:90886759-90886781 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958229998 3:90888457-90888479 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230099 3:90890156-90890178 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230200 3:90891856-90891878 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230303 3:90893555-90893577 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230405 3:90895253-90895275 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230604 3:90898652-90898674 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230701 3:90900350-90900372 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230809 3:90902049-90902071 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958230911 3:90903748-90903770 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231014 3:90905447-90905469 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231114 3:90907146-90907168 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231213 3:90908846-90908868 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231412 3:90912244-90912266 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231516 3:90913943-90913965 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231621 3:90915642-90915664 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231718 3:90917342-90917364 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231820 3:90919041-90919063 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958231920 3:90920740-90920762 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232022 3:90922440-90922462 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232127 3:90924139-90924161 CTGAGGCCATTTTTGGAAACGGG + Intergenic
958232231 3:90925838-90925860 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958232329 3:90927537-90927559 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232436 3:90929236-90929258 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232536 3:90930936-90930958 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958232636 3:90932635-90932657 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232735 3:90934334-90934356 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958232841 3:90936034-90936056 CTGAGGCCATCTTTGGAAACCGG + Intergenic
958232944 3:90937731-90937753 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958233047 3:90939430-90939452 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958233146 3:90941128-90941150 CTGAGGCCATCTTTGGAAAAGGG + Intergenic
958233249 3:90942827-90942849 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958233346 3:90944526-90944548 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958233553 3:90947925-90947947 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958233660 3:90949624-90949646 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958233771 3:90951323-90951345 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958233972 3:90954721-90954743 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958234078 3:90956419-90956441 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234175 3:90958118-90958140 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234279 3:90959818-90959840 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234376 3:90961517-90961539 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234473 3:90963216-90963238 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234571 3:90964916-90964938 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958234971 3:90971710-90971732 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235076 3:90973408-90973430 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235171 3:90975109-90975131 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235266 3:90976807-90976829 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235365 3:90978506-90978528 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235459 3:90980205-90980227 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235559 3:90981905-90981927 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235657 3:90983602-90983624 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235760 3:90985302-90985324 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958235863 3:90987001-90987023 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236073 3:90990399-90990421 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236169 3:90992097-90992119 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236266 3:90993797-90993819 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236376 3:90995496-90995518 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236473 3:90997194-90997216 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236578 3:90998893-90998915 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236675 3:91000591-91000613 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236784 3:91002291-91002313 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958236888 3:91003990-91004012 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237083 3:91007388-91007410 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237188 3:91009087-91009109 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237287 3:91010787-91010809 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237385 3:91012485-91012507 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237490 3:91014184-91014206 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237597 3:91015883-91015905 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237795 3:91019282-91019304 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237891 3:91020985-91021007 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958237996 3:91022683-91022705 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238093 3:91024382-91024404 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238194 3:91026081-91026103 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238291 3:91027776-91027798 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238491 3:91031173-91031195 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238595 3:91032872-91032894 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238689 3:91034572-91034594 CTGAGGCCATCTTTGGAAACTGG + Intergenic
958238793 3:91036271-91036293 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238888 3:91037969-91037991 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958238992 3:91039669-91039691 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239093 3:91041368-91041390 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239202 3:91043067-91043089 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239311 3:91044766-91044788 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239411 3:91046466-91046488 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239508 3:91048163-91048185 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958239709 3:91051561-91051583 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958239914 3:91054959-91054981 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958240118 3:91058358-91058380 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958240211 3:91060055-91060077 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958240314 3:91061754-91061776 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958240407 3:91063453-91063475 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958240603 3:91066851-91066873 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241125 3:91075346-91075368 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241236 3:91077044-91077066 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241338 3:91078743-91078765 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958241441 3:91080444-91080466 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241540 3:91082143-91082165 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241641 3:91083842-91083864 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241740 3:91085542-91085564 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241842 3:91087243-91087265 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241942 3:91088943-91088965 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958241993 3:91089793-91089815 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958242091 3:91091493-91091515 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958242296 3:91094892-91094914 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958242400 3:91096592-91096614 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958242604 3:91099989-91100011 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958242810 3:91103387-91103409 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958242903 3:91105087-91105109 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243102 3:91108485-91108507 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243199 3:91110183-91110205 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243305 3:91111881-91111903 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243411 3:91113579-91113601 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243521 3:91115278-91115300 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243616 3:91116977-91116999 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243714 3:91118677-91118699 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243821 3:91120376-91120398 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958243916 3:91122075-91122097 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958244018 3:91123776-91123798 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244120 3:91125475-91125497 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244221 3:91127174-91127196 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244318 3:91128872-91128894 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244423 3:91130571-91130593 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244519 3:91132271-91132293 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244622 3:91133971-91133993 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244728 3:91135670-91135692 CTGAGGCCATCTTTGGAAACTGG + Intergenic
958244828 3:91137369-91137391 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958244936 3:91139069-91139091 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245041 3:91140769-91140791 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245141 3:91142468-91142490 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245244 3:91144167-91144189 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245339 3:91145867-91145889 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245435 3:91147565-91147587 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245535 3:91149265-91149287 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245637 3:91150963-91150985 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245733 3:91152662-91152684 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245836 3:91154362-91154384 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958245938 3:91156060-91156082 CTGAGGCCATCTTTGGAAACAGG + Intergenic
958246035 3:91157761-91157783 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246146 3:91159460-91159482 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246340 3:91162858-91162880 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246444 3:91164558-91164580 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246648 3:91167956-91167978 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246750 3:91169653-91169675 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246851 3:91171354-91171376 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958246956 3:91173053-91173075 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247059 3:91174753-91174775 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247164 3:91176452-91176474 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247257 3:91178151-91178173 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247354 3:91179851-91179873 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247459 3:91181550-91181572 CTGAGGCCATGTTTGGAAACGGG + Intergenic
958247559 3:91183249-91183271 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247660 3:91184949-91184971 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247761 3:91186646-91186668 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958247968 3:91190044-91190066 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248175 3:91193442-91193464 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248274 3:91195141-91195163 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248379 3:91196840-91196862 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248490 3:91198540-91198562 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248586 3:91200239-91200261 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248687 3:91201935-91201957 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248792 3:91203634-91203656 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248889 3:91205333-91205355 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958248992 3:91207032-91207054 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249089 3:91208731-91208753 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249190 3:91210430-91210452 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249296 3:91212129-91212151 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249397 3:91213830-91213852 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249496 3:91215529-91215551 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958249695 3:91218928-91218950 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958250009 3:91224023-91224045 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958250114 3:91225721-91225743 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958250210 3:91227421-91227443 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958250315 3:91229120-91229142 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958250419 3:91230819-91230841 CTGAGGCCATCTTTGGAAACGGG + Intergenic
958251590 3:91256793-91256815 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958251694 3:91260837-91260859 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958251789 3:91262535-91262557 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958251886 3:91264233-91264255 CTGAGGCCATCTTTGGAAACTGG - Intergenic
958252005 3:91278000-91278022 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958252100 3:91279699-91279721 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958252200 3:91281403-91281425 CTGAGGCCATCTTTGGAAACGGG - Intergenic
958252362 3:91284775-91284797 CTGAGGCCATCTTTGGAAACGGG - Intergenic
959084405 3:101835706-101835728 ATGTGGCTATGTTTGGAGATGGG - Intronic
959406441 3:105966923-105966945 ATGTAACCATATTTGGGAATAGG - Intergenic
959497985 3:107073389-107073411 ATGTGACCATATTTGGAAATAGG - Intergenic
959712777 3:109401536-109401558 ATGTAACCGTGTTTGGAAGTAGG - Intergenic
959795576 3:110424151-110424173 ATGTAACCATATATGGAAATAGG + Intergenic
961064959 3:123867324-123867346 ATGTGGCCTGGTTTGGAAATAGG + Intronic
962277452 3:134026905-134026927 CTGGGGCCATGTTTAGAAAATGG + Intronic
962786392 3:138771996-138772018 CTGTATTCAGGTTTGTAAATAGG - Intronic
964521980 3:157579941-157579963 CTGGGGCCATGTTTGGAAAATGG - Intronic
964924432 3:161938382-161938404 ATGGGGCCATGTTTGGAAAATGG + Intergenic
964932593 3:162045236-162045258 CTGGGGCCATGTTTGGAAAATGG - Intergenic
965192819 3:165553282-165553304 ATGTGACCATATTTGGAAATAGG + Intergenic
965635669 3:170777781-170777803 ATGTGGCCTTATTTGGAAATAGG + Intronic
965653455 3:170958278-170958300 CTGTAGCCTTATTTGGAAATAGG + Intergenic
966125706 3:176573887-176573909 CAGTAGCCATATGTGGCAATTGG - Intergenic
966287929 3:178319653-178319675 CTGTAGCCCTGGGTGGGAATTGG + Intergenic
966372584 3:179264580-179264602 CTGTAGCCATGTGTCGTACTTGG - Intronic
966386227 3:179402117-179402139 GTATGGCCATGTTTGGCAATGGG + Intronic
966543099 3:181114116-181114138 ATGTGGCCTTATTTGGAAATAGG - Intergenic
967309475 3:188092542-188092564 CAGTTTCCTTGTTTGGAAATGGG - Intergenic
967954865 3:194870353-194870375 ATGTAGCCTTATTTGGACATAGG - Intergenic
968124892 3:196151737-196151759 ATGTGACCTTGTTTGGAAATAGG - Intergenic
968544196 4:1188749-1188771 CTTTATCCATGATTGGAAATGGG - Intronic
969530188 4:7726183-7726205 CGGTGGCCATGTGTGGAGATGGG + Intronic
969625505 4:8303099-8303121 ATGTGACCTTGTTTGGAAATAGG - Intronic
970138370 4:12951413-12951435 ATGTAGCCTTATTTGGAAATAGG - Intergenic
970342956 4:15126186-15126208 ATGTAACCTTGTTTGTAAATAGG + Intergenic
971027678 4:22604705-22604727 CAGGAGCCATGTTTAAAAATTGG + Intergenic
972077867 4:35108487-35108509 CTGGGGCCATGTTTGGAACTTGG + Intergenic
972192089 4:36606447-36606469 CAGTAGCCATGTATGCATATTGG + Intergenic
972217441 4:36912617-36912639 CTGGGGCCATGTTTAGAAAATGG + Intergenic
972275307 4:37551706-37551728 CTGAAGCCATGTTTAGAAGGTGG + Intronic
973315052 4:48750816-48750838 CTGTAGCCATCTTGGGTCATAGG - Intronic
974949489 4:68570810-68570832 CTGAAGCCATGTTTAGAAAGTGG - Intronic
976505035 4:85836601-85836623 ATGTGGTCATATTTGGAAATAGG - Intronic
976969622 4:91089749-91089771 CTGGGGCCATGTTTGGAAATTGG - Intronic
976989959 4:91353856-91353878 CTGTAGCCATGTTTGGAAATTGG - Intronic
977043151 4:92039151-92039173 CTGGGCCCATGTTTGGAAAATGG - Intergenic
977156742 4:93583202-93583224 ATGTGACCTTGTTTGGAAATAGG - Intronic
977724897 4:100284598-100284620 CTGTATCCAATTTTGGGAATCGG - Intergenic
977895339 4:102358282-102358304 ATGTAACCTTGTTTGGAAATAGG + Intronic
977972798 4:103230728-103230750 CTGGGGCTATGTTTGGAAAATGG + Intergenic
979954558 4:126935840-126935862 ATGTAACCTTATTTGGAAATAGG + Intergenic
980073417 4:128266961-128266983 CTGGGGCCATGTTTGGAAAATGG + Intergenic
980175683 4:129341166-129341188 ATGTCACCATATTTGGAAATAGG - Intergenic
980999756 4:139817497-139817519 CTTTGGCAATATTTGGAAATGGG - Intronic
981686623 4:147461929-147461951 ATGTGACCATATTTGGAAATAGG + Intergenic
983621165 4:169761996-169762018 CTGTAACCATATTTGGAAATAGG - Intergenic
983803824 4:171968570-171968592 ATGTAACCTTATTTGGAAATAGG - Intronic
983804237 4:171973623-171973645 ATGTAGCTTTATTTGGAAATGGG - Intronic
983898371 4:173105518-173105540 CTGGGGCCATGTTTGGAAAATGG + Intergenic
984152944 4:176157040-176157062 ATGTAACCATATATGGAAATAGG - Intronic
984852244 4:184164371-184164393 ATGTGACCCTGTTTGGAAATTGG + Intronic
984896377 4:184544919-184544941 ATGTGGCCTTATTTGGAAATAGG + Intergenic
985428798 4:189858042-189858064 CTATGGCGTTGTTTGGAAATAGG - Intergenic
986077989 5:4357709-4357731 ATGTGACCTTGTTTGGAAATAGG - Intergenic
986284321 5:6348543-6348565 ATGTGGCCTTATTTGGAAATGGG - Intergenic
986293878 5:6421641-6421663 ATGTGACCTTGTTTGGAAATAGG + Intergenic
986339854 5:6779579-6779601 CTGTGACCTTATTTGGAAATGGG + Intergenic
986405577 5:7421551-7421573 CTGTAACCTTATTTGGAAACAGG - Intronic
986413911 5:7509102-7509124 CAGTGGACAAGTTTGGAAATAGG + Intronic
986442411 5:7793744-7793766 CTGTAGCCCTGTGTGTACATAGG + Intronic
986460051 5:7960754-7960776 ATGTAACCATATTTGGAAACAGG - Intergenic
986708889 5:10473224-10473246 ATGTGGCCTTGTTTGGAAAAAGG + Intergenic
986717115 5:10532802-10532824 ATGTGGCCTTATTTGGAAATAGG + Intergenic
987033823 5:14000093-14000115 GTGTAGCCTTCTTTGGAAATAGG + Intergenic
987930278 5:24392548-24392570 CTGGGGCCATGTTTGGAAATTGG - Intergenic
988801413 5:34699598-34699620 ATGTAACCTTGTTTAGAAATAGG - Intronic
989116470 5:37958701-37958723 ATGTAACCTTATTTGGAAATAGG + Intergenic
989860222 5:46364212-46364234 TTGTGGCCTTCTTTGGAAATGGG - Intergenic
989924301 5:49851930-49851952 TTGAAGCCTTTTTTGGAAATGGG + Intergenic
989934264 5:49999777-49999799 TTGAAGCCTTTTTTGGAAATGGG + Intergenic
991296210 5:65084392-65084414 ATGTAACCTTATTTGGAAATAGG - Intergenic
991675760 5:69088522-69088544 CTGGGGCCATGTTTGGAAAATGG - Intergenic
992263339 5:74992530-74992552 CTGTGACCTTATTTGGAAATAGG - Intergenic
992370386 5:76137740-76137762 CAGTAGCCATGTTTAAAATTTGG + Intronic
992663392 5:78983667-78983689 CTGTAGCCAAGGTTAGAAATGGG - Intronic
993782545 5:92086277-92086299 TTGTAGGCATGTTTTGGAATTGG - Intergenic
994313456 5:98304248-98304270 CTTTAGCCAAATTTGGAAATTGG - Intergenic
995474242 5:112531914-112531936 CTGAAGCCATGTTTGGAAAATGG + Intergenic
995987955 5:118203211-118203233 CTGTTGCTAGGTTTGGGAATTGG - Intergenic
997562923 5:134864257-134864279 CAGAAGCCATGTTTTGAAATTGG - Intergenic
998115075 5:139530806-139530828 CGGGAGCCATGTTTGAAAATTGG + Intronic
1000604501 5:163313779-163313801 CGGGAGCCATGTTTGGAAACTGG - Intergenic
1000748515 5:165065912-165065934 ATGTAGCCTTGGTTGGAAACAGG - Intergenic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1002407745 5:179049266-179049288 CTGGGGCCATGTTTGGAAATTGG - Intergenic
1002998707 6:2311118-2311140 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1003136115 6:3435758-3435780 ATGTGACCCTGTTTGGAAATAGG + Intronic
1003954190 6:11146861-11146883 CTGTGACCTTATTTGGAAATGGG + Intergenic
1004334835 6:14755329-14755351 ATGTAGCCTTATTTGGAAAGAGG - Intergenic
1004335176 6:14757866-14757888 ATGTAACCTTATTTGGAAATAGG - Intergenic
1005454961 6:26010803-26010825 TTGTGGCCTTATTTGGAAATAGG - Intergenic
1005461101 6:26071169-26071191 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1005462346 6:26081035-26081057 CTGGGGCCATGTTTGAAAAATGG + Intergenic
1005510602 6:26508777-26508799 CTGTAGAGTTGTATGGAAATGGG + Exonic
1006570917 6:35003544-35003566 CTGAGGCCATGTTTAGAAATTGG + Intronic
1009192629 6:60647960-60647982 CTGTGGCCTTGTTTAGGAATAGG - Intergenic
1009941154 6:70289416-70289438 CAGAAGCCATGATTGGAAGTAGG - Intronic
1010318128 6:74473854-74473876 CAGGAGCCATGTTTAGAAATTGG + Intergenic
1010781992 6:79954293-79954315 CTTTTGGCATGTGTGGAAATAGG - Intergenic
1011323123 6:86119085-86119107 CTGTGGCCATGTTTCAAAGTGGG + Intergenic
1012143602 6:95653623-95653645 GTGTAGCCATGTTGGAAAATTGG + Intergenic
1013061942 6:106643354-106643376 CTGTGCCCATTTTTTGAAATTGG + Intronic
1013182450 6:107729509-107729531 CTGGAACCCTTTTTGGAAATGGG - Intronic
1013612778 6:111810690-111810712 GTGTAGGCATGTGTGGAAGTGGG - Intronic
1014469739 6:121799688-121799710 CTGTGACCATATTTGTAAATAGG + Intergenic
1014546482 6:122742227-122742249 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1014591320 6:123275197-123275219 ATGTAACCTTATTTGGAAATAGG + Intronic
1015172330 6:130267224-130267246 CTGGGGCCATGTTTGGAAATTGG + Intronic
1015336998 6:132050650-132050672 GTGTAGCCTTATTTGGAGATAGG + Intergenic
1015895680 6:138014144-138014166 GTGCAGACATGTTTGCAAATGGG + Intergenic
1016673601 6:146737587-146737609 GTGTAGCCCTTTTAGGAAATGGG - Intronic
1017532476 6:155309696-155309718 GTGTAGCCCTTTTTGGACATAGG - Intronic
1017549109 6:155485612-155485634 CAGTAGCCATTTATGGAAAATGG + Intergenic
1017576636 6:155812694-155812716 CTGCAGGCACCTTTGGAAATGGG - Intergenic
1018394151 6:163364477-163364499 CTATAGCCAGGGTTGGAAAAGGG - Intergenic
1018755130 6:166842256-166842278 ATGTGGCCTTGTTTGGAAATAGG + Intronic
1018912766 6:168112443-168112465 ATGCAGCCTTGTTTGGAAATAGG + Intergenic
1019012487 6:168853072-168853094 CTGTTTCCATGTCTGCAAATAGG + Intergenic
1019223188 6:170491054-170491076 GTGTGACCATGTTTGGAGATAGG + Intergenic
1019772346 7:2891573-2891595 CTGTAGCCTTATCCGGAAATAGG - Intergenic
1019893870 7:3967839-3967861 CTGCAGACCTGTTTGGAACTGGG - Intronic
1020043432 7:5021592-5021614 CTGGGGCCATGTTTGGAAAATGG - Intronic
1020491626 7:8792009-8792031 ATGTAGCCGTGTTTGGAGACAGG - Intergenic
1021849027 7:24790001-24790023 GTGGGGCCATGTTTGGAAAATGG - Intergenic
1021887666 7:25156015-25156037 TTGTAACCTTGTATGGAAATAGG + Intronic
1022337410 7:29434676-29434698 CTATGGCCTTATTTGGAAATAGG - Intronic
1023170675 7:37387538-37387560 ATGTTTCCTTGTTTGGAAATAGG - Intronic
1023209253 7:37785355-37785377 GTGTAAACAGGTTTGGAAATTGG + Intronic
1023347766 7:39288990-39289012 CAGAAGCAATGTTTGGAAGTTGG - Intronic
1023380280 7:39600279-39600301 ATGTGACCTTGTTTGGAAATAGG + Intronic
1023561233 7:41475277-41475299 CTGTTGCCTTGTCTGTAAATTGG + Intergenic
1023624217 7:42100345-42100367 ATGTGACCATATTTGGAAATAGG + Intronic
1024282505 7:47731217-47731239 ATGTAACCTTGTTTGGAAATAGG + Intronic
1024347120 7:48324397-48324419 ATGTGGCCTTGTTTGGAAATAGG - Intronic
1025490672 7:61117020-61117042 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025490836 7:61119755-61119777 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025490999 7:61122490-61122512 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025491160 7:61125224-61125246 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025491321 7:61127958-61127980 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025491640 7:61133426-61133448 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025491934 7:61138552-61138574 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025492107 7:61141456-61141478 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025492265 7:61144190-61144212 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025492426 7:61146924-61146946 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025492589 7:61149658-61149680 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025492751 7:61152392-61152414 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025492907 7:61155125-61155147 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025493068 7:61157859-61157881 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025493228 7:61160593-61160615 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025493392 7:61163327-61163349 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025493553 7:61166061-61166083 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025493713 7:61168795-61168817 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025493869 7:61171529-61171551 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025494076 7:61175119-61175141 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025494232 7:61177853-61177875 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025494394 7:61180587-61180609 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025494535 7:61182980-61183002 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025494695 7:61185714-61185736 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025494855 7:61188448-61188470 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495012 7:61191180-61191202 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495173 7:61193914-61193936 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495184 7:61194086-61194108 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495344 7:61196820-61196842 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495505 7:61199554-61199576 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495669 7:61202288-61202310 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495828 7:61205021-61205043 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025495986 7:61207755-61207777 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025496149 7:61210489-61210511 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025496310 7:61213223-61213245 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025496473 7:61215957-61215979 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025496796 7:61221424-61221446 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025496956 7:61224158-61224180 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025497116 7:61226892-61226914 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025497294 7:61229967-61229989 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025497451 7:61232701-61232723 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025497614 7:61235435-61235457 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025497773 7:61238169-61238191 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025498083 7:61243637-61243659 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025498245 7:61246371-61246393 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025498407 7:61249105-61249127 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025498877 7:61257306-61257328 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025499053 7:61260382-61260404 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025502899 7:61378421-61378443 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025503058 7:61381155-61381177 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025503222 7:61383889-61383911 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025503387 7:61386624-61386646 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025503703 7:61392093-61392115 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025503863 7:61394827-61394849 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504024 7:61397561-61397583 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504182 7:61400295-61400317 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504345 7:61403029-61403051 TTGAAGCCTTCTTTGGAAATTGG + Intergenic
1025504508 7:61405764-61405786 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504670 7:61408497-61408519 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504831 7:61411231-61411253 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025504991 7:61413965-61413987 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505155 7:61416699-61416721 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505316 7:61419433-61419455 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505479 7:61422167-61422189 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505644 7:61424898-61424920 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505809 7:61427632-61427654 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025505987 7:61430537-61430559 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025506145 7:61433271-61433293 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025506465 7:61438739-61438761 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025506624 7:61441473-61441495 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025506784 7:61444206-61444228 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507104 7:61449669-61449691 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507274 7:61452423-61452445 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507434 7:61455157-61455179 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507601 7:61457895-61457917 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507764 7:61460631-61460653 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025507928 7:61463366-61463388 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025508090 7:61466100-61466122 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025508409 7:61471568-61471590 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025508728 7:61477036-61477058 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025508886 7:61479770-61479792 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509052 7:61482503-61482525 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509215 7:61485245-61485267 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509370 7:61487979-61488001 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509531 7:61490714-61490736 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509691 7:61493447-61493469 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025509855 7:61496181-61496203 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510017 7:61498916-61498938 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510178 7:61501650-61501672 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510340 7:61504384-61504406 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510501 7:61507120-61507142 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510668 7:61509852-61509874 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025510832 7:61512586-61512608 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025511147 7:61518056-61518078 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025511312 7:61520790-61520812 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025511480 7:61523525-61523547 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1025511643 7:61526259-61526281 TTGAAGCCTTCTTTGGAAATGGG + Intergenic
1026205481 7:68254081-68254103 CTGTTGACAAGTCTGGAAATTGG + Intergenic
1028158457 7:87458766-87458788 CTGTAGCCATGTTTCTCATTAGG - Intronic
1028173111 7:87623157-87623179 CTGTTTCCTTGTTTGTAAATGGG + Intronic
1029486542 7:100846142-100846164 CTGAGGCCATGTTTAGAAAATGG + Intronic
1029916822 7:104218736-104218758 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1030150434 7:106399006-106399028 ATGTGGTCATATTTGGAAATAGG + Intergenic
1030535352 7:110759561-110759583 CCATAGCCATTTTTGAAAATAGG - Intronic
1031171664 7:118299345-118299367 ATGTGGCTATATTTGGAAATGGG - Intergenic
1031573469 7:123387136-123387158 ATGTGACCTTGTTTGGAAATAGG + Intergenic
1032238782 7:130145344-130145366 ATGTAACCTTATTTGGAAATAGG + Intergenic
1032900013 7:136296499-136296521 ATGTGACCATATTTGGAAATAGG + Intergenic
1032979256 7:137263255-137263277 CTGAAGCCATGTTTAGAAGGTGG - Intronic
1033342976 7:140506350-140506372 ATGTAACCATATTTGGAGATAGG - Intergenic
1034167877 7:149039520-149039542 CTGTAACCTTATTTGGAAACAGG + Intergenic
1035254009 7:157614673-157614695 GTGTGGCCATGTTTGGAGACAGG + Intronic
1035287500 7:157815534-157815556 CTGGGACCTTGTTTGGAAATAGG + Intronic
1036112559 8:5920029-5920051 CTGTTGCCGGGATTGGAAATTGG + Intergenic
1036211274 8:6843078-6843100 ATGTAACCGTATTTGGAAATAGG + Intergenic
1036504323 8:9341643-9341665 ATGTGGCTTTGTTTGGAAATAGG + Intergenic
1037125793 8:15346929-15346951 GTGTGGCCTTATTTGGAAATGGG - Intergenic
1037150820 8:15633469-15633491 CTGTGGCCTCATTTGGAAATAGG + Intronic
1037533791 8:19806280-19806302 ATGTAACCTTATTTGGAAATAGG - Intergenic
1037579298 8:20235221-20235243 ATGTGACCTTGTTTGGAAATAGG + Intergenic
1037615108 8:20512138-20512160 CTGTGGCATTGTTTGGGAATCGG - Intergenic
1037667604 8:20983821-20983843 ATGTGACCATGTTTGGAGATAGG + Intergenic
1038090082 8:24242613-24242635 CTGGGGCCTTGTTTGGAAAATGG + Intergenic
1038993668 8:32897581-32897603 GTTTAGCTATGTTTGTAAATGGG - Intergenic
1039278814 8:35959539-35959561 CTGGATCCCTGTTTGGAAAATGG + Intergenic
1039876593 8:41591693-41591715 CTGGGGCCATGTTTGGAAAATGG - Intronic
1041515868 8:58698135-58698157 CTGGAGCCATGTTTAGAAAATGG + Intergenic
1043618977 8:82164408-82164430 CTGGGGCCATGTTAGGAACTAGG + Intergenic
1043785993 8:84400589-84400611 CTGGAGCCATATTTCTAAATCGG + Intronic
1044871750 8:96626610-96626632 CTTTTCCCATGTTTGGTAATAGG - Intergenic
1044959341 8:97515210-97515232 ATGTCACCTTGTTTGGAAATAGG - Intergenic
1045013310 8:97977420-97977442 ATGTGGCCTTATTTGGAAATAGG - Intronic
1045390084 8:101706577-101706599 ATGTGACCTTGTTTGGAAATAGG + Intronic
1046507956 8:115160350-115160372 ATGTAACTTTGTTTGGAAATAGG - Intergenic
1046751461 8:117931287-117931309 ATGTATCCATGTCTGGAAAGGGG - Intronic
1047600236 8:126418873-126418895 CTGTGACCTTATTTGGAAATAGG + Intergenic
1047743971 8:127830104-127830126 ATGTAGCCTTATTTGGAAATAGG - Intergenic
1047941235 8:129829453-129829475 ATGTGGCCTTTTTTGGAAATAGG + Intergenic
1048133629 8:131724446-131724468 ATGTAGCCTTATTTGGAAATAGG + Intergenic
1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG + Intronic
1048422722 8:134293338-134293360 TTGTGGCCATATTTGGAGATGGG + Intergenic
1048581410 8:135732315-135732337 ATGTAACCTTATTTGGAAATAGG - Intergenic
1048921570 8:139236082-139236104 ATGTAACCTTATTTGGAAATAGG - Intergenic
1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG + Intergenic
1050179908 9:2910376-2910398 ATGTTACCTTGTTTGGAAATAGG + Intergenic
1051019148 9:12519447-12519469 CTGTAGGTATATTTGGATATGGG + Intergenic
1051054656 9:12970736-12970758 ATGTGACCATATTTGGAAATAGG - Intergenic
1051234879 9:14989496-14989518 CTGTGACCTTATTTGGAAATAGG + Intergenic
1052226252 9:26091465-26091487 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1052508489 9:29383942-29383964 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1053116439 9:35508164-35508186 CTGTAGACACGTTTGCAGATTGG - Intronic
1054760360 9:68999256-68999278 CCGTAACCTTATTTGGAAATAGG - Intronic
1054857697 9:69918698-69918720 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1055623268 9:78147684-78147706 CTGTAACTCTGTTTGGAGATAGG - Intergenic
1055736684 9:79337838-79337860 ATGTAGCCTTATTTGGAAATAGG + Intergenic
1056699743 9:88892330-88892352 ATGTGGCCATGTTTGGAAATAGG + Intergenic
1056935156 9:90910745-90910767 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1058986013 9:110208670-110208692 CTGTAGACATATTGGGTAATTGG - Intergenic
1059578167 9:115514325-115514347 TTGTACCAAAGTTTGGAAATAGG - Intergenic
1060050953 9:120377767-120377789 ATGTGACCTTGTTTGGAAATGGG - Intergenic
1060390459 9:123272323-123272345 TTGTGGCCAGGGTTGGAAATGGG - Intergenic
1061901065 9:133672329-133672351 ATGGGGCCTTGTTTGGAAATAGG - Intronic
1062610938 9:137373171-137373193 CTGTGGCCATGTGTGGGCATCGG + Intronic
1203416949 Un_KI270329v1:777-799 CTGAGGCCATCTTTGGAAACGGG - Intergenic
1185910380 X:3975451-3975473 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1186048839 X:5567161-5567183 CTATAGCCATGCATGAAAATTGG - Intergenic
1186475458 X:9853709-9853731 ATGTGGCCTTATTTGGAAATAGG - Intronic
1186970075 X:14832425-14832447 ATGTGGCCTTGTTTAGAAATAGG - Intergenic
1188301740 X:28513098-28513120 GTGTTGCCATTTTTGGAAAAGGG - Intergenic
1188953209 X:36402214-36402236 CTGAAGCATGGTTTGGAAATGGG + Intergenic
1189236301 X:39489756-39489778 ATGTGGTCTTGTTTGGAAATGGG + Intergenic
1189743962 X:44150848-44150870 ATGTGACCTTGTTTGGAAATAGG + Intronic
1189972273 X:46430283-46430305 ATGTAGCCTTATTTGGAAAAGGG + Intergenic
1190270699 X:48861062-48861084 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1190314332 X:49140220-49140242 CTGGATCCCTGTTTGGAAAATGG - Intergenic
1190425420 X:50330702-50330724 TTGGGGCCATGTTTGGAAAATGG - Intronic
1190771699 X:53520039-53520061 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1191917553 X:66219264-66219286 CTGGGGCCATGTTTGGAAAGTGG - Intronic
1192008374 X:67241462-67241484 CAATTGCCATGTTTTGAAATTGG - Intergenic
1192826936 X:74707108-74707130 ATGTGACCATATTTGGAAATAGG + Intergenic
1193717752 X:84951749-84951771 CTGGGGCCATGTTTTGAAAATGG + Intergenic
1194180650 X:90707312-90707334 ATGTGACCTTGTTTGGAAATAGG + Intergenic
1194384799 X:93238914-93238936 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1194467484 X:94251686-94251708 CTGTAGCCATTTCAGGAAAGTGG - Intergenic
1194600041 X:95909567-95909589 CTGTAGCAGTATTTGTAAATTGG + Intergenic
1196459649 X:115917153-115917175 CTGGAGCCATGTTTGGAAAATGG - Intergenic
1196711515 X:118768564-118768586 ATGTAACCTTATTTGGAAATAGG + Intronic
1196749226 X:119099891-119099913 CTGTACTCATATTTGAAAATGGG - Intronic
1196869693 X:120100958-120100980 CTGGAGCCATGTTTGGAAAATGG + Intergenic
1197861861 X:130979595-130979617 ATGTAGCCAGCTTTGGAAAGAGG - Intergenic
1198011029 X:132554438-132554460 CTGTAACCTTGTTTGGTAAATGG + Intergenic
1198376164 X:136042066-136042088 ATGTAACCTTGTTTGGAAATAGG - Intronic
1198644660 X:138792898-138792920 ATGTTACCATGTTTGGAAAAGGG + Intronic
1199118476 X:144021313-144021335 ATGTAAACATATTTGGAAATAGG - Intergenic
1199593749 X:149491029-149491051 ATGTAACCATATTTGGAAATAGG - Intronic
1199722476 X:150551861-150551883 ATGTGGCCTTATTTGGAAATAGG - Intergenic
1199981289 X:152921928-152921950 CTGTAACCTTATTTGGAAATAGG - Intronic
1200067938 X:153514004-153514026 ATGCAGCCTTATTTGGAAATAGG - Intergenic
1200246782 X:154530722-154530744 ATGTGGCCTTATTTGGAAATAGG + Intergenic
1200393669 X:155969662-155969684 CTGCAGCCATGTTTGGAAAATGG - Intergenic
1200527310 Y:4289468-4289490 ATGTGACCTTGTTTGGAAATAGG + Intergenic
1200943761 Y:8810979-8811001 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1201259740 Y:12147411-12147433 CTGGGGCCATGTTTGGAAAGTGG - Intergenic
1201270714 Y:12251239-12251261 TTGGGGCCATGTTTAGAAATTGG + Intergenic
1201297060 Y:12472936-12472958 CTGGGGCCATGTTTGGAAAATGG - Intergenic
1201412880 Y:13718555-13718577 ATATAGCCATGTTTTCAAATAGG + Intergenic
1201556632 Y:15269799-15269821 CTGGGGCCATGTTTGGAAAATGG + Intergenic
1201680140 Y:16636805-16636827 CTGAGGCCATGTTTGGAAATTGG - Intergenic