ID: 976993172

View in Genome Browser
Species Human (GRCh38)
Location 4:91395531-91395553
Sequence TGGTGTCAACTGAAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976993172 Original CRISPR TGGTGTCAACTGAAGGATGT GGG Intronic
905634224 1:39538639-39538661 GGGTGGCATCTGAAGGAAGTGGG + Intergenic
905906373 1:41621131-41621153 TGGTGTCACCTGTAGGAAGCCGG - Intronic
907955778 1:59226917-59226939 TGGTGTCAAATAAAGAATCTAGG + Intergenic
907993709 1:59608216-59608238 TGGGGAAAACTGAAGGATTTGGG - Intronic
908152400 1:61315815-61315837 TGCTCTCAACTCAAGGATGCAGG - Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
916178511 1:162063452-162063474 TCGTGTCATCTTAAGAATGTAGG + Intergenic
916250700 1:162735023-162735045 TGGACTCAACTGCAGGAGGTAGG + Intronic
917796399 1:178535904-178535926 TGGAGTGAACTGATGGGTGTGGG + Intronic
917969494 1:180197707-180197729 TGGTGGCATGGGAAGGATGTGGG + Exonic
919516315 1:198529590-198529612 TGGTGTGGACTGAAGGATTCTGG - Intronic
920179576 1:204124177-204124199 TGGTGGCCACGGAGGGATGTTGG + Intronic
920285601 1:204876818-204876840 TGTTGTCAACTGAAGAATCGTGG + Intronic
924708690 1:246517778-246517800 TGCTGTCAAATGAGGAATGTTGG + Intergenic
924718745 1:246603788-246603810 GGGTGACAGCTAAAGGATGTGGG + Intronic
1065824745 10:29560245-29560267 AGGTGACAGCTGAAGGGTGTAGG + Intronic
1070284753 10:75074672-75074694 TTGTGTTAAGTGAAAGATGTGGG - Intergenic
1071336398 10:84604012-84604034 TGGTGTCCACTGGAGGAAGACGG + Intergenic
1071726323 10:88201606-88201628 TGGTGTCAACTGTAGCACCTGGG - Intergenic
1072791489 10:98321383-98321405 GGTTGTAACCTGAAGGATGTGGG - Intergenic
1073456916 10:103642885-103642907 TGGTTTCAACTAAAAGCTGTAGG + Intronic
1074253168 10:111774185-111774207 TGCAGTCAGCTGAAGGATGATGG - Intergenic
1077484557 11:2832812-2832834 AGGTGACAACTGTAGGGTGTGGG + Intronic
1077962680 11:7091046-7091068 TGCTATCAATTGAAGGATTTGGG - Intergenic
1080408157 11:31998414-31998436 TGCTGGGAACTAAAGGATGTGGG + Intronic
1081626770 11:44660627-44660649 GGGTGGTAACTGAAGCATGTGGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1084278178 11:68067170-68067192 TGGTGCCAGCAGCAGGATGTCGG - Intronic
1087924912 11:103908778-103908800 TGGTGTTCAGTGAAAGATGTGGG - Exonic
1089556604 11:119318736-119318758 TGGTGTTAAGTGAAGGAAGGGGG - Intronic
1090271156 11:125387281-125387303 TTGTGTCAAATGAAGGGAGTGGG - Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091618452 12:2067402-2067424 TGGTGGCAGTTTAAGGATGTGGG + Intronic
1092015493 12:5155244-5155266 TGGTGTCTTCAGAAGGATGGTGG + Intergenic
1092352537 12:7767348-7767370 TGGTAGCAATAGAAGGATGTGGG + Intronic
1095377043 12:41542435-41542457 TGATGTCAACTGAATGAGGATGG - Intronic
1095654157 12:44649525-44649547 TGGGGACCACTGCAGGATGTGGG - Intronic
1098041362 12:66356712-66356734 AGGTGTATACTGAAGTATGTAGG - Intronic
1098244079 12:68498654-68498676 TGGTGGCAACCAAAGGATGGAGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099448455 12:82779291-82779313 TGGAGAGAACTGAAGGATTTAGG + Intronic
1100237370 12:92674263-92674285 TGGTGTCAACTGTGAGATCTAGG - Intergenic
1100343780 12:93707388-93707410 TGGTGTCAGCTGAGGAATCTGGG + Intronic
1100925765 12:99546604-99546626 TGGTGTCCACTGCAGAATTTAGG + Intronic
1105712360 13:23024380-23024402 GGGTGACAGCTGAAGGATATGGG + Intergenic
1106093405 13:26620054-26620076 TAGTGTCTACTCCAGGATGTAGG + Intronic
1107323725 13:39217015-39217037 TGGTCTCTACTGAACCATGTAGG - Intergenic
1112766623 13:102752491-102752513 TTGTGTCAACTGAAGAATGATGG - Intronic
1114654259 14:24306587-24306609 TAGAGCCAACTGATGGATGTTGG - Exonic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1119295667 14:73531079-73531101 TGGTGTCAGCTGGAAGATGAGGG - Intronic
1119299313 14:73558796-73558818 TGGTGTCAGCTGGAAGATGAGGG - Exonic
1119504445 14:75160039-75160061 TTGTGTCATCTGAAGGTTATAGG - Intronic
1120928520 14:89822769-89822791 TGGTGTCTATTGAATAATGTAGG - Intronic
1123496794 15:20834550-20834572 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
1123554026 15:21408142-21408164 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
1123572932 15:21633216-21633238 TGCTATCAACTGAAGAATGATGG - Intergenic
1123590273 15:21845507-21845529 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
1123609552 15:22075803-22075825 TGCTATCAACTGAAGAATGATGG - Intergenic
1124107933 15:26758367-26758389 TGCTTTCCTCTGAAGGATGTTGG + Intronic
1129890800 15:79070497-79070519 TGTTGTCATCTGAAACATGTAGG - Intronic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1202962374 15_KI270727v1_random:135338-135360 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
1202981794 15_KI270727v1_random:367588-367610 TGCTATCAACTGAAGAATGATGG - Intergenic
1132537641 16:490942-490964 TGGAGGCAGCTGAGGGATGTGGG + Intronic
1135218777 16:20595103-20595125 TGGTGGATACTGAAGGATGGTGG + Intergenic
1137061664 16:35795969-35795991 TGGTGTCAACGGAAGATTGCCGG + Intergenic
1137705692 16:50534314-50534336 TGGTGTCAGCTGATCCATGTGGG + Intergenic
1138420025 16:56892939-56892961 TGGGGTCCACTGCAGGAGGTGGG - Exonic
1139466505 16:67156777-67156799 TGGGGACAACTGAACCATGTGGG - Intronic
1140905101 16:79402875-79402897 TGGGCTCAGCTGAAGGATGTGGG - Intergenic
1141511404 16:84514486-84514508 TGGGGACACCTGAAGGATGAGGG - Intronic
1144047390 17:11466235-11466257 TGTTGTCAAGTCAAGAATGTTGG + Intronic
1144995773 17:19267240-19267262 TGGTGACCACTAATGGATGTTGG + Intronic
1145760278 17:27421607-27421629 TGCTGTCAAATGAGGAATGTTGG - Intergenic
1145940094 17:28738798-28738820 TGGTGTCAACTCACAGATGTGGG - Intronic
1146160297 17:30555879-30555901 TGCTGTCAAATGAGGAATGTTGG - Intergenic
1146844107 17:36172924-36172946 TGCTGTCAAATGAGGCATGTTGG + Exonic
1146856412 17:36260859-36260881 TGCTGTCAAATGAGGCATGTTGG + Exonic
1146864204 17:36327516-36327538 TGCTGTCAAATGAGGCATGTTGG - Exonic
1146872322 17:36384770-36384792 TGCTGTCAAATGAGGCATGTTGG + Exonic
1146879680 17:36435855-36435877 TGCTGTCAAATGAGGCATGTTGG + Exonic
1146883607 17:36457007-36457029 TGCTGTCAAATGAGGTATGTTGG + Intergenic
1147054848 17:37826211-37826233 TGGTGTGAATTAAAGGGTGTGGG - Intergenic
1147067065 17:37928104-37928126 TGCTGTCAAATGAGGCATGTTGG - Exonic
1147075206 17:37985394-37985416 TGCTGTCAAATGAGGCATGTTGG + Intronic
1147078597 17:38007665-38007687 TGCTGTCAAATGAGGCATGTTGG - Intronic
1147086731 17:38064940-38064962 TGCTGTCAAATGAGGCATGTTGG + Exonic
1147094535 17:38131600-38131622 TGCTGTCAAATGAGGCATGTTGG - Intergenic
1147102676 17:38188903-38188925 TGCTGTCAAATGAGGCATGTTGG + Intergenic
1149847249 17:60015370-60015392 TGCTGTCAAATGAGGCATGTTGG + Intergenic
1150085608 17:62271987-62272009 TGCTGTCAAATGAGGCATGTTGG + Intergenic
1150346085 17:64405771-64405793 TGGGGACAACAGAAGGATGAAGG + Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154454697 18:14510234-14510256 TTGTGTCAACTGCAGCTTGTTGG + Intronic
1159931560 18:74317015-74317037 TGGTGTCATCTGAGGAATGCTGG - Intronic
1160480810 18:79238314-79238336 TGCTGTCATCTCAAGGCTGTGGG + Intronic
1161258110 19:3320926-3320948 TGGTGGGAACTGGAGGATGGGGG - Intergenic
924966312 2:79779-79801 AGGTGTCAAATGGAGGATTTTGG + Intergenic
926443979 2:12921559-12921581 TAGTGTGACTTGAAGGATGTGGG + Intergenic
929847440 2:45544496-45544518 TGGTATGAAGTGAAGTATGTGGG - Intronic
937382071 2:121387425-121387447 TGGAGTCAAATGATTGATGTTGG + Intronic
938942758 2:136183323-136183345 TTGTGTTTGCTGAAGGATGTTGG + Intergenic
939258618 2:139778054-139778076 TGGTGTGCAGTGAAGGAGGTGGG + Intergenic
939900959 2:147848645-147848667 TGGGGTCTACTCAAGGATGGAGG + Intronic
940147110 2:150557463-150557485 TGGTCTGAACTGCAGGATGTTGG - Intergenic
942458096 2:176151538-176151560 TGCTGTCAACTGAATAAAGTTGG - Exonic
942638888 2:178039366-178039388 TGGGGTCTACTTAAGGATGGAGG + Intronic
942672104 2:178387346-178387368 TGGTGTTGACTGAAGAATGGAGG - Intronic
944465500 2:199996237-199996259 TGGTCTCAAAAGGAGGATGTGGG - Intronic
945615994 2:212067772-212067794 TTCTGTCAACTGAAAGAGGTAGG - Intronic
947925123 2:233914620-233914642 TGGTAGCAACTGATGGAGGTGGG - Intergenic
1169411757 20:5376865-5376887 TGGTGTCAACTGAAGCAACTGGG - Intergenic
1169753664 20:9021505-9021527 TCGTGGCAGCTGAAGGATGAGGG + Intergenic
1173606564 20:44336168-44336190 TGCTTTCACCTGAAGCATGTAGG - Intergenic
1174173805 20:48632634-48632656 TGGTGTCTGCGGAAGGATATGGG + Exonic
1176819467 21:13643074-13643096 TTGTGTCAACTGCAGCTTGTTGG - Intergenic
1177018937 21:15828447-15828469 TGGAGACAACTGACAGATGTGGG + Intronic
1178674055 21:34615465-34615487 TGGTGCCAGCTGAAGGACGCCGG + Intergenic
1178942966 21:36922969-36922991 TGGTGTCAGCTCAGGAATGTCGG - Intronic
1180971120 22:19816211-19816233 TGGTGTCATCTGAGGAATATGGG - Intronic
1181017769 22:20080887-20080909 TGGTGTCAACCGATGGACTTGGG + Intronic
1181019697 22:20092989-20093011 TGGTGACAAGTGGGGGATGTGGG + Intronic
1183758008 22:39788767-39788789 TGGTGGCTACTGAAGGTTGGGGG - Intronic
953722201 3:45366298-45366320 TGGTGTCCACATAAGAATGTTGG + Intergenic
957110344 3:75947634-75947656 TTATGTCAACTGAAGTGTGTAGG + Intronic
957805246 3:85139897-85139919 TGGAGTGAAGGGAAGGATGTAGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961439927 3:126946570-126946592 TGCTATCAACTGCAGGATGCCGG - Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
963067928 3:141278593-141278615 TGGTGGCAACTGCAGGACTTGGG - Intronic
964085523 3:152812893-152812915 TGGTGGCAAGTGAAAGGTGTTGG - Intergenic
964490472 3:157230642-157230664 TGGTGTCTCCTGGATGATGTGGG + Intergenic
967371781 3:188754823-188754845 TGATGTTAACTGAAGGCTCTAGG - Intronic
967820003 3:193831613-193831635 TGGTGGTTACTCAAGGATGTGGG + Intergenic
971841789 4:31862097-31862119 GGCTGTCATCTCAAGGATGTGGG + Intergenic
972863221 4:43198162-43198184 TGGTGTCCAGTGAAGTATTTGGG - Intergenic
973864969 4:55103579-55103601 TGGTGTGACTTGAAGGATGCTGG + Intronic
974606043 4:64151825-64151847 TAGTGTGAAAGGAAGGATGTGGG - Intergenic
975536814 4:75459775-75459797 TGGTGTCTGCTGGAGGATTTTGG + Intergenic
975845589 4:78521833-78521855 AGATGTCAACTGAAGTATTTTGG - Intronic
976428066 4:84929282-84929304 TGGTGTCATCTGAAGGTCCTGGG - Intronic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
977570195 4:98621219-98621241 TGGTTTCTACTGATGGTTGTAGG - Intronic
978683719 4:111414714-111414736 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
981121618 4:141057785-141057807 GGGTGTCAACAGTAGGGTGTTGG - Intronic
981325168 4:143438152-143438174 TGGAGTCAACTGAAGCAGATGGG - Exonic
982421308 4:155201455-155201477 TGGCATCAACTGAAGAATGATGG - Intergenic
983263164 4:165478615-165478637 TGGTGTTCACTGAAGATTGTAGG - Intronic
983386701 4:167072222-167072244 TGGTTTCAAATGAAGGCTTTGGG - Intronic
987624188 5:20376468-20376490 TGCTTTCAATTGAATGATGTTGG + Intronic
990137343 5:52662347-52662369 TGGTGTTATGTGAAGGAAGTGGG - Intergenic
990365815 5:55069298-55069320 TGGTGTATACTTAAAGATGTGGG + Intergenic
990667342 5:58088115-58088137 TGGTTTCCACTGCAGGAAGTGGG + Intergenic
993325468 5:86529603-86529625 AGGTGTTAACTCCAGGATGTGGG + Intergenic
996082569 5:119271813-119271835 TGGTATTAAATGCAGGATGTGGG - Intronic
996374414 5:122789389-122789411 TCTTGTAAACTGAAGAATGTGGG - Intronic
997834608 5:137182132-137182154 TGGTATCCATTGAAGGATGCAGG - Intronic
998160477 5:139810178-139810200 TGGAGTCAGTTGAAGGATTTGGG - Intronic
1009633484 6:66232174-66232196 TGGTGTCCAGTGAAGGACTTTGG + Intergenic
1012070604 6:94609679-94609701 TGGTGTCAACTGACAGTTGATGG + Intergenic
1014271213 6:119338760-119338782 AGGTCTCAGCTGAAGGATGTGGG + Intronic
1014585901 6:123197452-123197474 TGGTCTCCACTGAATGATCTGGG - Intergenic
1021913793 7:25411658-25411680 TGGGGTCAACAATAGGATGTGGG + Intergenic
1023543867 7:41296638-41296660 TCGTGTCAACTTGAGGATTTAGG - Intergenic
1025212567 7:57028658-57028680 AGATGCCAACTGAAGGGTGTGGG - Intergenic
1025659386 7:63548169-63548191 AGATGCCAACTGAAGGGTGTGGG + Intergenic
1026610961 7:71859499-71859521 TGATGTCAACTGGAGGTTGAAGG - Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029129229 7:98317625-98317647 TGGTGTGAACTGCAGGGTGAGGG - Intronic
1029143046 7:98425174-98425196 TGCTGTCAACTGAAGCGTGGGGG + Intergenic
1029675708 7:102067110-102067132 GGATGCCAACTGAAGGGTGTGGG - Intronic
1030582586 7:111376910-111376932 TGGTGACAGCTAAGGGATGTGGG + Intronic
1031931898 7:127694094-127694116 TGGTGTCCTCCCAAGGATGTTGG + Intronic
1038041670 8:23728499-23728521 TGGTGCCAACTGAGGGCTGTGGG - Intergenic
1038446240 8:27606171-27606193 TGGAGTCATCAAAAGGATGTAGG - Intronic
1038512559 8:28153036-28153058 TGGTTTCAAAGGTAGGATGTAGG - Intronic
1044766091 8:95575942-95575964 TGGTGTCATTTGAAAGAAGTAGG + Intergenic
1052376423 9:27722954-27722976 TGGTCTCAACTAAGGCATGTTGG - Intergenic
1054993183 9:71353891-71353913 TGGTTTCATCTGAAAGATGAGGG + Intronic
1055011175 9:71567120-71567142 TGGTGGCAACTAAAGTATATAGG + Intergenic
1203527891 Un_GL000213v1:106496-106518 TTGTGTCAACTGCAGCTTGTTGG + Intergenic
1190325448 X:49204498-49204520 TGTTGTCTACTGATGGATTTAGG + Intergenic
1193028760 X:76875119-76875141 TTGTGTCTACTGCAGGTTGTTGG - Intergenic