ID: 976994841

View in Genome Browser
Species Human (GRCh38)
Location 4:91417780-91417802
Sequence TAGGTAAACATGTGTCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18785
Summary {0: 9, 1: 187, 2: 1860, 3: 6362, 4: 10367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976994841_976994845 13 Left 976994841 4:91417780-91417802 CCACCGTGACACATGTTTACCTA 0: 9
1: 187
2: 1860
3: 6362
4: 10367
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976994841 Original CRISPR TAGGTAAACATGTGTCACGG TGG (reversed) Intronic
Too many off-targets to display for this crispr